Starting /dee2/code/volunteer_pipeline.sh ERR3317414 current disk space = 1526585929728 free memory = 1435057796 ERR3317414 SRAfilesize e6786e4152aeaed37fae030f72fa4ba3 ERR3317414.sra ERR3317414.sra file validated ERR3317414 is paired end ERR3317414 is conventional basespace ERR3317414 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317414_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.15225 34.0 31.0 34.0 26.0 34.0 2 31.5725 34.0 31.0 34.0 26.0 34.0 3 32.575 34.0 31.0 34.0 28.0 34.0 4 36.25825 37.0 37.0 37.0 35.0 37.0 5 36.30025 37.0 37.0 37.0 35.0 37.0 6 36.323 37.0 37.0 37.0 35.0 37.0 7 36.33425 37.0 37.0 37.0 35.0 37.0 8 36.33775 37.0 37.0 37.0 35.0 37.0 9 38.13025 39.0 39.0 39.0 37.0 39.0 10-11 38.143875 39.0 39.0 39.0 37.0 39.0 12-13 38.082375 39.0 39.0 39.0 36.0 39.0 14-15 39.655 41.0 40.0 41.0 37.0 41.0 16-17 39.545625 41.0 40.0 41.0 37.0 41.0 18-19 39.5865 41.0 40.0 41.0 37.0 41.0 20-21 39.572875 41.0 40.0 41.0 37.0 41.0 22-23 39.434625 41.0 39.0 41.0 36.5 41.0 24-25 39.43075 41.0 39.0 41.0 36.5 41.0 26-27 39.282875000000004 41.0 39.0 41.0 36.0 41.0 28-29 39.203625 41.0 39.0 41.0 36.0 41.0 30-31 38.970124999999996 40.5 39.0 41.0 35.0 41.0 32-33 38.86625 40.0 38.5 41.0 35.0 41.0 34-35 38.66975 40.0 38.0 41.0 34.5 41.0 36-37 38.53675 40.0 38.0 41.0 34.5 41.0 38-39 38.344125000000005 40.0 38.0 41.0 33.5 41.0 40-41 38.1295 40.0 38.0 41.0 33.5 41.0 42-43 37.93125 40.0 37.5 41.0 33.0 41.0 44-45 37.663875000000004 40.0 37.0 41.0 33.0 41.0 46-47 37.472375 40.0 36.5 41.0 32.5 41.0 48-49 37.367000000000004 40.0 36.0 41.0 32.0 41.0 50-51 37.067125000000004 39.5 35.5 41.0 31.5 41.0 52-53 37.307375 40.0 35.0 41.0 32.5 41.0 54-55 37.230000000000004 39.5 35.0 41.0 32.5 41.0 56-57 36.92775 39.0 35.0 41.0 32.0 41.0 58-59 36.762 39.0 35.0 41.0 32.0 41.0 60-61 36.39625 38.0 35.0 41.0 31.0 41.0 62-63 35.990375 37.0 35.0 40.0 31.0 41.0 64-65 35.64475 36.5 35.0 40.0 31.0 41.0 66-67 35.334125 36.0 35.0 39.0 30.5 41.0 68-69 34.973875 36.0 35.0 39.0 30.0 41.0 70-71 34.602625 35.0 34.5 37.5 30.0 40.0 72-73 34.272875 35.0 34.0 37.0 30.0 39.0 74-75 33.681124999999994 35.0 34.0 37.0 29.0 39.0 76-77 32.72825 35.0 32.5 36.0 26.5 37.5 78-79 32.98825 35.0 33.5 36.0 28.0 37.0 80-81 32.86525 35.0 34.0 35.5 28.5 37.0 82-83 32.634125 35.0 33.5 35.0 27.5 36.5 84-85 32.39225 35.0 33.0 35.0 27.0 36.0 86-87 32.07125 35.0 33.0 35.0 26.5 36.0 88-89 31.953125 35.0 33.0 35.0 27.0 36.0 90-91 31.676875000000003 35.0 33.0 35.0 25.0 35.0 92-93 31.381749999999997 35.0 33.0 35.0 24.0 35.0 94-95 31.1355 35.0 33.0 35.0 23.5 35.0 96-97 30.8005 35.0 32.5 35.0 19.5 35.0 98-99 30.37475 35.0 32.0 35.0 8.5 35.0 100-101 28.232625 33.0 28.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 1.0 10 4.0 11 3.0 12 4.0 13 6.0 14 11.0 15 8.0 16 4.0 17 10.0 18 6.0 19 9.0 20 8.0 21 9.0 22 22.0 23 13.0 24 25.0 25 22.0 26 29.0 27 35.0 28 57.0 29 43.0 30 65.0 31 72.0 32 98.0 33 109.0 34 187.0 35 319.0 36 565.0 37 1045.0 38 1053.0 39 153.