Starting /dee2/code/volunteer_pipeline.sh ERR3317413 current disk space = 1526591213568 free memory = 1597220940 ERR3317413 SRAfilesize fd7a85999f5e5ef160250e0dd09f9771 ERR3317413.sra ERR3317413.sra file validated ERR3317413 is paired end ERR3317413 is conventional basespace ERR3317413 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317413_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.07275 33.0 31.0 34.0 30.0 34.0 2 32.34775 34.0 31.0 34.0 30.0 34.0 3 32.45 34.0 31.0 34.0 30.0 34.0 4 36.056 37.0 35.0 37.0 35.0 37.0 5 35.528 37.0 35.0 37.0 35.0 37.0 6 35.63525 37.0 35.0 37.0 33.0 37.0 7 35.782 37.0 35.0 37.0 33.0 37.0 8 35.723 37.0 35.0 37.0 33.0 37.0 9 37.409 39.0 37.0 39.0 34.0 39.0 10-11 37.394125 39.0 37.0 39.0 34.0 39.0 12-13 37.36525 39.0 37.0 39.0 33.5 39.0 14-15 38.57275 40.0 38.0 41.0 33.5 41.0 16-17 38.552875 40.0 38.0 41.0 33.5 41.0 18-19 38.465125 40.0 38.0 41.0 33.5 41.0 20-21 38.531625000000005 40.0 38.0 41.0 34.0 41.0 22-23 38.459625 40.0 38.0 41.0 34.0 41.0 24-25 38.399874999999994 40.0 38.0 41.0 34.0 41.0 26-27 38.317499999999995 40.0 38.0 41.0 33.5 41.0 28-29 38.033375 40.0 37.5 41.0 33.0 41.0 30-31 37.94 40.0 37.0 41.0 33.0 41.0 32-33 37.89 40.0 37.0 41.0 32.5 41.0 34-35 37.519375 40.0 36.5 41.0 31.5 41.0 36-37 37.54375 40.0 36.0 41.0 32.0 41.0 38-39 37.517375 40.0 36.5 41.0 32.5 41.0 40-41 37.498374999999996 40.0 36.5 41.0 32.0 41.0 42-43 37.349374999999995 39.5 36.0 41.0 31.5 41.0 44-45 36.878625 39.0 35.0 41.0 30.5 41.0 46-47 37.003625 39.0 35.0 41.0 30.5 41.0 48-49 37.123374999999996 39.0 35.0 41.0 31.0 41.0 50-51 36.946375 39.0 35.0 41.0 31.0 41.0 52-53 36.72225 39.0 35.0 41.0 31.0 41.0 54-55 36.331875 38.5 35.0 40.5 30.5 41.0 56-57 35.944 38.0 34.5 40.0 29.5 41.0 58-59 35.984125 38.0 35.0 40.0 30.0 41.0 60-61 35.64025 37.0 34.5 40.0 29.5 41.0 62-63 35.303375 36.5 34.0 39.5 29.0 41.0 64-65 34.884 36.0 34.0 39.0 28.5 41.0 66-67 34.614000000000004 35.5 34.0 39.0 28.5 40.5 68-69 34.418 35.0 34.0 38.5 29.0 40.0 70-71 34.1305 35.0 33.5 37.0 29.0 39.5 72-73 33.732625 35.0 33.0 37.0 28.5 39.0 74-75 33.354749999999996 35.0 33.0 36.0 27.5 39.0 76-77 31.689999999999998 33.5 30.5 35.0 25.0 36.5 78-79 32.854375000000005 35.0 32.5 35.0 28.0 37.0 80-81 32.95825000000001 35.0 33.0 35.0 28.5 37.0 82-83 32.76975 35.0 33.0 35.0 28.0 36.0 84-85 32.52875 35.0 33.0 35.0 27.5 36.0 86-87 32.372125 35.0 33.0 35.0 27.0 36.0 88-89 32.168499999999995 35.0 33.0 35.0 26.5 35.5 90-91 32.122125 35.0 33.0 35.0 27.0 35.0 92-93 31.965000000000003 35.0 33.0 35.0 26.5 35.0 94-95 31.79875 35.0 33.0 35.0 26.0 35.0 96-97 31.58925 35.0 33.0 35.0 25.5 35.0 98-99 31.259124999999997 35.0 32.0 35.0 25.0 35.0 100 30.24775 34.0 30.0 35.0 20.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 1.0 9 2.0 10 3.0 11 1.0 12 10.0 13 2.0 14 5.0 15 7.0 16 7.0 17 8.0 18 3.0 19 13.0 20 7.0 21 12.0 22 9.0 23 15.0 24 16.0 25 22.0 26 36.0 27 48.0 28 53.0 29 92.0 30 71.0 31 114.0 32 109.0 33 198.0 34 262.0 35 365.0 36 627.0 37 947.0 38 838.0 39 96.