Starting /dee2/code/volunteer_pipeline.sh ERR3079484 current disk space = 1543188844544 free memory = 1596577808 ERR3079484 SRAfilesize 7c2349b3890d8de4454e78100ecd6186 ERR3079484.sra ERR3079484.sra file validated ERR3079484 is single end ERR3079484 is conventional basespace ERR3079484 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3079484_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.27575 33.0 14.0 33.0 2.0 33.0 2 30.707 33.0 27.0 33.0 27.0 33.0 3 31.285 33.0 33.0 33.0 27.0 33.0 4 32.26 33.0 33.0 33.0 33.0 33.0 5 32.55675 33.0 33.0 33.0 33.0 33.0 6 35.882 37.0 37.0 37.0 33.0 37.0 7 36.3135 37.0 37.0 37.0 37.0 37.0 8 36.41825 37.0 37.0 37.0 37.0 37.0 9 36.424 37.0 37.0 37.0 37.0 37.0 10 36.5755 37.0 37.0 37.0 37.0 37.0 11 36.57325 37.0 37.0 37.0 37.0 37.0 12 36.3465 37.0 37.0 37.0 37.0 37.0 13 36.52175 37.0 37.0 37.0 37.0 37.0 14 36.568 37.0 37.0 37.0 37.0 37.0 15 36.52675 37.0 37.0 37.0 37.0 37.0 16 36.53025 37.0 37.0 37.0 37.0 37.0 17 36.5325 37.0 37.0 37.0 37.0 37.0 18 36.59125 37.0 37.0 37.0 37.0 37.0 19 36.484 37.0 37.0 37.0 37.0 37.0 20 36.478 37.0 37.0 37.0 37.0 37.0 21 36.4715 37.0 37.0 37.0 37.0 37.0 22 36.48725 37.0 37.0 37.0 37.0 37.0 23 36.447 37.0 37.0 37.0 37.0 37.0 24 36.48625 37.0 37.0 37.0 37.0 37.0 25 36.4815 37.0 37.0 37.0 37.0 37.0 26 36.38825 37.0 37.0 37.0 37.0 37.0 27 36.50425 37.0 37.0 37.0 37.0 37.0 28 36.37825 37.0 37.0 37.0 37.0 37.0 29 36.3725 37.0 37.0 37.0 37.0 37.0 30 36.43275 37.0 37.0 37.0 37.0 37.0 31 36.2945 37.0 37.0 37.0 37.0 37.0 32 36.34675 37.0 37.0 37.0 37.0 37.0 33 36.37025 37.0 37.0 37.0 37.0 37.0 34 36.4885 37.0 37.0 37.0 37.0 37.0 35 36.4435 37.0 37.0 37.0 37.0 37.0 36 36.4525 37.0 37.0 37.0 37.0 37.0 37 36.23225 37.0 37.0 37.0 37.0 37.0 38 36.42575 37.0 37.0 37.0 37.0 37.0 39 36.421 37.0 37.0 37.0 37.0 37.0 40 36.42325 37.0 37.0 37.0 37.0 37.0 41 36.4635 37.0 37.0 37.0 37.0 37.0 42 36.32325 37.0 37.0 37.0 37.0 37.0 43 36.30725 37.0 37.0 37.0 37.0 37.0 44 36.29675 37.0 37.0 37.0 37.0 37.0 45 36.315 37.0 37.0 37.0 37.0 37.0 46 36.33425 37.0 37.0 37.0 37.0 37.0 47 36.34275 37.0 37.0 37.0 37.0 37.0 48 36.2995 37.0 37.0 37.0 37.0 37.0 49 36.364 37.0 37.0 37.0 37.0 37.0 50 36.35975 37.0 37.0 37.0 37.0 37.0 51 36.436 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 2.0 25 6.0 26 6.0 27 6.0 28 17.0 29 30.0 30 29.0 31 46.0 32 61.0 33 118.0 34 177.0 35 887.0 36 2610.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.446508840275698 15.253221456397961 7.222055738687444 47.0782139646389 2 26.05 15.825 36.7 21.425 3 24.725 20.75 21.2 33.324999999999996 4 26.974999999999998 24.0 19.950000000000003 29.075 5 29.549999999999997 26.700000000000003 21.625 22.125 6 24.75 31.6 20.974999999999998 22.675 7 20.974999999999998 21.25 34.875 22.900000000000002 8 20.674999999999997 22.75 28.975 27.6 9 22.6 19.5 32.35 25.55 10 23.799999999999997 31.55 23.674999999999997 20.974999999999998 11 26.1 25.75 20.7 27.450000000000003 12 24.875 22.025 24.55 28.549999999999997 13 23.400000000000002 24.025 26.450000000000003 26.125 14 23.375 24.975 26.825 24.825 15 25.45 23.599999999999998 24.775 26.174999999999997 16 25.85 23.400000000000002 23.175 27.575 17 25.275 24.275 24.875 25.575 18 25.55 23.75 24.425 26.275 19 25.4 24.075 23.525 27.0 20 25.724999999999998 24.5 25.025 24.75 21 26.150000000000002 23.674999999999997 24.0 26.174999999999997 22 25.474999999999998 24.525 23.25 26.75 23 24.8 24.275 24.25 26.674999999999997 24 24.325 24.8 23.325000000000003 27.55 25 24.15 25.0 23.575 27.275 26 24.75 23.974999999999998 24.85 26.424999999999997 27 26.025 23.1 23.375 27.500000000000004 28 24.775 24.725 23.775 26.724999999999998 29 24.85 24.7 24.474999999999998 25.974999999999998 30 26.200000000000003 24.625 23.5 25.674999999999997 31 25.374999999999996 24.25 22.900000000000002 27.474999999999998 32 25.95 23.799999999999997 25.074999999999996 25.174999999999997 33 26.75 23.925 23.375 25.95 34 25.275 24.55 23.825 26.35 35 24.9 24.975 23.549999999999997 26.575 36 25.95 