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 26.767537826685007 26.57496561210454 20.825309491059148 25.832187070151306 2 26.400000000000002 25.874999999999996 18.7 29.025000000000002 3 25.55 27.175 18.45 28.825 4 26.900000000000002 25.45 17.7 29.95 5 27.6 25.75 17.05 29.599999999999998 6 28.499999999999996 28.4 19.0 24.099999999999998 7 29.725 24.3 22.25 23.724999999999998 8 31.674999999999997 26.674999999999997 23.974999999999998 17.675 9 31.1 27.1 24.325 17.474999999999998 10-11 31.3 26.9625 22.3375 19.400000000000002 12-13 29.5 26.0125 24.3875 20.1 14-15 28.1375 26.775 24.025 21.0625 16-17 27.450000000000003 26.0625 24.212500000000002 22.275 18-19 25.8125 26.450000000000003 25.837500000000002 21.9 20-21 25.4625 26.4125 25.3125 22.8125 22-23 26.0 25.637500000000003 25.337500000000002 23.025000000000002 24-25 25.0375 26.8 25.7625 22.400000000000002 26-27 24.625 26.724999999999998 25.8125 22.8375 28-29 26.150000000000002 25.8 24.7875 23.2625 30-31 25.7375 25.9875 25.412499999999998 22.8625 32-33 26.0625 26.125 25.2 22.6125 34-35 26.5 25.6 24.6 23.3 36-37 25.4375 26.6125 25.0125 22.9375 38-39 25.7875 25.924999999999997 25.4875 22.8 40-41 25.424999999999997 25.45 24.875 24.25 42-43 26.237500000000004 25.0375 26.0 22.725 44-45 25.825 26.3125 25.162499999999998 22.7 46-47 26.525 26.625 24.0625 22.787499999999998 48-49 26.55 25.75 24.875 22.825 50-51 25.525 26.424999999999997 25.7375 22.3125 52-53 25.7625 26.25 24.7 23.2875 54-55 25.3125 26.8375 24.6125 23.2375 56-57 24.95 27.675 24.837500000000002 22.537499999999998 58-59 25.650000000000002 26.55 24.325 23.474999999999998 60-61 25.124999999999996 26.650000000000002 25.112499999999997 23.1125 62-63 25.674999999999997 26.700000000000003 25.162499999999998 22.4625 64-65 26.2625 25.8125 24.325 23.599999999999998 66-67 26.2125 26.9625 24.2875 22.537499999999998 68-69 25.2125 27.6625 24.05 23.075000000000003 70-71 24.825 27.487499999999997 24.9 22.787499999999998 72-73 25.324999999999996 26.337500000000002 25.362499999999997 22.975 74-75 25.025 27.0125 25.3 22.662499999999998 76-77 25.7875 26.887499999999996 24.2625 23.0625 78-79 25.900000000000002 27.400000000000002 24.762500000000003 21.9375 80-81 26.05 26.35 25.45 22.15 82-83 25.775 27.400000000000002 23.7125 23.1125 84-85 26.150000000000002 26.3125 24.637500000000003 22.900000000000002 86-87 24.75 26.7625 25.0375 23.45 88-89 25.7625 26.3625 24.2 23.674999999999997 90-91 25.1875 27.6 24.375 22.8375 92-93 25.324999999999996 27.150000000000002 24.4125 23.1125 94-95 25.715714464308036 27.00337542192774 24.290536317039628 22.99037379672459 96-97 25.687500000000004 26.337500000000002 24.462500000000002 23.5125 98-99 24.253031628953618 26.92836604575572 25.403175396924617 23.415426928366045 100-101 25.08785140562249 26.041666666666668 24.435240963855424 24.435240963855424 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 2.0 6 2.0 7 2.0 8 1.0 9 0.5 10 0.5 11 1.0 12 1.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.5 20 2.5 21 3.5 22 2.5 23 1.0 24 0.0 25 0.0 26 1.5 27 5.0 28 7.5 29 6.5 30 7.0 31 11.0 32 13.5 33 17.5 34 25.5 35 35.5 36 44.5 37 54.5 38 75.5 39 100.0 40 124.5 41 146.5 42 174.0 43 194.0 44 201.0 45 204.5 46 203.0 47 215.0 48 202.0 49 179.5 50 176.5 51 145.5 52 127.5 53 125.5 54 107.5 55 101.5 56 102.5 57 95.5 58 69.0 59 59.0 60 61.5 61 61.0 62 61.5 63 49.0 64 46.0 65 46.0 66 39.5 67 36.0 68 34.0 69 29.5 70 21.5 71 19.5 72 19.0 73 18.0 74 14.0 75 10.5 76 12.0 77 6.5 78 3.5 79 5.5 80 5.0 81 4.0 82 4.0 83 2.5 84 1.5 85 1.5 86 1.5 87 1.