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 26.3631815907954 27.613806903451728 20.260130065032516 25.76288144072036 2 27.3 25.45 18.675 28.575 3 25.75 25.874999999999996 18.8 29.575000000000003 4 26.125 25.674999999999997 17.224999999999998 30.975 5 26.734177215189874 24.860759493670887 17.443037974683545 30.962025316455694 6 29.349999999999998 26.55 18.725 25.374999999999996 7 31.3 24.025 20.325 24.349999999999998 8 31.900000000000002 25.424999999999997 24.275 18.4 9 31.974999999999998 26.950000000000003 23.575 17.5 10-11 33.375 27.212500000000002 21.762500000000003 17.65 12-13 31.2375 25.95 23.474999999999998 19.3375 14-15 28.275 26.6125 24.1625 20.95 16-17 26.85 26.700000000000003 24.425 22.025 18-19 25.4625 26.8125 25.45 22.275 20-21 23.95 28.175 26.025 21.85 22-23 25.4 25.937500000000004 26.224999999999998 22.4375 24-25 24.712500000000002 26.1625 26.724999999999998 22.400000000000002 26-27 24.5 27.55 25.75 22.2 28-29 26.237500000000004 26.187500000000004 24.6125 22.9625 30-31 25.162499999999998 27.0875 25.724999999999998 22.025 32-33 25.5125 26.224999999999998 25.775 22.4875 34-35 25.112499999999997 26.9625 25.674999999999997 22.25 36-37 24.925 27.212500000000002 25.8125 22.05 38-39 25.8 26.5625 25.5 22.1375 40-41 24.725 26.724999999999998 25.637500000000003 22.912499999999998 42-43 25.424999999999997 26.75 25.3 22.525000000000002 44-45 25.587500000000002 26.937499999999996 25.45 22.025 46-47 26.05 26.174999999999997 24.3625 23.4125 48-49 26.387500000000003 26.125 25.55 21.9375 50-51 25.474999999999998 26.75 25.637500000000003 22.1375 52-53 24.8625 27.3875 24.975 22.775000000000002 54-55 25.412499999999998 26.1125 26.325 22.15 56-57 24.975 26.887499999999996 25.112499999999997 23.025000000000002 58-59 24.337500000000002 27.787499999999998 25.6125 22.2625 60-61 25.45 26.275 25.324999999999996 22.95 62-63 25.137500000000003 27.437499999999996 25.5625 21.8625 64-65 25.362499999999997 26.8 25.087500000000002 22.75 66-67 24.712500000000002 27.200000000000003 25.2875 22.8 68-69 25.95 27.0 24.5125 22.537499999999998 70-71 24.675 26.8 25.424999999999997 23.1 72-73 24.9125 27.0125 25.1875 22.8875 74-75 24.887500000000003 27.825 24.887500000000003 22.400000000000002 76-77 25.724999999999998 28.175 23.9375 22.162499999999998 78-79 25.2875 27.750000000000004 24.6875 22.275 80-81 26.0 27.1125 24.9125 21.975 82-83 25.15 26.950000000000003 24.6875 23.2125 84-85 25.587500000000002 26.5375 25.525 22.35 86-87 25.5375 27.325 24.05 23.0875 88-89 26.1125 26.9125 24.349999999999998 22.625 90-91 25.025 27.9375 24.712500000000002 22.325 92-93 24.587500000000002 27.962500000000002 24.7375 22.7125 94-95 25.1 27.5875 23.2875 24.025 96-97 26.137500000000003 27.500000000000004 24.825 21.5375 98-99 25.1 28.0875 24.1375 22.675 100 25.75 27.675 23.075000000000003 23.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.5 5 0.5 6 1.0 7 2.5 8 2.0 9 1.0 10 1.0 11 1.0 12 2.0 13 2.0 14 1.5 15 1.5 16 0.5 17 0.5 18 2.5 19 3.5 20 2.0 21 2.0 22 2.0 23 2.0 24 4.0 25 4.5 26 2.5 27 3.0 28 4.5 29 4.0 30 9.5 31 13.0 32 15.5 33 21.0 34 26.0 35 28.0 36 34.5 37 54.5 38 78.0 39 98.0 40 122.0 41 144.5 42 172.0 43 190.5 44 207.5 45 224.0 46 220.5 47 217.5 48 204.0 49 193.5 50 176.0 51 150.0 52 141.5 53 124.5 54 116.0 55 106.5 56 85.5 57 82.5 58 76.5 59 65.5 60 59.0 61 62.0 62 53.0 63 41.0 64 41.0 65 38.0 66 32.5 67 32.0 68 