Starting /dee2/code/volunteer_pipeline.sh ERR3079480 current disk space = 1542931558400 free memory = 1593890220 ERR3079480 SRAfilesize 11d7864847c4cca02ee9fac3f9672f46 ERR3079480.sra ERR3079480.sra file validated ERR3079480 is single end ERR3079480 is conventional basespace ERR3079480 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3079480_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.67575 33.0 33.0 33.0 27.0 33.0 2 32.0835 33.0 33.0 33.0 27.0 33.0 3 32.28575 33.0 33.0 33.0 33.0 33.0 4 32.43675 33.0 33.0 33.0 33.0 33.0 5 32.50525 33.0 33.0 33.0 33.0 33.0 6 36.0925 37.0 37.0 37.0 37.0 37.0 7 36.196 37.0 37.0 37.0 37.0 37.0 8 36.38 37.0 37.0 37.0 37.0 37.0 9 36.38425 37.0 37.0 37.0 37.0 37.0 10 36.39675 37.0 37.0 37.0 37.0 37.0 11 36.3815 37.0 37.0 37.0 37.0 37.0 12 36.3895 37.0 37.0 37.0 37.0 37.0 13 36.388 37.0 37.0 37.0 37.0 37.0 14 36.392 37.0 37.0 37.0 37.0 37.0 15 36.36975 37.0 37.0 37.0 37.0 37.0 16 36.3515 37.0 37.0 37.0 37.0 37.0 17 36.304 37.0 37.0 37.0 37.0 37.0 18 36.41 37.0 37.0 37.0 37.0 37.0 19 36.32275 37.0 37.0 37.0 37.0 37.0 20 36.34725 37.0 37.0 37.0 37.0 37.0 21 36.3685 37.0 37.0 37.0 37.0 37.0 22 36.38175 37.0 37.0 37.0 37.0 37.0 23 36.23775 37.0 37.0 37.0 37.0 37.0 24 36.21275 37.0 37.0 37.0 37.0 37.0 25 36.25525 37.0 37.0 37.0 37.0 37.0 26 36.33425 37.0 37.0 37.0 37.0 37.0 27 36.17075 37.0 37.0 37.0 37.0 37.0 28 36.2555 37.0 37.0 37.0 37.0 37.0 29 36.3175 37.0 37.0 37.0 37.0 37.0 30 36.21275 37.0 37.0 37.0 37.0 37.0 31 36.244 37.0 37.0 37.0 37.0 37.0 32 36.20325 37.0 37.0 37.0 37.0 37.0 33 36.192 37.0 37.0 37.0 37.0 37.0 34 36.23175 37.0 37.0 37.0 37.0 37.0 35 36.12075 37.0 37.0 37.0 37.0 37.0 36 36.1525 37.0 37.0 37.0 37.0 37.0 37 36.118 37.0 37.0 37.0 37.0 37.0 38 36.17925 37.0 37.0 37.0 37.0 37.0 39 36.20775 37.0 37.0 37.0 37.0 37.0 40 36.266 37.0 37.0 37.0 37.0 37.0 41 36.23175 37.0 37.0 37.0 37.0 37.0 42 36.22 37.0 37.0 37.0 37.0 37.0 43 36.19425 37.0 37.0 37.0 37.0 37.0 44 36.151 37.0 37.0 37.0 37.0 37.0 45 36.1555 37.0 37.0 37.0 37.0 37.0 46 36.04025 37.0 37.0 37.0 37.0 37.0 47 36.07375 37.0 37.0 37.0 37.0 37.0 48 35.99575 37.0 37.0 37.0 37.0 37.0 49 35.73625 37.0 37.0 37.0 37.0 37.0 50 35.86725 37.0 37.0 37.0 37.0 37.0 51 35.34325 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 1.0 12 0.0 13 1.0 14 1.0 15 1.0 16 3.0 17 3.0 18 3.0 19 2.0 20 2.0 21 1.0 22 2.0 23 3.0 24 4.0 25 13.0 26 10.0 27 14.0 28 20.0 29 34.0 30 43.0 31 56.0 32 53.0 33 82.0 34 134.0 35 463.0 36 3048.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.685729414879535 14.164680963727827 8.737092930897537 46.412496690495104 2 29.025000000000002 15.325 33.550000000000004 22.1 3 25.8 20.45 21.325 32.425 4 29.075 24.55 17.75 28.625 5 29.475 28.675 19.925 21.925 6 22.85 33.75 19.825 23.575 7 22.45 20.674999999999997 33.775 23.1 8 21.5 21.75 27.650000000000002 29.099999999999998 9 22.075 20.474999999999998 28.325 29.125 10 23.724999999999998 31.075000000000003 23.575 21.625 11 25.924999999999997 24.525 20.474999999999998 29.075 12 24.65 21.025 25.0 29.325000000000003 13 24.975 24.2 24.95 25.874999999999996 