Starting /dee2/code/volunteer_pipeline.sh ERR3079485 current disk space = 1543039778816 free memory = 1592956992 ERR3079485 SRAfilesize 422c3c0cf159e9c15519d23914a33f9f ERR3079485.sra ERR3079485.sra file validated ERR3079485 is single end ERR3079485 is conventional basespace ERR3079485 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3079485_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.45725 33.0 14.0 33.0 2.0 33.0 2 25.26875 27.0 14.0 33.0 14.0 33.0 3 28.41975 27.0 27.0 33.0 14.0 33.0 4 32.1065 33.0 33.0 33.0 27.0 33.0 5 32.52925 33.0 33.0 33.0 33.0 33.0 6 35.58875 37.0 37.0 37.0 33.0 37.0 7 35.85925 37.0 37.0 37.0 33.0 37.0 8 36.14575 37.0 37.0 37.0 37.0 37.0 9 36.304 37.0 37.0 37.0 37.0 37.0 10 36.47775 37.0 37.0 37.0 37.0 37.0 11 36.55375 37.0 37.0 37.0 37.0 37.0 12 36.4185 37.0 37.0 37.0 37.0 37.0 13 36.5365 37.0 37.0 37.0 37.0 37.0 14 36.57525 37.0 37.0 37.0 37.0 37.0 15 36.55125 37.0 37.0 37.0 37.0 37.0 16 36.6145 37.0 37.0 37.0 37.0 37.0 17 36.55375 37.0 37.0 37.0 37.0 37.0 18 36.541 37.0 37.0 37.0 37.0 37.0 19 36.51375 37.0 37.0 37.0 37.0 37.0 20 36.465 37.0 37.0 37.0 37.0 37.0 21 36.47425 37.0 37.0 37.0 37.0 37.0 22 36.519 37.0 37.0 37.0 37.0 37.0 23 36.46325 37.0 37.0 37.0 37.0 37.0 24 36.487 37.0 37.0 37.0 37.0 37.0 25 36.50875 37.0 37.0 37.0 37.0 37.0 26 36.507 37.0 37.0 37.0 37.0 37.0 27 36.47425 37.0 37.0 37.0 37.0 37.0 28 36.385 37.0 37.0 37.0 37.0 37.0 29 36.41 37.0 37.0 37.0 37.0 37.0 30 36.3235 37.0 37.0 37.0 37.0 37.0 31 36.3355 37.0 37.0 37.0 37.0 37.0 32 36.36775 37.0 37.0 37.0 37.0 37.0 33 36.34425 37.0 37.0 37.0 37.0 37.0 34 36.4525 37.0 37.0 37.0 37.0 37.0 35 36.4395 37.0 37.0 37.0 37.0 37.0 36 36.49925 37.0 37.0 37.0 37.0 37.0 37 36.3725 37.0 37.0 37.0 37.0 37.0 38 36.4055 37.0 37.0 37.0 37.0 37.0 39 36.3445 37.0 37.0 37.0 37.0 37.0 40 36.402 37.0 37.0 37.0 37.0 37.0 41 36.43425 37.0 37.0 37.0 37.0 37.0 42 36.342 37.0 37.0 37.0 37.0 37.0 43 36.34725 37.0 37.0 37.0 37.0 37.0 44 36.3345 37.0 37.0 37.0 37.0 37.0 45 36.32 37.0 37.0 37.0 37.0 37.0 46 36.412 37.0 37.0 37.0 37.0 37.0 47 36.331 37.0 37.0 37.0 37.0 37.0 48 36.3825 37.0 37.0 37.0 37.0 37.0 49 36.439 37.0 37.0 37.0 37.0 37.0 50 36.37225 37.0 37.0 37.0 37.0 37.0 51 36.3175 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 5.0 25 9.0 26 8.0 27 12.0 28 22.0 29 25.0 30 34.0 31 41.0 32 69.0 33 99.0 34 219.0 35 1307.0 36 2145.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.312775330396477 12.511013215859032 5.961820851688692 54.21439060205579 2 25.6 15.575 35.325 23.5 3 23.125 20.325 22.650000000000002 33.900000000000006 4 28.225 24.15 19.475 28.15 5 28.875 27.025 22.375 21.725 6 24.95 32.05 20.474999999999998 22.525000000000002 7 22.275 21.425 33.900000000000006 22.400000000000002 8 21.025 22.325 29.849999999999998 26.8 9 23.05 19.5 30.525000000000002 26.924999999999997 10 23.425 31.075000000000003 24.025 21.475 11 27.750000000000004 24.85 20.75 26.650000000000002 12 24.5 22.025 24.125 29.349999999999998 13 24.95 23.474999999999998 25.775 25.8 14 25.63140785196299 24.431107776944234 25.531382845711427 24.406101525381345 15 25.95 23.325000000000003 23.875 26.85 16 24.65 23.9 24.625 26.825 17 26.025 22.375 25.45 26.150000000000002 