36.0 69 28.5 70 17.0 71 17.5 72 19.5 73 17.5 74 16.0 75 11.0 76 5.5 77 3.5 78 5.0 79 3.0 80 1.5 81 1.5 82 0.5 83 1.0 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 1.25 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.4 #Duplication Level Percentage of deduplicated Percentage of total 1 98.78048780487805 97.2 2 0.9654471544715447 1.9 3 0.17784552845528454 0.525 4 0.025406504065040653 0.1 5 0.025406504065040653 0.125 6 0.025406504065040653 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGCTCGTGAAGGTAATGAAATTATCCGAGCAGCTTGCAAATGGAGTCCTG 6 0.15 No Hit AGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCGAGTTCGCGCCGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.0625 0.0 0.0 0.0 0.0 32-33 0.1125 0.0 0.0 0.0 0.0 34-35 0.16249999999999998 0.0 0.0 0.0 0.0 36-37 0.21250000000000002 0.0 0.0 0.0 0.0 38-39 0.225 0.0 0.0 0.0 0.0 40-41 0.275 0.0 0.0 0.0 0.0 42-43 0.3125 0.0 0.0 0.0 0.0 44-45 0.375 0.0 0.0 0.0 0.0 46-47 0.525 0.0 0.0 0.0 0.0 48-49 0.625 0.0 0.0 0.0 0.0 50-51 0.675 0.0 0.0 0.0 0.0 52-53 0.7875 0.0 0.0 0.0 0.0 54-55 0.9875 0.0 0.0 0.0 0.0 56-57 1.2875 0.0 0.0 0.0 0.0 58-59 1.4125 0.0 0.0 0.0 0.0 60-61 1.6 0.0 0.0 0.0 0.0 62-63 1.9125 0.0 0.0 0.0 0.0 64-65 2.1625 0.0 0.0 0.0 0.0 66-67 2.425 0.0 0.0 0.0 0.0 68-69 2.8375 0.0 0.0 0.0 0.0 70-71 3.125 0.0 0.0 0.0 0.0 72-73 3.5875000000000004 0.0 0.0 0.0 0.0 74-75 4.0875 0.0 0.0 0.0 0.0 76-77 4.65 0.0 0.0 0.0 0.0 78-79 5.225 0.0 0.0 0.0 0.0 80-81 5.8 0.0 0.0 0.0 0.0 82-83 6.3125 0.0 0.0 0.0 0.0 84-85 6.925000000000001 0.0 0.0 0.0 0.0 86-87 7.575 0.0 0.0 0.0 0.0 88 7.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317413 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317413_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.25025 33.0 31.0 34.0 28.0 34.0 2 31.204 33.0 31.0 34.0 28.0 34.0 3 30.945 31.0 31.0 34.0 27.0 34.0 4 34.68875 37.0 35.0 37.0 32.0 37.0 5 34.9255 37.0 35.0 37.0 32.0 37.0 6 34.93425 37.0 35.0 37.0 32.0 37.0 7 35.08525 37.0 35.0 37.0 32.0 37.0 8 35.0565 37.0 35.0 37.0 32.0 37.0 9 36.57025 39.0 37.0 39.0 32.0 39.0 10-11 36.6295 39.0 37.0 39.0 32.5 39.0 12-13 36.503375 39.0 37.0 39.0 32.5 39.0 14-15 37.735375000000005 40.0 38.0 41.0 33.0 41.0 16-17 37.618625 40.0 37.0 41.0 32.0 41.0 18-19 37.537625 40.0 37.5 41.0 32.0 41.0 20-21 37.56125 40.0 37.0 41.0 32.0 41.0 22-23 37.44025 40.0 37.0 41.0 32.0 41.0 24-25 37.153000000000006 40.0 36.5 41.0 31.0 41.0 26-27 37.164500000000004 40.0 37.0 41.0 31.0 41.0 28-29 37.08775 40.0 37.0 41.0 31.0 41.0 30-31 36.9045 40.0 36.0 41.0 30.5 41.0 32-33 36.728875 40.0 36.0 41.0 30.0 41.0 34-35 36.709875 39.5 36.0 41.0 30.0 41.0 36-37 36.655375 40.0 36.0 41.0 30.0 41.0 38-39 36.38775 39.0 35.5 41.0 30.0 41.0 40-41 36.351749999999996 39.0 35.0 41.0 30.0 41.0 42-43 36.261125 39.0 35.0 41.0 29.5 41.0 44-45 36.2245 39.0 35.5 41.0 29.5 41.0 46-47 36.092 39.0 35.0 41.0 29.0 41.0 48-49 36.067125000000004 39.0 35.0 41.0 29.0 41.0 50-51 34.817625 38.0 33.5 40.0 27.0 40.5 52-53 34.98375 38.0 34.0 39.5 27.0 40.5 54-55 35.67 39.0 35.0 40.5 28.0 41.0 56-57 35.465125 38.0 35.0 41.0 27.5 41.0 58-59 35.386250000000004 38.0 35.0 41.0 27.5 41.0 60-61 35.126125 38.0 34.5 40.0 27.5 41.0 62-63 34.75125 