Starting /dee2/code/volunteer_pipeline.sh ERR3079481 current disk space = 1543024107520 free memory = 1598489008 ERR3079481 SRAfilesize 832664db65ccea05427155363fce71c3 ERR3079481.sra ERR3079481.sra file validated ERR3079481 is single end ERR3079481 is conventional basespace ERR3079481 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3079481_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.8055 33.0 33.0 33.0 27.0 33.0 2 31.9845 33.0 33.0 33.0 27.0 33.0 3 32.07 33.0 33.0 33.0 33.0 33.0 4 32.2955 33.0 33.0 33.0 33.0 33.0 5 32.3085 33.0 33.0 33.0 33.0 33.0 6 35.97625 37.0 37.0 37.0 33.0 37.0 7 36.19975 37.0 37.0 37.0 37.0 37.0 8 36.28425 37.0 37.0 37.0 37.0 37.0 9 36.28875 37.0 37.0 37.0 37.0 37.0 10 36.354 37.0 37.0 37.0 37.0 37.0 11 36.32525 37.0 37.0 37.0 37.0 37.0 12 36.284 37.0 37.0 37.0 37.0 37.0 13 36.31275 37.0 37.0 37.0 37.0 37.0 14 36.3005 37.0 37.0 37.0 37.0 37.0 15 36.32375 37.0 37.0 37.0 37.0 37.0 16 36.269 37.0 37.0 37.0 37.0 37.0 17 36.1615 37.0 37.0 37.0 37.0 37.0 18 36.292 37.0 37.0 37.0 37.0 37.0 19 36.22825 37.0 37.0 37.0 37.0 37.0 20 36.1665 37.0 37.0 37.0 37.0 37.0 21 36.29975 37.0 37.0 37.0 37.0 37.0 22 36.28975 37.0 37.0 37.0 37.0 37.0 23 36.08775 37.0 37.0 37.0 37.0 37.0 24 36.0165 37.0 37.0 37.0 37.0 37.0 25 36.21425 37.0 37.0 37.0 37.0 37.0 26 36.1665 37.0 37.0 37.0 37.0 37.0 27 36.169 37.0 37.0 37.0 37.0 37.0 28 36.19425 37.0 37.0 37.0 37.0 37.0 29 36.24075 37.0 37.0 37.0 37.0 37.0 30 36.08775 37.0 37.0 37.0 37.0 37.0 31 36.16225 37.0 37.0 37.0 37.0 37.0 32 36.13575 37.0 37.0 37.0 37.0 37.0 33 36.0925 37.0 37.0 37.0 37.0 37.0 34 36.0925 37.0 37.0 37.0 37.0 37.0 35 35.99225 37.0 37.0 37.0 37.0 37.0 36 36.13975 37.0 37.0 37.0 37.0 37.0 37 36.0265 37.0 37.0 37.0 37.0 37.0 38 36.0175 37.0 37.0 37.0 37.0 37.0 39 36.118 37.0 37.0 37.0 37.0 37.0 40 36.1125 37.0 37.0 37.0 37.0 37.0 41 36.0725 37.0 37.0 37.0 37.0 37.0 42 36.1 37.0 37.0 37.0 37.0 37.0 43 36.08475 37.0 37.0 37.0 37.0 37.0 44 35.977 37.0 37.0 37.0 37.0 37.0 45 36.023 37.0 37.0 37.0 37.0 37.0 46 36.03525 37.0 37.0 37.0 37.0 37.0 47 35.95225 37.0 37.0 37.0 37.0 37.0 48 35.78125 37.0 37.0 37.0 37.0 37.0 49 35.558 37.0 37.0 37.0 37.0 37.0 50 35.5595 37.0 37.0 37.0 37.0 37.0 51 35.11575 37.0 37.0 37.0 33.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 0.0 5 2.0 6 0.0 7 2.0 8 0.0 9 1.0 10 0.0 11 1.0 12 2.0 13 0.0 14 1.0 15 0.0 16 0.0 17 0.0 18 4.0 19 4.0 20 3.0 21 2.0 22 3.0 23 4.0 24 4.0 25 10.0 26 10.0 27 20.0 28 29.0 29 23.0 30 38.0 31 54.0 32 78.0 33 95.0 34 143.0 35 452.0 36 3008.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.088219756999475 16.34970945589012 7.527733755942948 45.03433703116746 2 28.275 16.3 32.2 23.225 3 24.349999999999998 21.7 21.825 32.125 4 27.925 26.825 18.125 27.125 5 30.5 27.35 20.7 21.45 6 22.55 34.775 19.575 23.1 7 21.425 20.175 35.4 23.0 8 20.775 23.599999999999998 26.400000000000002 29.225 9 23.45 19.325 28.625 28.599999999999998 10 25.4 30.599999999999998 22.725 21.275 11 27.525 24.099999999999998 20.225 28.15 12 25.025 21.575 23.3 30.099999999999998 13 24.7 25.4 25.474999999999998 24.425 14 24.474999999999998 24.45 25.424999999999997 25.650000000000002 15 24.3 25.0 24.25 26.450000000000003 16 26.674999999999997 24.25 22.0 27.075 17 26.25 23.95 23.799999999999997 26.0 18 24.525 