18 25.124999999999996 24.2 24.375 26.3 19 25.1 24.175 24.325 26.400000000000002 20 27.325 24.099999999999998 24.15 24.425 21 26.275 23.7 23.075000000000003 26.950000000000003 22 25.4 23.5 23.425 27.675 23 24.5 25.124999999999996 25.124999999999996 25.25 24 24.075 24.4 25.224999999999998 26.3 25 26.674999999999997 23.875 22.875 26.575 26 26.25 23.674999999999997 24.75 25.324999999999996 27 25.43815723585378 24.812218327491237 24.361542313470206 25.38808212318478 28 25.737868934467233 24.562281140570285 23.36168084042021 26.338169084542272 29 25.15 24.85 24.975 25.025 30 25.963945918878316 23.910866299449175 23.43515272909364 26.69003505257887 31 25.087631447170754 24.837255883825737 24.812218327491237 25.262894341512272 32 25.381345336334082 24.656164041010253 24.681170292573142 25.28132033008252 33 25.463194792188283 23.034551827741613 25.01251877816725 26.489734601902853 34 25.624999999999996 24.025 24.05 26.3 35 25.187781672508763 25.41311967951928 23.83575363044567 25.56334501752629 36 25.0 23.925 24.325 26.75 37 25.475475475475474 24.84984984984985 23.473473473473476 26.2012012012012 38 25.162744116174263 24.13620430645969 24.586880320480724 26.114171256885328 39 25.025 24.95 23.275000000000002 26.75 40 25.624999999999996 23.549999999999997 24.6 26.224999999999998 41 26.0 23.150000000000002 25.35 25.5 42 24.987493746873437 24.462231115557778 24.362181090545274 26.18809404702351 43 25.1 24.349999999999998 23.425 27.125 44 25.825825825825827 24.624624624624623 23.773773773773772 25.775775775775777 45 25.475475475475474 23.2982982982983 24.64964964964965 26.576576576576578 46 25.424999999999997 23.674999999999997 24.099999999999998 26.8 47 26.674999999999997 24.125 24.0 25.2 48 26.05 23.625 24.2 26.125 49 24.16208104052026 24.787393696848426 24.112056028014006 26.93846923461731 50 26.151151151151154 24.124124124124123 23.823823823823822 25.900900900900904 51 26.126126126126124 24.024024024024023 24.424424424424423 25.425425425425423 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 1.5 20 1.0 21 0.5 22 0.0 23 0.5 24 1.0 25 2.0 26 6.0 27 9.0 28 19.0 29 29.0 30 35.5 31 42.0 32 54.5 33 67.0 34 80.5 35 94.0 36 123.0 37 152.0 38 168.5 39 185.0 40 207.5 41 230.0 42 262.5 43 295.0 44 311.5 45 328.0 46 309.0 47 290.0 48 301.0 49 312.0 50 278.5 51 245.0 52 237.0 53 229.0 54 210.0 55 191.0 56 189.5 57 188.0 58 167.5 59 147.0 60 154.5 61 162.0 62 137.0 63 112.0 64 111.5 65 111.0 66 109.0 67 107.0 68 104.0 69 101.0 70 99.0 71 97.0 72 93.5 73 90.0 74 71.5 75 49.0 76 45.0 77 39.5 78 34.0 79 27.5 80 21.0 81 16.5 82 12.0 83 11.5 84 11.0 85 5.5 86 0.0 87 1.0 88 2.0 89 1.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 14.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.025 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.15 28 0.05 29 0.0 30 0.15 31 0.15 32 0.025 33 0.15 34 0.0 35 0.15 36 0.0 37 0.1 38 0.15 39 0.0 40 0.0 41 0.0 42 0.05 43 0.0 44 0.1 45 0.1 46 0.0 47 0.0 48 0.0 49 0.05 50 0.1 51 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 2075009 READS because READLEN < 1 Read 2075009 spots for ERR3079485.sra Written 2075009 spots for ERR3079485.sra Rejected 2075009 READS because READLEN < 1 Read 2075009 spots for