37.0 34.0 40.0 26.0 41.0 64-65 34.26575 37.0 34.0 40.0 26.0 41.0 66-67 33.79275 36.0 34.0 39.0 25.0 41.0 68-69 33.0415 36.0 33.0 39.0 22.0 41.0 70-71 32.65275 35.0 33.0 38.5 22.0 40.0 72-73 32.29075 35.0 32.5 37.0 19.5 39.5 74-75 32.2065 35.0 32.5 37.0 21.0 39.0 76-77 32.0645 35.0 32.0 36.5 23.5 39.0 78-79 31.83775 35.0 32.0 36.0 23.5 37.5 80-81 31.425874999999998 35.0 32.0 35.5 21.5 37.0 82-83 30.914625 35.0 31.0 35.0 19.0 37.0 84-85 30.9095 35.0 31.5 35.0 20.0 36.0 86-87 30.51775 35.0 31.0 35.0 18.0 36.0 88-89 30.414125 35.0 31.0 35.0 17.5 36.0 90-91 30.017625000000002 34.0 31.0 35.0 10.5 35.0 92-93 29.792125 34.0 31.0 35.0 4.5 35.0 94-95 29.55025 34.0 31.0 35.0 2.0 35.0 96-97 29.246499999999997 34.0 30.5 35.0 2.0 35.0 98-99 28.759375 34.0 29.5 35.0 2.0 35.0 100 27.5455 33.0 27.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 44.0 3 7.0 4 5.0 5 3.0 6 4.0 7 5.0 8 8.0 9 13.0 10 10.0 11 5.0 12 7.0 13 9.0 14 13.0 15 12.0 16 16.0 17 13.0 18 5.0 19 19.0 20 16.0 21 20.0 22 22.0 23 22.0 24 28.0 25 35.0 26 38.0 27 65.0 28 73.0 29 67.0 30 75.0 31 120.0 32 127.0 33 180.0 34 228.0 35 375.0 36 493.0 37 788.0 38 901.0 39 129.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.6295923502768 11.273276295923502 29.441368897835936 31.655762455963764 2 26.2150591790481 10.425585494837572 26.81944094686477 36.53991437924956 3 21.867136386512332 12.783090085556115 29.516859587317562 35.83291394061399 4 23.88022143935581 12.17916456970307 27.252138902868644 36.68847508807247 5 25.213890286864622 14.947156517362858 24.157020634121793 35.68193256165073 6 24.510787757150023 18.46462619167085 29.126944305067738 27.89764174611139 7 18.690416457601604 23.95885599598595 40.015052684395386 17.335674862017058 8 17.83295711060948 24.37923250564334 36.49360421369451 21.29420617005267 9 18.11339688911189 28.073256397390868 34.119417962870045 19.693928750627197 10-11 19.27997992975414 27.119919719016554 32.2002007024586 21.3998996487707 12-13 19.769192172604114 27.420973406924237 31.62318113396889 21.18665328650276 14-15 20.45910687405921 26.781234320120422 31.021073758153538 21.738585047666835 16-17 20.83281073623479 25.523642292737993 29.223629750407625 24.419917220619592 18-19 20.25840441545409 26.71851480180632 30.44405418966382 22.579026593075767 20-21 20.79779227295534 26.154039136979428 29.001505268439537 24.04666332162569 22-23 21.69657422512235 25.44861337683524 28.987325887815285 23.867486510227128 24-25 21.261916708479678 26.07877571500251 28.92624184646262 23.733065730055195 26-27 21.908703285678456 25.92174567343867 27.702533233007276 24.467017807875596 28-29 20.923231309583542 25.765178123432015 27.483692925238334 25.827897641746112 30-31 20.25840441545409 26.705970898143498 29.315102860010033 23.720521826392375 32-33 22.1372130941929 25.95008152514737 27.80634641916468 24.106358961495044 34-35 20.995236901479068 25.570318375532715 27.638505891200804 25.795938831787414 36-37 21.32113311606919 25.407370268237656 28.95462521935322 24.316871396339934 38-39 21.290726817042607 25.563909774436087 27.957393483709275 25.18796992481203 40-41 21.853475266123983 24.38321853475266 27.56418284283031 26.199123356293047 42-43 