24.349999999999998 24.175 26.950000000000003 19 26.400000000000002 23.875 23.175 26.55 20 26.200000000000003 22.75 24.95 26.1 21 25.025 22.125 24.4 28.449999999999996 22 24.65 24.349999999999998 23.525 27.474999999999998 23 24.725 23.325000000000003 24.8 27.150000000000002 24 25.2 23.05 23.05 28.7 25 25.8 24.224999999999998 23.45 26.525 26 25.4 23.775 23.925 26.900000000000002 27 25.3 23.95 23.45 27.3 28 25.074999999999996 24.9 21.85 28.175 29 26.150000000000002 23.275000000000002 23.0 27.575 30 25.874999999999996 22.650000000000002 23.974999999999998 27.500000000000004 31 25.074999999999996 24.05 24.0 26.875 32 24.95 24.175 23.474999999999998 27.400000000000002 33 25.3 24.099999999999998 23.525 27.075 34 25.674999999999997 24.15 23.525 26.650000000000002 35 25.3 24.2 24.474999999999998 26.025 36 26.3 23.625 23.775 26.3 37 25.174999999999997 24.675 23.35 26.8 38 25.124999999999996 24.275 23.375 27.224999999999998 39 25.424999999999997 23.25 23.599999999999998 27.725 40 26.075 23.625 23.525 26.775 41 26.400000000000002 23.849999999999998 22.5 27.250000000000004 42 25.124999999999996 23.45 23.400000000000002 28.025 43 25.775 23.775 24.0 26.450000000000003 44 26.875 23.625 23.625 25.874999999999996 45 26.85 22.8 23.35 27.0 46 26.724999999999998 24.05 23.35 25.874999999999996 47 25.3 22.425 24.525 27.750000000000004 48 25.7 23.5 22.95 27.85 49 25.05 23.849999999999998 23.825 27.275 50 26.650000000000002 24.0 22.6 26.75 51 26.424999999999997 22.75 22.55 28.275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 1.5 2 3.0 3 2.0 4 1.0 5 1.0 6 1.0 7 1.0 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 2.0 22 3.0 23 3.0 24 3.0 25 7.0 26 11.5 27 12.0 28 15.0 29 18.0 30 24.5 31 31.0 32 51.5 33 72.0 34 77.5 35 83.0 36 116.5 37 150.0 38 163.5 39 177.0 40 190.5 41 204.0 42 234.5 43 265.0 44 269.5 45 274.0 46 271.5 47 269.0 48 275.0 49 281.0 50 265.5 51 250.0 52 234.0 53 218.0 54 203.5 55 189.0 56 187.0 57 185.0 58 190.5 59 196.0 60 176.5 61 157.0 62 151.0 63 145.0 64 140.0 65 135.0 66 135.0 67 135.0 68 141.0 69 147.0 70 116.5 71 86.0 72 90.5 73 95.0 74 76.5 75 52.0 76 46.0 77 41.5 78 37.0 79 27.5 80 18.0 81 17.0 82 16.0 83 14.5 84 13.0 85 11.5 86 10.0 87 6.5 88 3.0 89 2.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44612286002014 98.75 2 0.4783484390735146 0.95 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025176233635448138 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTATG 6 0.15 TruSeq Adapter, Index 3 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.025 11 0.0 0.0 0.0 0.0 0.025 12 0.0 0.0 0.0 0.0 0.025 13 0.0 0.0 0.0 0.0 0.025 14 0.0 0.0 0.0 0.0 0.025 15 0.0 0.0 0.0 0.0 0.025 16 0.0 0.0 0.0 0.0 0.025 17 0.0 0.0 0.0 0.0 0.025 18 0.0 0.0 0.0 0.0 0.025 19 0.0 0.0 0.0 0.0 0.025 20 0.0 0.0 0.0 0.0 0.025 21 0.0 0.0 0.0 0.0 0.025 22 0.0 0.0 0.0 0.0 0.025 23 0.0 0.0 0.0 0.0 0.025 24 0.0 0.0 0.0 0.0 0.025 25 0.0 0.0 0.0 0.0 0.025 26 0.0 0.0 0.0 0.0 0.025 27 0.0 0.0 0.0 0.0 0.025 28 0.0 0.0 0.0 0.0 0.025 29 0.0 0.0 0.0 0.0 0.025 30 0.0 0.0 0.0 0.0 0.025 31 0.0 0.0 0.0 0.0 0.025 32 0.0 0.0 0.0 0.0 0.025 33 0.0 0.0 0.0 0.0 0.025 34 0.0 0.0 0.0 0.0 0.025 35 0.0 0.0 0.0 0.0 0.025 36 0.0 0.0 0.0 0.0 0.025 37 0.0 0.0 0.0 0.0 0.025 38 0.0 0.0 0.0 0.0 0.025 39 0.