Starting /dee2/code/volunteer_pipeline.sh ERR3079483 current disk space = 1543213277184 free memory = 1598581484 ERR3079483 SRAfilesize c666b88c73407b4c96d9f7e25b4c5a82 ERR3079483.sra ERR3079483.sra file validated ERR3079483 is single end ERR3079483 is conventional basespace ERR3079483 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3079483_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 17.371 14.0 14.0 27.0 2.0 33.0 2 23.11125 27.0 14.0 27.0 14.0 33.0 3 23.93275 27.0 14.0 27.0 14.0 33.0 4 28.92 33.0 27.0 33.0 14.0 33.0 5 29.0645 33.0 27.0 33.0 14.0 33.0 6 34.53025 37.0 33.0 37.0 27.0 37.0 7 35.63475 37.0 37.0 37.0 33.0 37.0 8 35.53125 37.0 37.0 37.0 33.0 37.0 9 36.07 37.0 37.0 37.0 37.0 37.0 10 36.36275 37.0 37.0 37.0 37.0 37.0 11 36.34975 37.0 37.0 37.0 37.0 37.0 12 36.217 37.0 37.0 37.0 37.0 37.0 13 36.42475 37.0 37.0 37.0 37.0 37.0 14 36.457 37.0 37.0 37.0 37.0 37.0 15 36.38675 37.0 37.0 37.0 37.0 37.0 16 36.47925 37.0 37.0 37.0 37.0 37.0 17 36.4685 37.0 37.0 37.0 37.0 37.0 18 36.48325 37.0 37.0 37.0 37.0 37.0 19 36.37925 37.0 37.0 37.0 37.0 37.0 20 36.458 37.0 37.0 37.0 37.0 37.0 21 36.39875 37.0 37.0 37.0 37.0 37.0 22 36.3665 37.0 37.0 37.0 37.0 37.0 23 36.327 37.0 37.0 37.0 37.0 37.0 24 36.4395 37.0 37.0 37.0 37.0 37.0 25 36.47325 37.0 37.0 37.0 37.0 37.0 26 36.31 37.0 37.0 37.0 37.0 37.0 27 36.3965 37.0 37.0 37.0 37.0 37.0 28 36.27875 37.0 37.0 37.0 37.0 37.0 29 36.28925 37.0 37.0 37.0 37.0 37.0 30 36.1445 37.0 37.0 37.0 37.0 37.0 31 36.314 37.0 37.0 37.0 37.0 37.0 32 36.35225 37.0 37.0 37.0 37.0 37.0 33 36.2715 37.0 37.0 37.0 37.0 37.0 34 36.3735 37.0 37.0 37.0 37.0 37.0 35 36.399 37.0 37.0 37.0 37.0 37.0 36 36.3575 37.0 37.0 37.0 37.0 37.0 37 36.3105 37.0 37.0 37.0 37.0 37.0 38 36.38475 37.0 37.0 37.0 37.0 37.0 39 36.33275 37.0 37.0 37.0 37.0 37.0 40 36.4035 37.0 37.0 37.0 37.0 37.0 41 36.43825 37.0 37.0 37.0 37.0 37.0 42 36.266 37.0 37.0 37.0 37.0 37.0 43 36.1875 37.0 37.0 37.0 37.0 37.0 44 36.28125 37.0 37.0 37.0 37.0 37.0 45 36.303 37.0 37.0 37.0 37.0 37.0 46 36.269 37.0 37.0 37.0 37.0 37.0 47 36.19975 37.0 37.0 37.0 37.0 37.0 48 36.263 37.0 37.0 37.0 37.0 37.0 49 36.36825 37.0 37.0 37.0 37.0 37.0 50 36.272 37.0 37.0 37.0 37.0 37.0 51 36.333 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 1.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 3.0 25 1.0 26 14.0 27 19.0 28 16.0 29 32.0 30 58.0 31 54.0 32 84.0 33 155.0 34 466.0 35 2188.0 36 903.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.779490053236202 23.872233118520594 5.099467637993836 48.24880919024937 2 30.675 16.3 32.775 20.25 3 29.15 20.724999999999998 18.099999999999998 32.025 4 26.174999999999997 25.575 17.2 31.05 5 31.225 26.6 19.400000000000002 22.775000000000002 6 25.7 32.625 19.175 22.5 7 21.349999999999998 21.7 34.175 22.775000000000002 8 20.424999999999997 22.875 28.175 28.525 9 23.375 19.225 30.375000000000004 27.025 10 23.799999999999997 32.1 23.125 20.974999999999998 11 27.375 23.875 21.375 27.375 12 24.75 21.65 25.0 28.599999999999998 13 25.1 23.825 25.474999999999998 25.6 14 23.674999999999997 25.874999999999996 