21.576971214017522 25.319148936170212 28.498122653316642 24.60575719649562 44-45 22.09902986014867 25.95439082776868 26.748141615219858 25.198437696862797 46-47 20.885599598595086 25.990968389362767 26.94430506773708 26.17912694430507 48-49 21.147582059634175 28.013029315960914 27.123527937860185 23.715860686544726 50-51 22.287721058572682 26.527028721936535 25.987708516242318 25.197541703248465 52-53 21.726041144004014 24.899648770697443 27.87255393878575 25.501756146512793 54-55 21.274460612142498 27.2077270446563 28.22378324134471 23.2940291018565 56-57 22.12467076382792 25.749404239307665 26.87821397215603 25.24771102470839 58-59 21.27099523690148 25.43243920782151 26.748558535973928 26.548007019303082 60-61 21.58066132264529 26.20240480961924 28.0561122244489 24.160821643286575 62-63 22.20691382765531 25.789078156312623 26.127254509018037 25.876753507014026 64-65 21.749049429657795 24.512040557667934 28.365019011406844 25.373891001267427 66-67 21.0941475826972 26.615776081424936 27.633587786259543 24.65648854961832 68-69 23.145057766367138 25.8408215661104 27.16302952503209 23.85109114249037 70-71 23.355980002563772 25.586463273939238 25.855659530829385 25.201897192667605 72-73 22.38083099668621 26.40836094825389 26.701503951057866 24.509304104002037 74-75 22.608913370055085 26.4521782674011 27.003004506760142 23.935903855783675 76-77 23.697394789579157 24.749498997995993 26.265030060120242 25.288076152304612 78-79 23.00951427140711 26.589884827240862 26.32699048572859 24.073610415623435 80-81 23.78270121416948 25.760420578295157 26.711728626861937 23.745149580673424 82-83 22.865394274234053 25.527373179306885 26.18031140130588 25.42692114515319 84-85 23.801176912482784 26.31776637035182 26.28020533366721 23.600851383498185 86-87 23.432219301539618 26.799349105019406 25.63524846664163 24.13318312679935 88-89 23.5949430466892 25.89810990111403 25.68531731130304 24.821629740893727 90-91 23.404255319148938 26.345431789737173 25.39424280350438 24.85607008760951 92-93 23.992490613266586 25.782227784730914 26.170212765957444 24.055068836045056 94-95 24.58072590738423 25.444305381727162 25.944931163954944 24.030037546933666 96-97 24.668335419274094 26.282853566958696 26.057571964956196 22.991239048811014 98-99 24.76214321482223 25.926389584376565 25.88883324987481 23.42263395092639 100 24.71206810215323 26.289434151226843 25.463194792188283 23.535302954431646 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 22.0 1 16.5 2 10.0 3 5.5 4 2.0 5 4.0 6 3.0 7 0.5 8 0.5 9 1.5 10 2.5 11 1.0 12 0.0 13 0.5 14 1.5 15 2.0 16 2.0 17 2.0 18 2.0 19 2.0 20 1.5 21 2.5 22 4.0 23 6.0 24 5.5 25 6.0 26 6.5 27 6.5 28 8.5 29 6.5 30 8.5 31 12.5 32 26.5 33 38.0 34 36.5 35 45.0 36 58.0 37 74.0 38 103.0 39 135.0 40 142.0 41 162.5 42 199.5 43 214.5 44 216.0 45 197.5 46 197.5 47 197.5 48 183.5 49 173.5 50 160.0 51 142.5 52 127.5 53 119.0 54 106.0 55 87.0 56 76.0 57 74.0 58 59.0 59 54.0 60 58.0 61 49.5 62 42.0 63 36.0 64 32.0 65 33.5 66 28.5 67 22.5 68 19.0 69 20.5 70 22.0 71 16.5 72 15.5 73 15.0 74 7.0 75 3.5 76 5.5 77 5.0 78 5.5 79 4.0 80 1.5 81 1.5 82 1.0 83 0.5 84 0.5 85 0.5 86 0.5 87 1.0 88 0.5 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.7250000000000001 