ERR3079485.sra Written 2075009 spots for ERR3079485.sra Rejected 2075009 READS because READLEN < 1 Read 2075009 spots for ERR3079485.sra Written 2075009 spots for ERR3079485.sra Rejected 2075009 READS because READLEN < 1 Read 2075009 spots for ERR3079485.sra Written 2075009 spots for ERR3079485.sra Rejected 2075009 READS because READLEN < 1 Read 2075009 spots for ERR3079485.sra Written 2075009 spots for ERR3079485.sra Rejected 2075009 READS because READLEN < 1 Read 2075009 spots for ERR3079485.sra Written 2075009 spots for ERR3079485.sra Rejected 2075009 READS because READLEN < 1 Read 2075009 spots for ERR3079485.sra Written 2075009 spots for ERR3079485.sra Rejected 2075009 READS because READLEN < 1 Read 2075009 spots for ERR3079485.sra Written 2075009 spots for ERR3079485.sra Rejected 2075009 READS because READLEN < 1 Read 2075009 spots for ERR3079485.sra Written 2075009 spots for ERR3079485.sra Rejected 2075009 READS because READLEN < 1 Read 2075009 spots for ERR3079485.sra Written 2075009 spots for ERR3079485.sra Rejected 2075009 READS because READLEN < 1 Read 2075009 spots for ERR3079485.sra Written 2075009 spots for ERR3079485.sra Rejected 2075009 READS because READLEN < 1 Read 2075009 spots for ERR3079485.sra Written 2075009 spots for ERR3079485.sra Rejected 2075009 READS because READLEN < 1 Read 2075009 spots for ERR3079485.sra Written 2075009 spots for ERR3079485.sra Rejected 2075026 READS because READLEN < 1 Read 2075026 spots for ERR3079485.sra Written 2075026 spots for ERR3079485.sra Rejected 2075009 READS because READLEN < 1 Read 2075009 spots for ERR3079485.sra Written 2075009 spots for ERR3079485.sra Rejected 2075009 READS because READLEN < 1 Read 2075009 spots for ERR3079485.sra Written 2075009 spots for ERR3079485.sra Rejected 2075009 READS because READLEN < 1 Read 2075009 spots for ERR3079485.sra Written 2075009 spots for ERR3079485.sra Rejected 2075009 READS because READLEN < 1 Read 2075009 spots for ERR3079485.sra Written 2075009 spots for ERR3079485.sra Rejected 2075009 READS because READLEN < 1 Read 2075009 spots for ERR3079485.sra Written 2075009 spots for ERR3079485.sra Rejected 2075009 READS because READLEN < 1 Read 2075009 spots for ERR3079485.sra Written 2075009 spots for ERR3079485.sra SRR ids: ['ERR3079485.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_23n6m5sa ERR3079485.sra spots: 41500197 blocks: [[1, 2075009], [2075010, 4150018], [4150019, 6225027], [6225028, 8300036], [8300037, 10375045], [10375046, 12450054], [12450055, 14525063], [14525064, 16600072], [16600073, 18675081], [18675082, 20750090], [20750091, 22825099], [22825100, 24900108], [24900109, 26975117], [26975118, 29050126], [29050127, 31125135], [31125136, 33200144], [33200145, 35275153], [35275154, 37350162], [37350163, 39425171], [39425172, 41500197]] ERR3079485 file size 5895319 ERR3079485 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3079485 ERR3079485_1.fastq Input file: ERR3079485_1.fastq trimmed: ERR3079485-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 14:10:23 2024 >> started Sat Dec 7 14:10:45 2024 >> done (22.212s) 41500197 reads processed; of these: 3932 ( 0.01%) short reads filtered out after trimming by size