25.374999999999996 25.074999999999996 15 25.25 23.150000000000002 24.9 26.700000000000003 16 26.575 24.349999999999998 23.525 25.55 17 26.625 24.25 22.125 27.0 18 24.875 24.65 24.85 25.624999999999996 19 26.6 24.3 23.150000000000002 25.95 20 26.575 22.95 24.45 26.025 21 26.1 22.925 24.15 26.825 22 25.124999999999996 25.525 23.375 25.974999999999998 23 24.7 24.224999999999998 24.575 26.5 24 23.849999999999998 24.975 24.65 26.525 25 26.1 23.775 24.625 25.5 26 26.275 24.45 24.175 25.1 27 25.887943971985994 24.787393696848426 23.011505752876438 26.313156578289142 28 24.45 25.4 24.425 25.724999999999998 29 25.825 23.1 24.65 26.424999999999997 30 25.23130782695674 24.15603900975244 24.50612653163291 26.106526631657918 31 24.756189047261813 24.056014003500874 23.730932733183295 27.45686421605401 32 26.75 24.175 23.599999999999998 25.474999999999998 33 24.462231115557778 24.637318659329665 23.536768384192097 27.363681840920464 34 25.25 24.4 23.799999999999997 26.55 35 25.212606303151574 24.912456228114056 24.81240620310155 25.062531265632813 36 25.074999999999996 25.75 22.45 26.724999999999998 37 25.5 24.825 22.875 26.8 38 26.9567391847962 23.13078269567392 24.90622655663916 25.006251562890725 39 25.224999999999998 24.75 24.7 25.324999999999996 40 25.724999999999998 23.925 23.525 26.825 41 25.55 24.9 23.75 25.8 42 25.474999999999998 23.75 23.974999999999998 26.8 43 26.275 24.625 23.35 25.75 44 27.05 23.45 24.5 25.0 45 25.624999999999996 23.775 23.974999999999998 26.625 46 25.575 23.974999999999998 23.400000000000002 27.05 47 26.025 24.175 24.325 25.474999999999998 48 24.875 24.45 24.7 25.974999999999998 49 26.05 22.625 24.275 27.05 50 26.325 25.174999999999997 23.25 25.25 51 25.374999999999996 24.95 23.925 25.75 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.0 25 4.0 26 9.5 27 13.0 28 14.0 29 15.0 30 21.0 31 27.0 32 48.0 33 69.0 34 84.0 35 99.0 36 128.0 37 157.0 38 172.5 39 188.0 40 209.0 41 230.0 42 253.0 43 276.0 44 293.0 45 310.0 46 311.5 47 313.0 48 304.0 49 295.0 50 281.0 51 267.0 52 255.5 53 244.0 54 219.0 55 194.0 56 187.5 57 181.0 58 175.5 59 170.0 60 148.0 61 126.0 62 121.0 63 116.0 64 122.5 65 129.0 66 114.5 67 100.0 68 98.5 69 97.0 70 93.0 71 89.0 72 92.0 73 95.0 74 79.0 75 56.5 76 50.0 77 36.5 78 23.0 79 26.5 80 30.0 81 19.0 82 8.0 83 10.5 84 13.0 85 8.5 86 4.0 87 2.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.05 28 0.0 29 0.0 30 0.025 31 0.025 32 0.0 33 0.05 34 0.0 35 0.05 36 0.0 37 0.0 38 0.025 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34508816120908 98.6 2 0.5793450881612091 1.15 3 0.05037783375314861 0.15 4 0.025188916876574305 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1681645 READS because READLEN < 1 Read 1681645 spots for ERR3079483.sra Written 1681645 spots for ERR3079483.sra Rejected 1681645 READS because READLEN < 1 Read 1681645 spots for ERR3079483.sra Written 1681645 spots for ERR3079483.sra Rejected 1681645 READS because READLEN < 1 Read 1681645 spots for ERR3079483.sra Written 1681645 spots for ERR3079483.sra Rejected 1681645 READS because READLEN < 1 Read 1681645 