3 0.65 4 0.65 5 0.65 6 0.35000000000000003 7 0.35000000000000003 8 0.325 9 0.35000000000000003 10-11 0.35000000000000003 12-13 0.35000000000000003 14-15 0.35000000000000003 16-17 0.3375 18-19 0.35000000000000003 20-21 0.35000000000000003 22-23 0.3875 24-25 0.35000000000000003 26-27 0.325 28-29 0.35000000000000003 30-31 0.35000000000000003 32-33 0.3375 34-35 0.27499999999999997 36-37 0.27499999999999997 38-39 0.25 40-41 0.1875 42-43 0.125 44-45 0.7875 46-47 0.35000000000000003 48-49 0.22499999999999998 50-51 0.3375 52-53 0.35000000000000003 54-55 0.35000000000000003 56-57 0.3375 58-59 0.27499999999999997 60-61 0.2 62-63 0.2 64-65 1.375 66-67 1.7500000000000002 68-69 2.625 70-71 2.4875000000000003 72-73 1.925 74-75 0.15 76-77 0.2 78-79 0.15 80-81 0.13749999999999998 82-83 0.44999999999999996 84-85 0.1625 86-87 0.13749999999999998 88-89 0.13749999999999998 90-91 0.125 92-93 0.125 94-95 0.125 96-97 0.125 98-99 0.15 100 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.18492103922567 97.35000000000001 2 0.5348955680081509 1.05 3 0.15282730514518594 0.44999999999999996 4 0.07641365257259297 0.3 5 0.025471217524197655 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025471217524197655 0.7250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 29 0.7250000000000001 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.0625 0.0 0.0 0.0 0.0 32-33 0.1125 0.0 0.0 0.0 0.0 34-35 0.1375 0.0 0.0 0.0 0.0 36-37 0.1875 0.0 0.0 0.0 0.0 38-39 0.2 0.0 0.0 0.0 0.0 40-41 0.2625 0.0 0.0 0.0 0.0 42-43 0.3125 0.0 0.0 0.0 0.0 44-45 0.375 0.0 0.0 0.0 0.0 46-47 0.5125 0.0 0.0 0.0 0.0 48-49 0.55 0.0 0.0 0.0 0.0 50-51 0.6 0.0 0.0 0.0 0.0 52-53 0.7125 0.0 0.0 0.0 0.0 54-55 0.9125 0.0 0.0 0.0 0.0 56-57 1.2125 0.0 0.0 0.0 0.0 58-59 1.3375 0.0 0.0 0.0 0.0 60-61 1.55 0.0 0.0 0.0 0.0 62-63 1.8625 0.0 0.0 0.0 0.0 64-65 2.0875 0.0 0.0 0.0 0.0 66-67 2.3375 0.0 0.0 0.0 0.0 68-69 2.7125 0.0 0.0 0.0 0.0 70-71 2.9875 0.0 0.0 0.0 0.0 72-73 3.4 0.0 0.0 0.0 0.0 74-75 3.8875 0.0 0.0 0.0 0.0 76-77 4.4375 0.0 0.0 0.0 0.0 78-79 5.0 0.0 0.0 0.0 0.0 80-81 5.5375 0.0 0.0 0.0 0.0 82-83 6.012499999999999 0.0 0.0 0.0 0.0 84-85 6.625 0.0 0.0 0.0 0.0 86-87 7.262499999999999 0.0 0.0 0.0 0.0 88 7.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1711360 spots for ERR3317413.sra Written 1711360 spots for ERR3317413.sra Read 1711360 spots for ERR3317413.sra Written 1711360 spots for ERR3317413.sra Read 1711360 spots for ERR3317413.sra Written 1711360 spots for ERR3317413.sra Read 1711360 spots for ERR3317413.sra Written 1711360 spots for ERR3317413.sra Read 1711360 spots for ERR3317413.sra Written 1711360 spots for ERR3317413.sra Read 1711360 spots for ERR3317413.sra Written 1711360 spots for ERR3317413.sra Read 1711360 spots for ERR3317413.sra Written 1711360 spots for ERR3317413.sra Read 1711360 spots for ERR3317413.sra Written 1711360 spots for ERR3317413.sra Read 1711360 spots for ERR3317413.sra Written 1711360 spots for ERR3317413.sra Read 1711360 spots for ERR3317413.sra Written 1711360 spots for ERR3317413.sra Read 1711368 spots for ERR3317413.sra Written 1711368 spots for ERR3317413.sra Read 1711360 spots for ERR3317413.sra