14 23.849999999999998 24.7 24.325 27.125 15 24.349999999999998 23.474999999999998 24.474999999999998 27.700000000000003 16 25.525 23.225 23.75 27.500000000000004 17 25.074999999999996 24.099999999999998 23.575 27.250000000000004 18 26.200000000000003 24.0 23.0 26.8 19 25.374999999999996 23.825 23.95 26.85 20 25.8 24.0 23.375 26.825 21 25.724999999999998 24.125 23.875 26.275 22 25.85 23.65 24.349999999999998 26.150000000000002 23 24.7 25.0 23.724999999999998 26.575 24 25.8 22.675 24.15 27.375 25 26.275 24.275 22.325 27.125 26 24.85 25.55 22.325 27.275 27 25.85 24.65 23.799999999999997 25.7 28 27.150000000000002 23.425 23.125 26.3 29 25.6 23.0 24.025 27.375 30 25.174999999999997 23.35 23.875 27.6 31 26.375 23.175 22.325 28.125 32 24.6 25.4 24.275 25.724999999999998 33 25.45 24.875 22.375 27.3 34 26.25 24.099999999999998 22.475 27.175 35 25.8 24.0 23.65 26.55 36 26.150000000000002 22.7 24.625 26.525 37 26.1 24.125 21.875 27.900000000000002 38 23.875 24.625 23.775 27.725 39 26.0 23.1 23.275000000000002 27.625 40 26.275 22.85 22.55 28.325 41 26.575 23.325000000000003 24.25 25.85 42 25.15 24.7 22.925 27.224999999999998 43 26.174999999999997 22.85 23.7 27.275 44 26.450000000000003 23.95 23.7 25.900000000000002 45 25.525 23.025000000000002 23.5 27.950000000000003 46 26.625 23.674999999999997 22.725 26.974999999999998 47 26.125 23.575 23.775 26.525 48 25.95 23.200000000000003 23.7 27.150000000000002 49 26.275 23.75 23.400000000000002 26.575 50 27.224999999999998 24.099999999999998 22.55 26.125 51 25.05 23.825 23.799999999999997 27.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 7.0 1 4.0 2 1.0 3 1.0 4 1.0 5 1.5 6 2.0 7 1.5 8 1.0 9 0.5 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 2.5 22 4.0 23 3.0 24 2.0 25 5.0 26 12.5 27 17.0 28 17.5 29 18.0 30 26.5 31 35.0 32 47.5 33 60.0 34 77.0 35 94.0 36 124.0 37 154.0 38 169.5 39 185.0 40 193.0 41 201.0 42 218.0 43 235.0 44 254.5 45 274.0 46 278.5 47 283.0 48 266.5 49 250.0 50 244.5 51 239.0 52 220.0 53 201.0 54 201.0 55 201.0 56 183.5 57 166.0 58 178.0 59 190.0 60 193.5 61 197.0 62 175.0 63 153.0 64 151.5 65 150.0 66 137.0 67 124.0 68 124.0 69 124.0 70 110.0 71 96.0 72 94.0 73 92.0 74 87.5 75 68.0 76 53.0 77 46.5 78 40.0 79 31.0 80 22.0 81 18.0 82 14.0 83 13.0 84 12.0 85 9.5 86 7.0 87 4.0 88 1.0 89 1.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47129909365559 98.775 2 0.4531722054380665 0.8999999999999999 3 0.025176233635448138 0.075 4 0.025176233635448138 0.1 5 0.0 0.0 6 0.025176233635448138 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTATG 6 0.15 TruSeq Adapter, Index 13 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 2025190 READS because READLEN < 1 Read 2025190 spots for ERR3079480.sra Written 2025190 spots for ERR3079480.sra Rejected 2025190 READS because READLEN < 1 Read 2025190 spots for ERR3079480.sra Written 2025190 spots for ERR3079480.sra Rejected 2025190 READS because READLEN < 1 Read 2025190 spots for ERR3079480.sra Written 2025190 spots for ERR3079480.sra Rejected 2025190 READS because READLEN < 1 Read 2025190 spots