24.7 23.025000000000002 26.325 37 25.674999999999997 24.875 23.3 26.150000000000002 38 24.3 24.625 23.400000000000002 27.675 39 25.15 24.2 24.575 26.075 40 24.625 25.374999999999996 24.0 26.0 41 25.5 24.525 24.9 25.074999999999996 42 27.0 23.575 22.900000000000002 26.525 43 25.85 23.799999999999997 23.325000000000003 27.025 44 24.3 23.75 25.95 26.0 45 27.224999999999998 22.975 23.575 26.224999999999998 46 25.5 22.95 24.6 26.950000000000003 47 24.85 24.65 24.6 25.900000000000002 48 25.124999999999996 24.075 23.3 27.500000000000004 49 25.45 25.25 23.724999999999998 25.575 50 26.775 23.425 23.575 26.224999999999998 51 25.55 23.3 24.25 26.900000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.0 23 1.5 24 3.0 25 4.0 26 7.5 27 10.0 28 11.0 29 12.0 30 24.5 31 37.0 32 48.5 33 60.0 34 79.0 35 98.0 36 120.0 37 142.0 38 171.5 39 201.0 40 239.5 41 278.0 42 265.5 43 253.0 44 279.5 45 306.0 46 306.5 47 307.0 48 304.0 49 301.0 50 282.5 51 264.0 52 270.0 53 276.0 54 246.5 55 217.0 56 195.0 57 173.0 58 161.5 59 150.0 60 139.0 61 128.0 62 119.5 63 111.0 64 108.5 65 106.0 66 106.0 67 106.0 68 103.0 69 100.0 70 96.5 71 93.0 72 84.5 73 76.0 74 69.5 75 53.5 76 44.0 77 37.0 78 30.0 79 25.5 80 21.0 81 18.5 82 16.0 83 10.0 84 4.0 85 3.0 86 2.0 87 2.5 88 3.0 89 2.0 90 1.0 91 1.0 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 16.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 2133363 READS because READLEN < 1 Read 2133363 spots for ERR3079484.sra Written 2133363 spots for ERR3079484.sra Rejected 2133363 READS because READLEN < 1 Read 2133363 spots for ERR3079484.sra Written 2133363 spots for ERR3079484.sra Rejected 2133363 READS because READLEN < 1 Read 2133363 spots for ERR3079484.sra Written 2133363 spots for ERR3079484.sra Rejected 2133363 READS because READLEN < 1 Read 2133363 spots for ERR3079484.sra Written 2133363 spots for ERR3079484.sra Rejected 2133363 READS because READLEN < 1 Read 2133363 spots for ERR3079484.sra Written 2133363 spots for ERR3079484.sra Rejected 2133363 READS because READLEN < 1 Read 2133363 spots for ERR3079484.sra Written 2133363 spots for ERR3079484.sra Rejected 2133363 READS because READLEN < 1 Read 2133363 spots for ERR3079484.sra Written 2133363 spots for ERR3079484.sra Rejected 2133363 READS because READLEN < 1 Read 2133363 spots for ERR3079484.sra Written 2133363 spots for ERR3079484.sra Rejected 2133363 READS because READLEN < 1 Read 2133363 spots for ERR3079484.sra Written 2133363 spots for ERR3079484.sra Rejected 2133365 READS because READLEN < 1 Read 2133365 spots for ERR3079484.sra Written 2133365 spots for ERR3079484.sra Rejected 2133363 READS because READLEN < 1 Read 2133363 spots for ERR3079484.sra Written 2133363 spots for ERR3079484.sra Rejected 2133363 READS because READLEN < 1 Read 2133363 spots for ERR3079484.sra Written 2133363 spots for ERR3079484.sra Rejected 2133363 READS because READLEN < 1 Read 2133363 spots for ERR3079484.sra Written 2133363 spots for ERR3079484.sra Rejected 2133363 READS because READLEN < 1 Read 2133363 spots for ERR3079484.sra Written 2133363 spots for ERR3079484.sra Rejected 2133363 READS because READLEN < 1 Read 2133363 spots for ERR3079484.sra Written 2133363 spots for ERR3079484.sra Rejected 2133363 READS because READLEN < 1 Read 2133363 spots for ERR3079484.sra Written 2133363 spots for ERR3079484.sra Rejected 2133363 READS because READLEN < 1 Read 2133363 spots for ERR3079484.sra Written 2133363 spots for ERR3079484.sra Rejected 2133363 READS because READLEN < 1 Read 2133363 spots for ERR3079484.sra Written 2133363 spots for ERR3079484.sra Rejected 2133363 READS because READLEN < 1 Read 2133363 spots for ERR3079484.sra Written 2133363 spots for ERR3079484.sra Rejected 2133363 READS because READLEN < 1 Read 2133363 spots for ERR3079484.sra Written 2133363 spots for ERR3079484.sra SRR ids: ['ERR3079484.