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1854145 READS because READLEN < 1 Read 1854145 spots for ERR3079481.sra Written 1854145 spots for ERR3079481.sra Rejected 1854145 READS because READLEN < 1 Read 1854145 spots for ERR3079481.sra Written 1854145 spots for ERR3079481.sra Rejected 1854145 READS because READLEN < 1 Read 1854145 spots for ERR3079481.sra Written 1854145 spots for ERR3079481.sra Rejected 1854145 READS because READLEN < 1 Read 1854145 spots for ERR3079481.sra Written 1854145 spots for ERR3079481.sra Rejected 1854145 READS because READLEN < 1 Read 1854145 spots for ERR3079481.sra Written 1854145 spots for ERR3079481.sra Rejected 1854145 READS because READLEN < 1 Read 1854145 spots for ERR3079481.sra Written 1854145 spots for ERR3079481.sra Rejected 1854145 READS because READLEN < 1 Read 1854145 spots for ERR3079481.sra Written 1854145 spots for ERR3079481.sra Rejected 1854145 READS because READLEN < 1 Read 1854145 spots for ERR3079481.sra Written 1854145 spots for ERR3079481.sra Rejected 1854145 READS because READLEN < 1 Read 1854145 spots for ERR3079481.sra Written 1854145 spots for ERR3079481.sra Rejected 1854145 READS because READLEN < 1 Read 1854145 spots for ERR3079481.sra Written 1854145 spots for ERR3079481.sra Rejected 1854145 READS because READLEN < 1 Read 1854145 spots for ERR3079481.sra Written 1854145 spots for ERR3079481.sra Rejected 1854145 READS because READLEN < 1 Read 1854145 spots for ERR3079481.sra Written 1854145 spots for ERR3079481.sra Rejected 1854147 READS because READLEN < 1 Read 1854147 spots for ERR3079481.sra Written 1854147 spots for ERR3079481.sra Rejected 1854145 READS because READLEN < 1 Read 1854145 spots for ERR3079481.sra Written 1854145 spots for ERR3079481.sra Rejected 1854145 READS because READLEN < 1 Read 1854145 spots for ERR3079481.sra Written 1854145 spots for ERR3079481.sra Rejected 1854145 READS because READLEN < 1 Read 1854145 spots for ERR3079481.sra Written 1854145 spots for ERR3079481.sra Rejected 1854145 READS because READLEN < 1 Read 1854145 spots for ERR3079481.sra Written 1854145 spots for ERR3079481.sra Rejected 1854145 READS because READLEN < 1 Read 1854145 spots for ERR3079481.sra Written 1854145 spots for ERR3079481.sra Rejected 1854145 READS because READLEN < 1 Read 1854145 spots for ERR3079481.sra Written 1854145 spots for ERR3079481.sra Rejected 1854145 READS because READLEN < 1 Read 1854145 spots for ERR3079481.sra Written 1854145 spots for ERR3079481.sra SRR ids: ['ERR3079481.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t6yg8ynw ERR3079481.sra spots: 37082902 blocks: [[1, 1854145], [1854146, 3708290], [3708291, 5562435], [5562436, 7416580], [7416581, 9270725], [9270726, 11124870], [11124871, 12979015], [12979016, 14833160], [14833161, 16687305], [16687306, 18541450], [18541451, 20395595], [20395596, 22249740], [22249741, 24103885], [24103886, 25958030], [25958031, 27812175], [27812176, 29666320], [29666321, 31520465], [31520466, 33374610], [33374611, 35228755], [35228756, 37082902]] ERR3079481 file size 5265510 ERR3079481 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3079481 ERR3079481_1.fastq Input file: ERR3079481_1.fastq trimmed: ERR3079481-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 13:49:27 2024 >> started Sat Dec 7 13:49:50 2024 >> done (22.763s) 37082902 