spots for ERR3079483.sra Written 1681645 spots for ERR3079483.sra Rejected 1681645 READS because READLEN < 1 Read 1681645 spots for ERR3079483.sra Written 1681645 spots for ERR3079483.sra Rejected 1681645 READS because READLEN < 1 Read 1681645 spots for ERR3079483.sra Written 1681645 spots for ERR3079483.sra Rejected 1681645 READS because READLEN < 1 Read 1681645 spots for ERR3079483.sra Written 1681645 spots for ERR3079483.sra Rejected 1681645 READS because READLEN < 1 Read 1681645 spots for ERR3079483.sra Written 1681645 spots for ERR3079483.sra Rejected 1681645 READS because READLEN < 1 Read 1681645 spots for ERR3079483.sra Written 1681645 spots for ERR3079483.sra Rejected 1681645 READS because READLEN < 1 Read 1681645 spots for ERR3079483.sra Written 1681645 spots for ERR3079483.sra Rejected 1681645 READS because READLEN < 1 Read 1681645 spots for ERR3079483.sra Written 1681645 spots for ERR3079483.sra Rejected 1681645 READS because READLEN < 1 Read 1681645 spots for ERR3079483.sra Written 1681645 spots for ERR3079483.sra Rejected 1681645 READS because READLEN < 1 Read 1681645 spots for ERR3079483.sra Written 1681645 spots for ERR3079483.sra Rejected 1681645 READS because READLEN < 1 Read 1681645 spots for ERR3079483.sra Written 1681645 spots for ERR3079483.sra Rejected 1681655 READS because READLEN < 1 Read 1681655 spots for ERR3079483.sra Written 1681655 spots for ERR3079483.sra Rejected 1681645 READS because READLEN < 1 Read 1681645 spots for ERR3079483.sra Written 1681645 spots for ERR3079483.sra Rejected 1681645 READS because READLEN < 1 Read 1681645 spots for ERR3079483.sra Written 1681645 spots for ERR3079483.sra Rejected 1681645 READS because READLEN < 1 Read 1681645 spots for ERR3079483.sra Written 1681645 spots for ERR3079483.sra Rejected 1681645 READS because READLEN < 1 Read 1681645 spots for ERR3079483.sra Written 1681645 spots for ERR3079483.sra Rejected 1681645 READS because READLEN < 1 Read 1681645 spots for ERR3079483.sra Written 1681645 spots for ERR3079483.sra SRR ids: ['ERR3079483.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qaffam1o ERR3079483.sra spots: 33632910 blocks: [[1, 1681645], [1681646, 3363290], [3363291, 5044935], [5044936, 6726580], [6726581, 8408225], [8408226, 10089870], [10089871, 11771515], [11771516, 13453160], [13453161, 15134805], [15134806, 16816450], [16816451, 18498095], [18498096, 20179740], [20179741, 21861385], [21861386, 23543030], [23543031, 25224675], [25224676, 26906320], [26906321, 28587965], [28587966, 30269610], [30269611, 31951255], [31951256, 33632910]] ERR3079483 file size 4773616 ERR3079483 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3079483 ERR3079483_1.fastq Input file: ERR3079483_1.fastq trimmed: ERR3079483-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 13:59:30 2024 >> started Sat Dec 7 13:59:51 2024 >> done (20.821s) 33632910 reads processed; of these: 7517 ( 0.02%) short reads filtered out after trimming by size control 23814 ( 0.07%) empty reads filtered out after trimming by size control 33601579 (99.91%) reads available; of