Starting /dee2/code/volunteer_pipeline.sh ERR3079482 current disk space = 1543187750912 free memory = 1596955916 ERR3079482 SRAfilesize a3316ad456a535b1f3cd726b56286497 ERR3079482.sra ERR3079482.sra file validated ERR3079482 is single end ERR3079482 is conventional basespace ERR3079482 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3079482_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.4345 33.0 33.0 33.0 27.0 33.0 2 31.9985 33.0 33.0 33.0 27.0 33.0 3 32.18575 33.0 33.0 33.0 33.0 33.0 4 32.435 33.0 33.0 33.0 33.0 33.0 5 32.5235 33.0 33.0 33.0 33.0 33.0 6 36.0435 37.0 37.0 37.0 37.0 37.0 7 36.31175 37.0 37.0 37.0 37.0 37.0 8 36.38875 37.0 37.0 37.0 37.0 37.0 9 36.396 37.0 37.0 37.0 37.0 37.0 10 36.393 37.0 37.0 37.0 37.0 37.0 11 36.4395 37.0 37.0 37.0 37.0 37.0 12 36.389 37.0 37.0 37.0 37.0 37.0 13 36.3825 37.0 37.0 37.0 37.0 37.0 14 36.38875 37.0 37.0 37.0 37.0 37.0 15 36.463 37.0 37.0 37.0 37.0 37.0 16 36.4425 37.0 37.0 37.0 37.0 37.0 17 36.31225 37.0 37.0 37.0 37.0 37.0 18 36.45625 37.0 37.0 37.0 37.0 37.0 19 36.38725 37.0 37.0 37.0 37.0 37.0 20 36.39775 37.0 37.0 37.0 37.0 37.0 21 36.345 37.0 37.0 37.0 37.0 37.0 22 36.42 37.0 37.0 37.0 37.0 37.0 23 36.2065 37.0 37.0 37.0 37.0 37.0 24 36.246 37.0 37.0 37.0 37.0 37.0 25 36.30025 37.0 37.0 37.0 37.0 37.0 26 36.29775 37.0 37.0 37.0 37.0 37.0 27 36.30475 37.0 37.0 37.0 37.0 37.0 28 36.33775 37.0 37.0 37.0 37.0 37.0 29 36.35225 37.0 37.0 37.0 37.0 37.0 30 36.28925 37.0 37.0 37.0 37.0 37.0 31 36.33875 37.0 37.0 37.0 37.0 37.0 32 36.23625 37.0 37.0 37.0 37.0 37.0 33 36.26425 37.0 37.0 37.0 37.0 37.0 34 36.24225 37.0 37.0 37.0 37.0 37.0 35 36.14925 37.0 37.0 37.0 37.0 37.0 36 36.26075 37.0 37.0 37.0 37.0 37.0 37 36.22975 37.0 37.0 37.0 37.0 37.0 38 36.11425 37.0 37.0 37.0 37.0 37.0 39 36.2555 37.0 37.0 37.0 37.0 37.0 40 36.212 37.0 37.0 37.0 37.0 37.0 41 36.2305 37.0 37.0 37.0 37.0 37.0 42 36.13325 37.0 37.0 37.0 37.0 37.0 43 36.20375 37.0 37.0 37.0 37.0 37.0 44 36.1055 37.0 37.0 37.0 37.0 37.0 45 36.16725 37.0 37.0 37.0 37.0 37.0 46 36.1855 37.0 37.0 37.0 37.0 37.0 47 36.09975 37.0 37.0 37.0 37.0 37.0 48 36.1405 37.0 37.0 37.0 37.0 37.0 49 35.796 37.0 37.0 37.0 37.0 37.0 50 35.6925 37.0 37.0 37.0 37.0 37.0 51 35.4065 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 3.0 15 2.0 16 0.0 17 1.0 18 1.0 19 0.0 20 1.0 21 2.0 22 4.0 23 3.0 24 4.0 25 9.0 26 12.0 27 12.0 28 27.0 29 30.0 30 42.0 31 55.0 32 52.0 33 92.0 34 114.0 35 504.0 36 3026.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.7856761090326 14.698022447888828 7.509353287012292 47.00694815606627 2 27.325 16.475 33.125 23.075000000000003 3 24.375 22.1 21.7 31.825 4 28.825 25.55 17.9 27.725 5 28.9 28.9 21.2 21.0 6 22.55 34.575 20.75 22.125 7 21.925 19.875 34.275 23.925 8 21.5 21.725 28.525 28.249999999999996 9 22.3 20.925 28.749999999999996 28.025 10 24.65 30.4 23.075000000000003 21.875 11 27.775 24.875 19.3 28.050000000000004 12 24.975 21.9 24.425 28.7 13 24.474999999999998 25.2 24.45 25.874999999999996 14 24.375 25.05 25.55 25.025 15 24.8 