reads processed; of these: 27065 ( 0.07%) short reads filtered out after trimming by size control 110959 ( 0.30%) empty reads filtered out after trimming by size control 36944878 (99.63%) reads available; of these: 1388372 ( 3.76%) trimmed reads available after processing 35556506 (96.24%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2496 0.01% 19 2848 0.01% 20 2986 0.01% 21 3485 0.01% 22 4241 0.01% 23 5178 0.01% 24 6417 0.02% 25 7658 0.02% 26 7537 0.02% 27 7694 0.02% 28 7405 0.02% 29 7243 0.02% 30 7409 0.02% 31 7973 0.02% 32 8142 0.02% 33 9014 0.02% 34 9609 0.03% 35 10569 0.03% 36 11723 0.03% 37 13081 0.04% 38 14497 0.04% 39 15959 0.04% 40 18594 0.05% 41 21646 0.06% 42 24409 0.07% 43 31264 0.08% 44 38898 0.11% 45 47699 0.13% 46 62138 0.17% 47 85712 0.23% 48 128923 0.35% 49 250114 0.68% 50 505811 1.37% 51 35556506 96.24% 36944878 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=120.81 fanout-score-rank=10 prefix-density=0.71 prefix-fanout=18.4 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=18 fanout-score=266.62 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=18.4 sequence=CGCCGCCGCCGTC Started job on | Dec 07 13:50:00 Started mapping on | Dec 07 13:50:00 Finished on | Dec 07 13:50:27 Mapping speed, Million of reads per hour | 4925.98 Number of input reads | 36944878 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 32539079 Uniquely mapped reads % | 88.07% Average mapped length | 50.67 Number of splices: Total | 4767605 Number of splices: Annotated (sjdb) | 4578657 Number of splices: GT/AG | 4706928 Number of splices: GC/AG | 53628 Number of splices: AT/AC | 3376 Number of splices: Non-canonical | 3673 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.28 Insertion rate per base | 0.00% Insertion average length | 1.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2106893 % of reads mapped to multiple loci | 5.70% Number of reads mapped to too many loci | 2058262 % of reads mapped to too many loci | 5.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.54% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2298906 2298906 2298906 N_multimapping 2106893 2106893 2106893 N_noFeature 1126489 16527441 16744394 N_ambiguous 445224 32374 22836 UnstrandedReadsAssigned:30967366 PositiveStrandReadsAssigned:15979264 NegativeStrandReadsAssigned:15771849 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR3079481 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR3079481-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,944,878 reads, 32,180,648 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,240 rounds 52973 ERR3079481.ke.tsv 35125 ERR3079481.se.tsv 88098 total ==> ERR3079481.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 89.9237 5.26673 PNS24247 1044 945 21.4992 1.11528 PNS24249 1928 1829 464.288 12.4442 PNS24246 1044 945 21.4992 1.11528 PNS24248 1044 945 21.4992 1.11528 PNS24244 1471 1372 30.2908 1.0823 PNS24243 293 194 1 0.252692 KQK14069 1603 1504 3539.88 115.381 KQK14071 474 375 933.463 122.028 ==> ERR3079481.se.tsv <== BRADI_1g14170v3 4833 BRADI_1g53295v3 150 BRADI_1g59795v3 491 BRADI_1g07683v3 0 BRADI_1g00485v3 76 BRADI_1g20270v3 5878 BRADI_1g74790v3 386 BRADI_1g09890v3 28 BRADI_1g77505v3 766 BRADI_1g48960v3 0 ERR3079481 completed mapping pipeline successfully