Starting /dee2/code/volunteer_pipeline.sh ERR3079479 current disk space = 1543053705216 free memory = 1596216732 ERR3079479 SRAfilesize fdbbacb56e7f7b9af7f0691ef70ac99b ERR3079479.sra ERR3079479.sra file validated ERR3079479 is single end ERR3079479 is conventional basespace ERR3079479 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3079479_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 51 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 16.27425 14.0 14.0 27.0 2.0 33.0 2 27.394 27.0 27.0 33.0 14.0 33.0 3 29.4675 33.0 27.0 33.0 27.0 33.0 4 31.944 33.0 33.0 33.0 27.0 33.0 5 31.96075 33.0 33.0 33.0 33.0 33.0 6 35.16825 37.0 37.0 37.0 27.0 37.0 7 35.73675 37.0 37.0 37.0 33.0 37.0 8 36.277 37.0 37.0 37.0 37.0 37.0 9 36.4485 37.0 37.0 37.0 37.0 37.0 10 36.5895 37.0 37.0 37.0 37.0 37.0 11 36.6545 37.0 37.0 37.0 37.0 37.0 12 36.43225 37.0 37.0 37.0 37.0 37.0 13 36.572 37.0 37.0 37.0 37.0 37.0 14 36.6435 37.0 37.0 37.0 37.0 37.0 15 36.621 37.0 37.0 37.0 37.0 37.0 16 36.5735 37.0 37.0 37.0 37.0 37.0 17 36.57875 37.0 37.0 37.0 37.0 37.0 18 36.53825 37.0 37.0 37.0 37.0 37.0 19 36.58725 37.0 37.0 37.0 37.0 37.0 20 36.485 37.0 37.0 37.0 37.0 37.0 21 36.4725 37.0 37.0 37.0 37.0 37.0 22 36.5325 37.0 37.0 37.0 37.0 37.0 23 36.40475 37.0 37.0 37.0 37.0 37.0 24 36.44825 37.0 37.0 37.0 37.0 37.0 25 36.531 37.0 37.0 37.0 37.0 37.0 26 36.496 37.0 37.0 37.0 37.0 37.0 27 36.504 37.0 37.0 37.0 37.0 37.0 28 36.384 37.0 37.0 37.0 37.0 37.0 29 36.42875 37.0 37.0 37.0 37.0 37.0 30 36.358 37.0 37.0 37.0 37.0 37.0 31 36.304 37.0 37.0 37.0 37.0 37.0 32 36.39575 37.0 37.0 37.0 37.0 37.0 33 36.4035 37.0 37.0 37.0 37.0 37.0 34 36.52725 37.0 37.0 37.0 37.0 37.0 35 36.50525 37.0 37.0 37.0 37.0 37.0 36 36.4955 37.0 37.0 37.0 37.0 37.0 37 36.26525 37.0 37.0 37.0 37.0 37.0 38 36.47025 37.0 37.0 37.0 37.0 37.0 39 36.45525 37.0 37.0 37.0 37.0 37.0 40 36.48825 37.0 37.0 37.0 37.0 37.0 41 36.51625 37.0 37.0 37.0 37.0 37.0 42 36.45075 37.0 37.0 37.0 37.0 37.0 43 36.43325 37.0 37.0 37.0 37.0 37.0 44 36.4105 37.0 37.0 37.0 37.0 37.0 45 36.3855 37.0 37.0 37.0 37.0 37.0 46 36.45825 37.0 37.0 37.0 37.0 37.0 47 36.44525 37.0 37.0 37.0 37.0 37.0 48 36.42225 37.0 37.0 37.0 37.0 37.0 49 36.4625 37.0 37.0 37.0 37.0 37.0 50 36.41625 37.0 37.0 37.0 37.0 37.0 51 36.43875 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 4.0 25 5.0 26 3.0 27 7.0 28 12.0 29 21.0 30 39.0 31 47.0 32 75.0 33 116.0 34 234.0 35 1487.0 36 1945.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.212636695018226 21.111786148238153 4.8298906439854195 48.8456865127582 2 25.324999999999996 16.55 37.7 20.424999999999997 3 25.15 20.200000000000003 20.95 33.7 4 28.449999999999996 24.825 18.025 28.7 5 28.849999999999998 28.050000000000004 20.575 22.525000000000002 6 24.025 33.6 20.9 21.475 7 20.775 22.400000000000002 33.800000000000004 23.025000000000002 8 21.425 22.05 29.625 26.900000000000002 9 22.45 19.625 31.45 26.474999999999998 10 24.4 30.349999999999998 23.7 21.55 11 26.0 24.775 20.925 28.299999999999997 12 25.1 22.225 24.9 27.775 13 23.3 24.4 25.974999999999998 26.325 14 25.124999999999996 23.9 25.224999999999998 25.75 15 25.025 24.275 24.474999999999998 26.224999999999998 16 25.825 24.0 23.925 26.25 17 25.5 24.775 23.925 25.8 18 25.55 24.75 24.525 25.174999999999997 19 24.275 24.675 24.2 26.85 20 26.924999999999997 23.525 23.9 25.650000000000002 21 24.15 23.275000000000002 24.45 28.125 22 25.174999999999997 24.099999999999998 25.025 25.7 23 25.85 23.775 24.425 25.95 24 25.424999999999997 24.75 24.175 25.650000000000002 25 25.474999999999998 24.85 22.8 26.875 26 25.95 23.325000000000003 25.525 25.2 27 25.2 25.174999999999997 24.349999999999998 25.275 28 24.375 23.849999999999998 25.174999999999997 26.6 29 25.25 24.65 24.425 25.674999999999997 30 26.55 23.674999999999997 24.224999999999998 25.55 31 25.374999999999996 24.425 23.275000000000002 26.924999999999997 32 25.224999999999998 25.224999999999998 23.3 26.25 33 25.424999999999997 24.25 25.025 25.3 34 24.55 24.375 23.175 27.900000000000002 35 