24.15 24.275 26.775 16 25.05 23.05 23.775 28.125 17 25.4 24.7 22.775000000000002 27.125 18 25.525 24.175 23.674999999999997 26.625 19 25.900000000000002 23.775 23.474999999999998 26.85 20 24.775 23.325000000000003 24.85 27.05 21 25.85 22.75 24.05 27.35 22 27.700000000000003 23.35 22.0 26.950000000000003 23 26.0 24.7 23.799999999999997 25.5 24 24.675 24.9 24.05 26.375 25 25.0 23.5 23.075000000000003 28.425 26 23.925 25.8 22.725 27.55 27 25.5 24.075 23.875 26.55 28 26.025 24.525 22.675 26.775 29 27.075 23.625 22.650000000000002 26.650000000000002 30 25.575 23.775 23.775 26.875 31 26.3 23.1 23.724999999999998 26.875 32 25.324999999999996 23.925 23.549999999999997 27.200000000000003 33 24.3 23.400000000000002 23.95 28.349999999999998 34 25.5 23.5 23.974999999999998 27.025 35 26.950000000000003 23.400000000000002 22.25 27.400000000000002 36 25.55 23.125 23.35 27.975 37 25.624999999999996 23.175 23.075000000000003 28.125 38 26.1 24.2 23.325000000000003 26.375 39 26.625 24.0 22.725 26.650000000000002 40 25.825 23.1 23.775 27.3 41 27.450000000000003 23.1 22.650000000000002 26.8 42 25.825 23.9 23.7 26.575 43 26.25 23.400000000000002 23.7 26.650000000000002 44 25.575 23.5 23.425 27.500000000000004 45 25.575 23.925 23.7 26.8 46 27.200000000000003 22.8 22.975 27.025 47 26.224999999999998 23.3 23.1 27.375 48 25.6 23.375 23.825 27.200000000000003 49 24.975 23.150000000000002 24.325 27.55 50 26.224999999999998 22.7 23.3 27.775 51 25.775 23.775 24.0 26.450000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 6.0 1 3.0 2 0.0 3 0.0 4 0.0 5 1.5 6 3.0 7 2.0 8 1.0 9 1.0 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 2.0 20 2.0 21 1.0 22 0.0 23 1.5 24 3.0 25 8.0 26 13.0 27 13.0 28 20.0 29 27.0 30 30.0 31 33.0 32 51.5 33 70.0 34 82.5 35 95.0 36 121.0 37 147.0 38 160.5 39 174.0 40 194.5 41 215.0 42 230.5 43 246.0 44 254.0 45 262.0 46 270.0 47 278.0 48 257.5 49 237.0 50 243.0 51 249.0 52 237.5 53 226.0 54 215.5 55 205.0 56 195.0 57 185.0 58 187.0 59 189.0 60 174.0 61 159.0 62 144.0 63 129.0 64 130.5 65 132.0 66 131.5 67 131.0 68 127.0 69 123.0 70 121.5 71 120.0 72 103.5 73 87.0 74 79.5 75 71.5 76 71.0 77 56.5 78 42.0 79 31.0 80 20.0 81 20.0 82 20.0 83 13.0 84 6.0 85 5.0 86 4.0 87 2.5 88 1.0 89 1.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.45 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47169811320755 98.85000000000001 2 0.4779874213836478 0.95 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.025157232704402514 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 2085359 READS because READLEN < 1 Read 2085359 spots for ERR3079482.sra Written 2085359 spots for ERR3079482.sra Rejected 2085359 READS because READLEN < 1 Read 2085359 spots for ERR3079482.sra Written 2085359 spots for ERR3079482.sra Rejected 2085359 READS because READLEN < 1 Read 2085359 spots for ERR3079482.sra Written 2085359 spots for ERR3079482.sra Rejected 2085364 READS because READLEN < 1 Read 2085364 spots for ERR3079482.sra Written 2085364 spots for ERR3079482.sra Rejected 2085359 