these: 47409 ( 0.14%) trimmed reads available after processing 33554170 (99.86%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 435 0.00% 19 495 0.00% 20 518 0.00% 21 697 0.00% 22 885 0.00% 23 1059 0.00% 24 1433 0.00% 25 1886 0.01% 26 2312 0.01% 27 1648 0.00% 28 1597 0.00% 29 1530 0.00% 30 1381 0.00% 31 1443 0.00% 32 1337 0.00% 33 1389 0.00% 34 1458 0.00% 35 1422 0.00% 36 1442 0.00% 37 1376 0.00% 38 1498 0.00% 39 1475 0.00% 40 1501 0.00% 41 1532 0.00% 42 1540 0.00% 43 1697 0.01% 44 1594 0.00% 45 1638 0.00% 46 1615 0.00% 47 1792 0.01% 48 1889 0.01% 49 1814 0.01% 50 2081 0.01% 51 33554170 99.86% 33601579 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=116.06 fanout-score-rank=17 prefix-density=0.66 prefix-fanout=17.9 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=26 fanout-score=350.94 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=17.9 sequence=CGCCGCCGCCACC Started job on | Dec 07 14:00:05 Started mapping on | Dec 07 14:00:05 Finished on | Dec 07 14:00:43 Mapping speed, Million of reads per hour | 3183.31 Number of input reads | 33601579 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 28488964 Uniquely mapped reads % | 84.78% Average mapped length | 50.76 Number of splices: Total | 4437742 Number of splices: Annotated (sjdb) | 4230721 Number of splices: GT/AG | 4375378 Number of splices: GC/AG | 55003 Number of splices: AT/AC | 3472 Number of splices: Non-canonical | 3889 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.00% Deletion average length | 1.34 Insertion rate per base | 0.00% Insertion average length | 1.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1009417 % of reads mapped to multiple loci | 3.00% Number of reads mapped to too many loci | 3765325 % of reads mapped to too many loci | 11.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.70% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4103198 4103198 4103198 N_multimapping 1009417 1009417 1009417 N_noFeature 1415186 14598421 14881190 N_ambiguous 464489 22703 19839 UnstrandedReadsAssigned:26609289 PositiveStrandReadsAssigned:13867840 NegativeStrandReadsAssigned:13587935 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR3079483 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR3079483-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,601,579 reads, 27,354,101 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,294 rounds 52973 ERR3079483.ke.tsv 35125 ERR3079483.se.tsv 88098 total ==> ERR3079483.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0.00198391 0.000149232 PNS24247 1044 945 91.9848 6.12844 PNS24249 1928 1829 541.602 18.6437 PNS24246 1044 945 91.9848 6.12844 PNS24248 1044 945 91.9848 6.12844 PNS24244 1471 1372 13.4419 0.61684 PNS24243 293 194 17 5.51713 KQK14069 1603 1504 13271.2 555.555 KQK14071 474 375 4688.72 787.207 ==> ERR3079483.se.tsv <== BRADI_1g14170v3 19630 BRADI_1g53295v3 129 BRADI_1g59795v3 738 BRADI_1g07683v3 0 BRADI_1g00485v3 33 BRADI_1g20270v3 752 BRADI_1g74790v3 154 BRADI_1g09890v3 1 BRADI_1g77505v3 589 BRADI_1g48960v3 1 ERR3079483 completed mapping pipeline successfully