Written 1711360 spots for ERR3317413.sra Read 1711360 spots for ERR3317413.sra Written 1711360 spots for ERR3317413.sra Read 1711360 spots for ERR3317413.sra Written 1711360 spots for ERR3317413.sra Read 1711360 spots for ERR3317413.sra Written 1711360 spots for ERR3317413.sra Read 1711360 spots for ERR3317413.sra Written 1711360 spots for ERR3317413.sra Read 1711360 spots for ERR3317413.sra Written 1711360 spots for ERR3317413.sra Read 1711360 spots for ERR3317413.sra Written 1711360 spots for ERR3317413.sra Read 1711360 spots for ERR3317413.sra Written 1711360 spots for ERR3317413.sra Read 1711360 spots for ERR3317413.sra Written 1711360 spots for ERR3317413.sra SRR ids: ['ERR3317413.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mus5ampb ERR3317413.sra spots: 34227208 blocks: [[1, 1711360], [1711361, 3422720], [3422721, 5134080], [5134081, 6845440], [6845441, 8556800], [8556801, 10268160], [10268161, 11979520], [11979521, 13690880], [13690881, 15402240], [15402241, 17113600], [17113601, 18824960], [18824961, 20536320], [20536321, 22247680], [22247681, 23959040], [23959041, 25670400], [25670401, 27381760], [27381761, 29093120], [29093121, 30804480], [30804481, 32515840], [32515841, 34227208]] ERR3317413 file size 8930215 ERR3317413 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317413 ERR3317413_1.fastq ERR3317413_2.fastq Input file: ERR3317413_1.fastq Paired file: ERR3317413_2.fastq trimmed: ERR3317413-trimmed-pair1.fastq, ERR3317413-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 08:44:35 2024 >> started Tue Dec 10 08:45:09 2024 >> done (33.799s) 34227208 read pairs processed; of these: 258448 ( 0.76%) short read pairs filtered out after trimming by size control 408786 ( 1.19%) empty read pairs filtered out after trimming by size control 33559974 (98.05%) read pairs available; of these: 11438300 (34.08%) trimmed read pairs available after processing 22121674 (65.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 556 0.00% 19 768 0.00% 20 989 0.00% 21 1334 0.00% 22 1711 0.01% 23 2277 0.01% 24 2806 0.01% 25 3484 0.01% 26 4116 0.01% 27 4870 0.01% 28 5649 0.02% 29 6502 0.02% 30 7278 0.02% 31 9004 0.03% 32 9500 0.03% 33 10450 0.03% 34 12096 0.04% 35 13145 0.04% 36 14383 0.04% 37 15485 0.05% 38 17285 0.05% 39 18570 0.06% 40 19665 0.06% 41 21352 0.06% 42 23273 0.07% 43 25124 0.07% 44 27237 0.08% 45 28826 0.09% 46 30535 0.09% 47 34335 0.10% 48 35445 0.11% 49 37576 0.11% 50 40896 0.12% 51 42539 0.13% 52 44374 0.13% 53 47644 0.14% 54 50108 0.15% 55 54233 0.16% 56 57517 0.17% 57 61558 0.18% 58 65832 0.20% 59 91457 0.27% 60 97501 0.29% 61 101607 0.30% 62 106952 0.32% 63 110290 0.33% 64 115717 0.34% 65 123466 0.37% 66 132034 0.39% 67 134088 0.40% 68 136837 0.41% 69 140914 0.42% 70 147586 0.44% 71 153372 0.46% 72 154557 0.46% 73 163076 0.49% 74 168834 0.50% 75 161941 0.48% 76 162618 0.48% 77 174198 0.52% 78 181298 0.54% 79 187099 0.56% 80 194280 0.58% 81 199501 0.59% 82 205145 0.61% 83 213711 0.64% 84 221897 0.66% 85 232363 0.69% 86 242436 0.72% 87 246704 0.74% 88 245653 0.73% 89 273321 0.81% 90 275476 0.82% 91 296119 0.88% 92 322851 0.96% 93 354357 1.06% 94 403314 1.20% 95 471081 1.40% 96 552851 