READS because READLEN < 1 Read 2085359 spots for ERR3079482.sra Written 2085359 spots for ERR3079482.sra Rejected 2085359 READS because READLEN < 1 Read 2085359 spots for ERR3079482.sra Written 2085359 spots for ERR3079482.sra Rejected 2085359 READS because READLEN < 1 Read 2085359 spots for ERR3079482.sra Written 2085359 spots for ERR3079482.sra Rejected 2085359 READS because READLEN < 1 Read 2085359 spots for ERR3079482.sra Written 2085359 spots for ERR3079482.sra Rejected 2085359 READS because READLEN < 1 Read 2085359 spots for ERR3079482.sra Written 2085359 spots for ERR3079482.sra Rejected 2085359 READS because READLEN < 1 Read 2085359 spots for ERR3079482.sra Written 2085359 spots for ERR3079482.sra Rejected 2085359 READS because READLEN < 1 Read 2085359 spots for ERR3079482.sra Written 2085359 spots for ERR3079482.sra Rejected 2085359 READS because READLEN < 1 Read 2085359 spots for ERR3079482.sra Written 2085359 spots for ERR3079482.sra Rejected 2085359 READS because READLEN < 1 Read 2085359 spots for ERR3079482.sra Written 2085359 spots for ERR3079482.sra Rejected 2085359 READS because READLEN < 1 Read 2085359 spots for ERR3079482.sra Written 2085359 spots for ERR3079482.sra Rejected 2085359 READS because READLEN < 1 Read 2085359 spots for ERR3079482.sra Written 2085359 spots for ERR3079482.sra Rejected 2085359 READS because READLEN < 1 Read 2085359 spots for ERR3079482.sra Written 2085359 spots for ERR3079482.sra Rejected 2085359 READS because READLEN < 1 Read 2085359 spots for ERR3079482.sra Written 2085359 spots for ERR3079482.sra Rejected 2085359 READS because READLEN < 1 Read 2085359 spots for ERR3079482.sra Written 2085359 spots for ERR3079482.sra Rejected 2085359 READS because READLEN < 1 Read 2085359 spots for ERR3079482.sra Written 2085359 spots for ERR3079482.sra Rejected 2085359 READS because READLEN < 1 Read 2085359 spots for ERR3079482.sra Written 2085359 spots for ERR3079482.sra SRR ids: ['ERR3079482.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gwpli2jw ERR3079482.sra spots: 41707185 blocks: [[1, 2085359], [2085360, 4170718], [4170719, 6256077], [6256078, 8341436], [8341437, 10426795], [10426796, 12512154], [12512155, 14597513], [14597514, 16682872], [16682873, 18768231], [18768232, 20853590], [20853591, 22938949], [22938950, 25024308], [25024309, 27109667], [27109668, 29195026], [29195027, 31280385], [31280386, 33365744], [33365745, 35451103], [35451104, 37536462], [37536463, 39621821], [39621822, 41707185]] ERR3079482 file size 5924831 ERR3079482 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3079482 ERR3079482_1.fastq Input file: ERR3079482_1.fastq trimmed: ERR3079482-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 13:54:04 2024 >> started Sat Dec 7 13:54:25 2024 >> done (21.109s) 41707185 reads processed; of these: 17193 ( 0.04%) short reads filtered out after trimming by size control 66178 ( 0.16%) empty reads filtered out after trimming by size control 41623814 (99.80%) reads available; of these: 1487658 ( 