26.224999999999998 24.0 24.349999999999998 25.424999999999997 36 25.275 25.174999999999997 23.5 26.05 37 25.05 24.9 23.275000000000002 26.775 38 25.6 24.5 23.375 26.525 39 25.7 24.45 24.4 25.45 40 23.775 25.974999999999998 24.675 25.575 41 27.474999999999998 24.224999999999998 22.55 25.75 42 25.900000000000002 24.0 23.5 26.6 43 26.375 25.724999999999998 22.575 25.324999999999996 44 25.825 23.775 23.799999999999997 26.6 45 26.400000000000002 23.875 24.25 25.474999999999998 46 26.275 25.05 23.05 25.624999999999996 47 25.95 24.025 24.75 25.275 48 25.624999999999996 24.075 24.099999999999998 26.200000000000003 49 26.525 24.325 22.55 26.6 50 25.3 24.6 23.0 27.1 51 25.2 23.9 24.125 26.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.0 24 3.0 25 7.0 26 12.0 27 13.0 28 16.0 29 19.0 30 27.5 31 36.0 32 51.5 33 67.0 34 92.0 35 117.0 36 124.5 37 132.0 38 163.5 39 195.0 40 226.5 41 258.0 42 254.0 43 250.0 44 282.0 45 314.0 46 317.5 47 321.0 48 302.5 49 284.0 50 298.5 51 313.0 52 276.0 53 239.0 54 214.0 55 189.0 56 184.5 57 180.0 58 176.5 59 173.0 60 147.0 61 121.0 62 121.5 63 122.0 64 113.0 65 104.0 66 108.5 67 113.0 68 95.0 69 77.0 70 78.5 71 80.0 72 75.5 73 71.0 74 66.0 75 58.0 76 55.0 77 45.5 78 36.0 79 30.0 80 24.0 81 19.0 82 14.0 83 9.0 84 4.0 85 3.0 86 2.0 87 1.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 17.7 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39607448414695 98.75 2 0.5787619526925012 1.15 3 0.0 0.0 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 2096395 READS because READLEN < 1 Read 2096395 spots for ERR3079479.sra Written 2096395 spots for ERR3079479.sra Rejected 2096395 READS because READLEN < 1 Read 2096395 spots for ERR3079479.sra Written 2096395 spots for ERR3079479.sra Rejected 2096395 READS because READLEN < 1 Read 2096395 spots for ERR3079479.sra Written 2096395 spots for ERR3079479.sra Rejected 2096395 READS because READLEN < 1 Read 2096395 spots for ERR3079479.sra Written 2096395 spots for ERR3079479.sra Rejected 2096395 READS because READLEN < 1 Read 2096395 spots for ERR3079479.sra Written 2096395 spots for ERR3079479.sra Rejected 2096395 READS because READLEN < 1 Read 2096395 spots for ERR3079479.sra Written 2096395 spots for ERR3079479.sra Rejected 2096395 READS because READLEN < 1 Read 2096395 spots for ERR3079479.sra Written 2096395 spots for ERR3079479.sra Rejected 2096395 READS because READLEN < 1 Read 2096395 spots for ERR3079479.sra Written 2096395 spots for ERR3079479.sra Rejected 2096395 READS because READLEN < 1 Read 2096395 spots for ERR3079479.sra Written 2096395 spots for ERR3079479.sra Rejected 2096395 READS because READLEN < 1 Read 2096395 spots for ERR3079479.sra Written 2096395 spots for ERR3079479.sra Rejected 2096395 READS because READLEN < 1 Read 2096395 spots for ERR3079479.sra Written 2096395 spots for ERR3079479.sra Rejected 2096395 READS because READLEN < 1 Read 2096395 spots for ERR3079479.sra Written 2096395 spots for ERR3079479.sra Rejected 2096395 READS because READLEN < 1 Read 2096395 spots for ERR3079479.sra Written 2096395 spots for ERR3079479.sra Rejected 2096395 READS because READLEN < 1 Read 2096395 spots for ERR3079479.sra Written 2096395 spots for ERR3079479.sra Rejected 2096395 READS because READLEN < 1 Read 2096395 spots for ERR3079479.sra Written 2096395 spots for ERR3079479.sra Rejected 2096395 READS because READLEN < 1 Read 2096395 spots for ERR3079479.sra Written 2096395 spots for ERR3079479.sra Rejected 2096395 READS because READLEN < 1 Read 2096395 spots for ERR3079479.sra Written 2096395 spots for ERR3079479.sra Rejected 2096395 READS because READLEN < 1 Read 2096395 spots for ERR3079479.sra Written 2096395 spots for ERR3079479.sra Rejected 2096395 READS because READLEN < 1 Read 2096395 spots for ERR3079479.sra Written 2096395 spots for ERR3079479.sra Rejected 2096399 READS because READLEN < 1 Read 2096399 spots for ERR3079479.sra Written 2096399 spots for ERR3079479.sra SRR ids: ['ERR3079479.