for ERR3079480.sra Written 2025190 spots for ERR3079480.sra Rejected 2025190 READS because READLEN < 1 Read 2025190 spots for ERR3079480.sra Written 2025190 spots for ERR3079480.sra Rejected 2025190 READS because READLEN < 1 Read 2025190 spots for ERR3079480.sra Written 2025190 spots for ERR3079480.sra Rejected 2025190 READS because READLEN < 1 Read 2025190 spots for ERR3079480.sra Written 2025190 spots for ERR3079480.sra Rejected 2025190 READS because READLEN < 1 Read 2025190 spots for ERR3079480.sra Written 2025190 spots for ERR3079480.sra Rejected 2025190 READS because READLEN < 1 Read 2025190 spots for ERR3079480.sra Written 2025190 spots for ERR3079480.sra Rejected 2025190 READS because READLEN < 1 Read 2025190 spots for ERR3079480.sra Written 2025190 spots for ERR3079480.sra Rejected 2025190 READS because READLEN < 1 Read 2025190 spots for ERR3079480.sra Written 2025190 spots for ERR3079480.sra Rejected 2025190 READS because READLEN < 1 Read 2025190 spots for ERR3079480.sra Written 2025190 spots for ERR3079480.sra Rejected 2025200 READS because READLEN < 1 Read 2025200 spots for ERR3079480.sra Written 2025200 spots for ERR3079480.sra Rejected 2025190 READS because READLEN < 1 Read 2025190 spots for ERR3079480.sra Written 2025190 spots for ERR3079480.sra Rejected 2025190 READS because READLEN < 1 Read 2025190 spots for ERR3079480.sra Written 2025190 spots for ERR3079480.sra Rejected 2025190 READS because READLEN < 1 Read 2025190 spots for ERR3079480.sra Written 2025190 spots for ERR3079480.sra Rejected 2025190 READS because READLEN < 1 Read 2025190 spots for ERR3079480.sra Written 2025190 spots for ERR3079480.sra Rejected 2025190 READS because READLEN < 1 Read 2025190 spots for ERR3079480.sra Written 2025190 spots for ERR3079480.sra Rejected 2025190 READS because READLEN < 1 Read 2025190 spots for ERR3079480.sra Written 2025190 spots for ERR3079480.sra Rejected 2025190 READS because READLEN < 1 Read 2025190 spots for ERR3079480.sra Written 2025190 spots for ERR3079480.sra SRR ids: ['ERR3079480.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i9z95i2r ERR3079480.sra spots: 40503810 blocks: [[1, 2025190], [2025191, 4050380], [4050381, 6075570], [6075571, 8100760], [8100761, 10125950], [10125951, 12151140], [12151141, 14176330], [14176331, 16201520], [16201521, 18226710], [18226711, 20251900], [20251901, 22277090], [22277091, 24302280], [24302281, 26327470], [26327471, 28352660], [28352661, 30377850], [30377851, 32403040], [32403041, 34428230], [34428231, 36453420], [36453421, 38478610], [38478611, 40503810]] ERR3079480 file size 5753256 ERR3079480 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3079480 ERR3079480_1.fastq Input file: ERR3079480_1.fastq trimmed: ERR3079480-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 13:43:18 2024 >> started Sat Dec 7 13:43:37 2024 >> done (19.338s) 40503810 reads processed; of these: 16504 ( 0.04%) short reads filtered out after trimming by size control 73629 ( 0.18%) empty reads filtered out after trimming by size control 40413677 (99.78%) reads available; of