3.57%) trimmed reads available after processing 40136156 (96.43%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2289 0.01% 19 2583 0.01% 20 3003 0.01% 21 3451 0.01% 22 4171 0.01% 23 5224 0.01% 24 6518 0.02% 25 7705 0.02% 26 7726 0.02% 27 7857 0.02% 28 7585 0.02% 29 7504 0.02% 30 7723 0.02% 31 8182 0.02% 32 8617 0.02% 33 9708 0.02% 34 10130 0.02% 35 11402 0.03% 36 12298 0.03% 37 13634 0.03% 38 15287 0.04% 39 16975 0.04% 40 19380 0.05% 41 23205 0.06% 42 26118 0.06% 43 33195 0.08% 44 41711 0.10% 45 50574 0.12% 46 65945 0.16% 47 91999 0.22% 48 139491 0.34% 49 270168 0.65% 50 546300 1.31% 51 40136156 96.43% 41623814 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=119.05 fanout-score-rank=11 prefix-density=0.72 prefix-fanout=18.2 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=10 fanout-score=250.95 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=18.2 sequence=CGCCGCCGCCGTC Started job on | Dec 07 13:54:36 Started mapping on | Dec 07 13:54:36 Finished on | Dec 07 13:55:13 Mapping speed, Million of reads per hour | 4049.88 Number of input reads | 41623814 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 36153337 Uniquely mapped reads % | 86.86% Average mapped length | 50.68 Number of splices: Total | 5284616 Number of splices: Annotated (sjdb) | 5073985 Number of splices: GT/AG | 5216986 Number of splices: GC/AG | 59556 Number of splices: AT/AC | 3538 Number of splices: Non-canonical | 4536 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.29 Insertion rate per base | 0.00% Insertion average length | 1.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2245167 % of reads mapped to multiple loci | 5.39% Number of reads mapped to too many loci | 3017696 % of reads mapped to too many loci | 7.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.36% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3225310 3225310 3225310 N_multimapping 2245167 2245167 2245167 N_noFeature 1180014 18331296 18558507 N_ambiguous 498349 33687 24909 UnstrandedReadsAssigned:34474974 PositiveStrandReadsAssigned:17788354 NegativeStrandReadsAssigned:17569921 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR3079482 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR3079482-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 41,623,814 reads, 35,840,796 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,284 rounds 52973 ERR3079482.ke.tsv 35125 ERR3079482.se.tsv 88098 total ==> ERR3079482.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 87.021 4.04494 PNS24249 1928 1829 434.991 10.4469 PNS24246 1044 945 87.021 4.04494 PNS24248 1044 945 87.021 4.04494 PNS24244 1471 1372 20.9464 0.670618 PNS24243 293 194 12 2.71706 KQK14069 1603 1504 3465.98 101.227 KQK14071 474 375 910.93 106.702 ==> ERR3079482.se.tsv <== BRADI_1g14170v3 4701 BRADI_1g53295v3 107 BRADI_1g59795v3 420 BRADI_1g07683v3 0 BRADI_1g00485v3 80 BRADI_1g20270v3 7809 BRADI_1g74790v3 375 BRADI_1g09890v3 17 BRADI_1g77505v3 661 BRADI_1g48960v3 0 ERR3079482 completed mapping pipeline successfully