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hi4gx6zq ERR3079484.sra spots: 42667262 blocks: [[1, 2133363], [2133364, 4266726], [4266727, 6400089], [6400090, 8533452], [8533453, 10666815], [10666816, 12800178], [12800179, 14933541], [14933542, 17066904], [17066905, 19200267], [19200268, 21333630], [21333631, 23466993], [23466994, 25600356], [25600357, 27733719], [27733720, 29867082], [29867083, 32000445], [32000446, 34133808], [34133809, 36267171], [36267172, 38400534], [38400535, 40533897], [40533898, 42667262]] ERR3079484 file size 6061717 ERR3079484 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3079484 ERR3079484_1.fastq Input file: ERR3079484_1.fastq trimmed: ERR3079484-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 14:05:22 2024 >> started Sat Dec 7 14:05:39 2024 >> done (17.266s) 42667262 reads processed; of these: 4391 ( 0.01%) short reads filtered out after trimming by size control 26312 ( 0.06%) empty reads filtered out after trimming by size control 42636559 (99.93%) reads available; of these: 61270 ( 0.14%) trimmed reads available after processing 42575289 (99.86%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 567 0.00% 19 682 0.00% 20 733 0.00% 21 890 0.00% 22 1134 0.00% 23 1453 0.00% 24 1964 0.00% 25 2435 0.01% 26 3216 0.01% 27 2304 0.01% 28 2275 0.01% 29 1959 0.00% 30 1979 0.00% 31 1768 0.00% 32 1765 0.00% 33 1725 0.00% 34 1878 0.00% 35 1763 0.00% 36 1892 0.00% 37 1735 0.00% 38 1826 0.00% 39 1796 0.00% 40 1873 0.00% 41 1897 0.00% 42 1997 0.00% 43 2007 0.00% 44 1999 0.00% 45 2019 0.00% 46 2134 0.01% 47 2211 0.01% 48 2421 0.01% 49 2327 0.01% 50 2646 0.01% 51 42575289 99.86% 42636559 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=109.53 fanout-score-rank=16 prefix-density=0.71 prefix-fanout=17.7 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=338.17 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=21.4 sequence=CCGCCGCCGCCC Started job on | Dec 07 14:05:49 Started mapping on | Dec 07 14:05:49 Finished on | Dec 07 14:06:41 Mapping speed, Million of reads per hour | 2951.76 Number of input reads | 42636559 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 36462507 Uniquely mapped reads % | 85.52% Average mapped length | 50.77 Number of splices: Total | 5736618 Number of splices: Annotated (sjdb) | 5472946 Number of splices: GT/AG | 5656944 Number of splices: GC/AG | 69972 Number of splices: AT/AC | 4667 Number of splices: Non-canonical | 5035 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.00% Deletion average length | 1.33 Insertion rate per base | 0.00% Insertion average length | 1.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1296776 % of reads mapped to multiple loci | 3.04% Number of reads mapped to too many loci | 4466088 % of reads mapped to too many loci | 10.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.67% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4877276 4877276 4877276 N_multimapping 1296776 1296776 1296776 N_noFeature 1716428 18721547 18830476 N_ambiguous 676708 28339 24742 UnstrandedReadsAssigned:34069371 PositiveStrandReadsAssigned:17712621 NegativeStrandReadsAssigned:17607289 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR3079484 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR3079484-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 42,636,559 reads, 35,134,511 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,259 rounds 52973 ERR3079484.ke.tsv 35125 ERR3079484.se.tsv 88098 total ==> ERR3079484.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 85.6324 4.94261 PNS24247 1044 945 84.042 4.29643 PNS24249 1928 1829 667.009 17.6182 PNS24246 1044 945 84.042 4.29643 PNS24248 1044 945 84.042 4.29643 PNS24244 1471 1372 47.2329 1.66316 PNS24243 293 194 14 3.48634 KQK14069 1603 1504 8006.67 257.186 KQK14071 474 375 2648.81 341.243 ==> ERR3079484.se.tsv <== BRADI_1g14170v3 12308 BRADI_1g53295v3 167 BRADI_1g59795v3 754 BRADI_1g07683v3 0 BRADI_1g00485v3 44 BRADI_1g20270v3 1187 BRADI_1g74790v3 174 BRADI_1g09890v3 3 BRADI_1g77505v3 747 BRADI_1g48960v3 1 ERR3079484 completed mapping pipeline successfully