1.65% 97 688397 2.05% 98 867911 2.59% 99 1075163 3.20% 100 22121674 65.92% 33559974 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.63 fanout-score-rank=15 prefix-density=0.49 prefix-fanout=3.1 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=246.76 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=29.2 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=23 prefix-density=0.42 prefix-fanout=1.0 sequence=ATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=186.00 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=7.8 sequence=TTTTCCTTTTTGTTTGTTTCGAGAAAGATATCGTCCGATTCTCCTTCTATTGATTCTTTTCCGATCGAGATGTATGGATCCATGTGTCTACATACCTAGATTCTGTTCATGGATTAACGAAAATGTGCAAGAGCTCTATTTGCCTCTGCCATTCTATGAGTCGCTTCCTTTTTGCGTATGGCACCCCCACTCCCTTTGGCAGCATCTACTAATT ERR3317413 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 08:45:49 Started mapping on | Dec 10 08:45:49 Finished on | Dec 10 08:47:41 Mapping speed, Million of reads per hour | 1078.71 Number of input reads | 33559974 Average input read length | 188 UNIQUE READS: Uniquely mapped reads number | 30391256 Uniquely mapped reads % | 90.56% Average mapped length | 187.36 Number of splices: Total | 18959847 Number of splices: Annotated (sjdb) | 18077356 Number of splices: GT/AG | 18688198 Number of splices: GC/AG | 242694 Number of splices: AT/AC | 15142 Number of splices: Non-canonical | 13813 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.00% Deletion average length | 1.20 Insertion rate per base | 0.00% Insertion average length | 1.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1978685 % of reads mapped to multiple loci | 5.90% Number of reads mapped to too many loci | 64172 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.39% % of reads unmapped: other | 0.96% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1465760 1465760 1465760 N_multimapping 1978685 1978685 1978685 N_noFeature 1046959 2443061 28363485 N_ambiguous 922188 347461 18395 UnstrandedReadsAssigned:28422109 PositiveStrandReadsAssigned:27600734 NegativeStrandReadsAssigned:2009376 Dataset is classified positive stranded MeadianReadLen=100 20thPercentileLength=99 echo kmer=95 ERR3317413 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317413-trimmed-pair1.fastq ERR3317413-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,559,974 reads, 29,296,948 reads pseudoaligned [quant] estimated average fragment length: 180.171 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,253 rounds 52973 ERR3317413.ke.tsv 35125 ERR3317413.se.tsv 88098 total ==> ERR3317413.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 757.013 0 0 PNS24247 1044 864.829 23.5209 1.4601 PNS24249 1928 1748.83 79.381 2.43685 PNS24246 1044 864.829 23.5209 1.4601 PNS24248 1044 864.829 23.5209 1.4601 PNS24244 1471 1291.83 253.056 10.5165 PNS24243 293 138.366 0 0 KQK14069 1603 1423.83 3589.51 135.343 KQK14071 474 301.693 80.8985 14.3958 ==> ERR3317413.se.tsv <== BRADI_1g14170v3 5641 BRADI_1g53295v3 67 BRADI_1g59795v3 249 BRADI_1g07683v3 0 BRADI_1g00485v3 88 BRADI_1g20270v3 2400 BRADI_1g74790v3 245 BRADI_1g09890v3 14 BRADI_1g77505v3 456 BRADI_1g48960v3 0 ERR3317413 completed mapping pipeline successfully