control 16818 ( 0.04%) empty reads filtered out after trimming by size control 41479447 (99.95%) reads available; of these: 60888 ( 0.15%) trimmed reads available after processing 41418559 (99.85%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 535 0.00% 19 668 0.00% 20 713 0.00% 21 888 0.00% 22 1105 0.00% 23 1516 0.00% 24 1787 0.00% 25 2373 0.01% 26 2953 0.01% 27 2219 0.01% 28 1965 0.00% 29 1951 0.00% 30 1816 0.00% 31 1873 0.00% 32 1800 0.00% 33 1810 0.00% 34 1832 0.00% 35 1961 0.00% 36 1922 0.00% 37 1787 0.00% 38 1834 0.00% 39 1903 0.00% 40 1862 0.00% 41 2019 0.00% 42 1915 0.00% 43 2012 0.00% 44 2024 0.00% 45 2066 0.00% 46 2073 0.00% 47 2317 0.01% 48 2431 0.01% 49 2268 0.01% 50 2690 0.01% 51 41418559 99.85% 41479447 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=99.01 fanout-score-rank=16 prefix-density=0.73 prefix-fanout=16.6 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=23 fanout-score=318.42 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=16.6 sequence=CGCCGCCGCCACC Started job on | Dec 07 14:10:57 Started mapping on | Dec 07 14:10:58 Finished on | Dec 07 14:11:46 Mapping speed, Million of reads per hour | 3110.96 Number of input reads | 41479447 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 35639203 Uniquely mapped reads % | 85.92% Average mapped length | 50.76 Number of splices: Total | 5681392 Number of splices: Annotated (sjdb) | 5421493 Number of splices: GT/AG | 5603007 Number of splices: GC/AG | 68758 Number of splices: AT/AC | 4617 Number of splices: Non-canonical | 5010 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.00% Deletion average length | 1.33 Insertion rate per base | 0.00% Insertion average length | 1.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1291845 % of reads mapped to multiple loci | 3.11% Number of reads mapped to too many loci | 4163444 % of reads mapped to too many loci | 10.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.66% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4548399 4548399 4548399 N_multimapping 1291845 1291845 1291845 N_noFeature 1611539 18399304 18165048 N_ambiguous 734619 27050 24333 UnstrandedReadsAssigned:33293045 PositiveStrandReadsAssigned:17212849 NegativeStrandReadsAssigned:17449822 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR3079485 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR3079485-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 41,479,447 reads, 34,403,478 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,212 rounds 52973 ERR3079485.ke.tsv 35125 ERR3079485.se.tsv 88098 total ==> ERR3079485.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 167.566 9.86976 PNS24247 1044 945 64.3585 3.35753 PNS24249 1928 1829 689.94 18.597 PNS24246 1044 945 64.3585 3.35753 PNS24248 1044 945 64.3585 3.35753 PNS24244 1471 1372 63.418 2.27879 PNS24243 293 194 17 4.32009 KQK14069 1603 1504 4530.44 148.504 KQK14071 474 375 1609.12 211.545 ==> ERR3079485.se.tsv <== BRADI_1g14170v3 6872 BRADI_1g53295v3 99 BRADI_1g59795v3 707 BRADI_1g07683v3 0 BRADI_1g00485v3 29 BRADI_1g20270v3 1226 BRADI_1g74790v3 165 BRADI_1g09890v3 2 BRADI_1g77505v3 844 BRADI_1g48960v3 1 ERR3079485 completed mapping pipeline successfully