these: 1421849 ( 3.52%) trimmed reads available after processing 38991828 (96.48%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2138 0.01% 19 2484 0.01% 20 2801 0.01% 21 3235 0.01% 22 4143 0.01% 23 5112 0.01% 24 6482 0.02% 25 7820 0.02% 26 7542 0.02% 27 7705 0.02% 28 7476 0.02% 29 7496 0.02% 30 7676 0.02% 31 7865 0.02% 32 8286 0.02% 33 9159 0.02% 34 9779 0.02% 35 10915 0.03% 36 11748 0.03% 37 13247 0.03% 38 14507 0.04% 39 16085 0.04% 40 18630 0.05% 41 21919 0.05% 42 24554 0.06% 43 32062 0.08% 44 40226 0.10% 45 48521 0.12% 46 63085 0.16% 47 87337 0.22% 48 132179 0.33% 49 256956 0.64% 50 522679 1.29% 51 38991828 96.48% 40413677 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=126.96 fanout-score-rank=9 prefix-density=0.69 prefix-fanout=18.6 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=15 fanout-score=265.95 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=18.6 sequence=CGCCGCCGCCGTC Started job on | Dec 07 13:43:48 Started mapping on | Dec 07 13:43:49 Finished on | Dec 07 13:44:25 Mapping speed, Million of reads per hour | 4041.37 Number of input reads | 40413677 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 35335639 Uniquely mapped reads % | 87.43% Average mapped length | 50.68 Number of splices: Total | 5150478 Number of splices: Annotated (sjdb) | 4945393 Number of splices: GT/AG | 5084896 Number of splices: GC/AG | 57890 Number of splices: AT/AC | 3303 Number of splices: Non-canonical | 4389 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.28 Insertion rate per base | 0.00% Insertion average length | 1.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2322643 % of reads mapped to multiple loci | 5.75% Number of reads mapped to too many loci | 2528006 % of reads mapped to too many loci | 6.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.44% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2755395 2755395 2755395 N_multimapping 2322643 2322643 2322643 N_noFeature 1214213 17953685 18159375 N_ambiguous 492281 34343 25388 UnstrandedReadsAssigned:33629145 PositiveStrandReadsAssigned:17347611 NegativeStrandReadsAssigned:17150876 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR3079480 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR3079480-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,413,677 reads, 35,008,248 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,192 rounds 52973 ERR3079480.ke.tsv 35125 ERR3079480.se.tsv 88098 total ==> ERR3079480.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 65.376 3.49828 PNS24247 1044 945 58.9186 2.79243 PNS24249 1928 1829 330.657 8.09703 PNS24246 1044 945 58.9186 2.79243 PNS24248 1044 945 58.9186 2.79243 PNS24244 1471 1372 42.2108 1.37794 PNS24243 293 194 8 1.84693 KQK14069 1603 1504 3886.25 115.729 KQK14071 474 375 990.078 118.25 ==> ERR3079480.se.tsv <== BRADI_1g14170v3 5234 BRADI_1g53295v3 223 BRADI_1g59795v3 478 BRADI_1g07683v3 0 BRADI_1g00485v3 98 BRADI_1g20270v3 7024 BRADI_1g74790v3 399 BRADI_1g09890v3 33 BRADI_1g77505v3 710 BRADI_1g48960v3 2 ERR3079480 completed mapping pipeline successfully