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j1s63fsr ERR3079479.sra spots: 41927904 blocks: [[1, 2096395], [2096396, 4192790], [4192791, 6289185], [6289186, 8385580], [8385581, 10481975], [10481976, 12578370], [12578371, 14674765], [14674766, 16771160], [16771161, 18867555], [18867556, 20963950], [20963951, 23060345], [23060346, 25156740], [25156741, 27253135], [27253136, 29349530], [29349531, 31445925], [31445926, 33542320], [33542321, 35638715], [35638716, 37735110], [37735111, 39831505], [39831506, 41927904]] ERR3079479 file size 5956301 ERR3079479 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3079479 ERR3079479_1.fastq Input file: ERR3079479_1.fastq trimmed: ERR3079479-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 13:38:48 2024 >> started Sat Dec 7 13:39:12 2024 >> done (24.422s) 41927904 reads processed; of these: 3893 ( 0.01%) short reads filtered out after trimming by size control 19583 ( 0.05%) empty reads filtered out after trimming by size control 41904428 (99.94%) reads available; of these: 56285 ( 0.13%) trimmed reads available after processing 41848143 (99.87%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 465 0.00% 19 593 0.00% 20 687 0.00% 21 789 0.00% 22 1014 0.00% 23 1223 0.00% 24 1670 0.00% 25 2104 0.01% 26 2727 0.01% 27 1978 0.00% 28 1892 0.00% 29 1697 0.00% 30 1727 0.00% 31 1668 0.00% 32 1607 0.00% 33 1627 0.00% 34 1660 0.00% 35 1672 0.00% 36 1731 0.00% 37 1774 0.00% 38 1795 0.00% 39 1741 0.00% 40 1744 0.00% 41 1783 0.00% 42 1856 0.00% 43 2020 0.00% 44 1924 0.00% 45 1973 0.00% 46 1960 0.00% 47 2169 0.01% 48 2306 0.01% 49 2158 0.01% 50 2551 0.01% 51 41848143 99.87% 41904428 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=95.16 fanout-score-rank=15 prefix-density=0.74 prefix-fanout=16.3 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=334.01 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=21.4 sequence=CCGCCGCCGCCC Started job on | Dec 07 13:39:30 Started mapping on | Dec 07 13:39:31 Finished on | Dec 07 13:40:21 Mapping speed, Million of reads per hour | 3017.12 Number of input reads | 41904428 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 35729850 Uniquely mapped reads % | 85.27% Average mapped length | 50.77 Number of splices: Total | 5700672 Number of splices: Annotated (sjdb) | 5424355 Number of splices: GT/AG | 5621098 Number of splices: GC/AG | 69732 Number of splices: AT/AC | 4688 Number of splices: Non-canonical | 5154 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.00% Deletion average length | 1.34 Insertion rate per base | 0.00% Insertion average length | 1.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1281572 % of reads mapped to multiple loci | 3.06% Number of reads mapped to too many loci | 4474887 % of reads mapped to too many loci | 10.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.71% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4893006 4893006 4893006 N_multimapping 1281572 1281572 1281572 N_noFeature 1741132 18275952 18510781 N_ambiguous 733721 28031 24207 UnstrandedReadsAssigned:33254997 PositiveStrandReadsAssigned:17425867 NegativeStrandReadsAssigned:17194862 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR3079479 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR3079479-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 41,904,428 reads, 34,389,175 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,228 rounds 52973 ERR3079479.ke.tsv 35125 ERR3079479.se.tsv 88098 total ==> ERR3079479.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 206.733 12.1042 PNS24247 1044 945 87.3695 4.53086 PNS24249 1928 1829 752.406 20.16 PNS24246 1044 945 87.3695 4.53086 PNS24248 1044 945 87.3695 4.53086 PNS24244 1471 1372 53.7523 1.91997 PNS24243 293 194 13 3.28393 KQK14069 1603 1504 502.742 16.3814 KQK14071 474 375 219.713 28.7128 ==> ERR3079479.se.tsv <== BRADI_1g14170v3 884 BRADI_1g53295v3 146 BRADI_1g59795v3 912 BRADI_1g07683v3 0 BRADI_1g00485v3 51 BRADI_1g20270v3 879 BRADI_1g74790v3 8 BRADI_1g09890v3 0 BRADI_1g77505v3 1095 BRADI_1g48960v3 0 ERR3079479 completed mapping pipeline successfully