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0125 96-97 0.0 98-99 0.0125 100-101 0.4 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98785425101214 97.8 2 0.8856275303643725 1.7500000000000002 3 0.10121457489878542 0.3 4 0.0 0.0 5 0.0 0.0 6 0.025303643724696356 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCGAGTTCGCGCCGG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.0625 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.16249999999999998 0.0 0.0 0.0 0.0 36-37 0.2625 0.0 0.0 0.0 0.0 38-39 0.375 0.0 0.0 0.0 0.0 40-41 0.475 0.0 0.0 0.0 0.0 42-43 0.6000000000000001 0.0 0.0 0.0 0.0 44-45 0.7625 0.0 0.0 0.0 0.0 46-47 0.8625 0.0 0.0 0.0 0.0 48-49 0.95 0.0 0.0 0.0 0.0 50-51 1.15 0.0 0.0 0.0 0.0 52-53 1.35 0.0 0.0 0.0 0.0 54-55 1.5875 0.0 0.0 0.0 0.0 56-57 1.95 0.0 0.0 0.0 0.0 58-59 2.2 0.0 0.0 0.0 0.0 60-61 2.55 0.0 0.0 0.0 0.0 62-63 2.95 0.0 0.0 0.0 0.0 64-65 3.1875 0.0 0.0 0.0 0.0 66-67 3.4749999999999996 0.0 0.0 0.0 0.0 68-69 3.7625 0.0 0.0 0.0 0.0 70-71 4.075 0.0 0.0 0.0 0.0 72-73 4.5375 0.0 0.0 0.0 0.0 74-75 5.0 0.0 0.0 0.0 0.0 76-77 5.6125 0.0 0.0 0.0 0.0 78-79 6.175 0.0 0.0 0.0 0.0 80-81 6.762499999999999 0.0 0.0 0.0 0.0 82-83 7.4625 0.0 0.0 0.0 0.0 84-85 8.05 0.0 0.0 0.0 0.0 86-87 8.65 0.0 0.0 0.0 0.0 88-89 9.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGAAG 25 0.0046836664 56.940002 7 >>END_MODULE ERR3317414 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317414_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.994 34.0 31.0 34.0 30.0 34.0 2 31.7765 34.0 31.0 34.0 30.0 34.0 3 32.068 34.0 31.0 34.0 30.0 34.0 4 34.874 37.0 35.0 37.0 32.0 37.0 5 35.47775 37.0 35.0 37.0 33.0 37.0 6 35.468 37.0 35.0 37.0 35.0 37.0 7 35.53425 37.0 36.0 37.0 35.0 37.0 8 35.4785 37.0 37.0 37.0 35.0 37.0 9 37.2975 39.0 38.0 39.0 35.0 39.0 10-11 37.311375 39.0 38.0 39.0 35.0 39.0 12-13 37.390125 39.0 38.5 39.0 35.0 39.0 14-15 38.812749999999994 41.0 39.0 41.0 36.0 41.0 16-17 38.77175 41.0 39.0 41.0 36.0 41.0 18-19 38.690125 41.0 39.0 41.0 35.0 41.0 20-21 38.708124999999995 41.0 39.0 41.0 35.0 41.0 22-23 38.628875 41.0 39.0 41.0 35.0 41.0 24-25 38.595125 41.0 39.0 41.0 35.0 41.0 26-27 38.508125 41.0 39.0 41.0 35.0 41.0 28-29 38.41125 41.0 39.0 41.0 35.0 41.0 30-31 38.27475 41.0 38.5 41.0 34.5 41.0 32-33 38.204750000000004 40.5 38.0 41.0 34.5 41.0 34-35 37.992000000000004 40.0 38.0 41.0 34.0 41.0 36-37 37.929 40.0 38.0 41.0 34.0 41.0 38-39 37.77612499999999 40.0 38.0 41.0 33.0 41.0 40-41 37.605000000000004 40.0 38.0 41.0 33.0 41.0 42-43 37.462375 40.0 38.0 41.0 33.0 41.0 44-45 37.147625 40.0 37.0 41.0 32.0 41.0 46-47 36.96475 40.0 37.0 41.0 31.5 41.0 48-49 36.945625 40.0 36.5 41.0 31.5 41.0 50-51 36.3995 39.0 36.0 40.5 31.0 40.5 52-53 36.369749999999996 39.0 35.0 40.5 31.0 41.0 54-55 36.4865 40.0 35.0 41.0 31.0 41.0 56-57 36.271 39.0 35.0 41.0 30.5 41.0 58-59 35.922125 39.0 35.0 41.0 29.5 41.0 60-61 35.611125 38.5 35.0 41.0 29.0 41.0 62-63 35.340125 38.0 35.0 41.0 28.5 41.0 64-65 34.94 37.0 34.5 40.0 28.0 41.0 66-67 34.589375 37.0 34.0 40.0 28.0 41.0 68-69 34.114875 36.0 34.0 39.0 26.0 41.0 70-71 33.68575 35.5 34.0 39.0 26.0 41.0 72-73 33.601124999999996 35.0 34.0 38.0 26.5 40.0 74-75 33.476124999999996 35.0 34.0 37.0 28.0 39.5 76-77 33.109125000000006 35.0 34.0 37.0 27.0 39.0 78-79 32.76575 35.0 34.0 36.5 26.5 39.0 80-81 32.406625000000005 35.0 34.0 36.0 26.5 37.0 82-83 32.0625 35.0 33.0 35.5 25.5 37.0 84-85 31.89525 35.0 33.0 35.0 25.0 36.5 86-87 31.597125 35.0 33.0 35.0 24.0 36.0 88-89 31.431625 35.0 33.0 35.0 24.0 36.0 90-91 31.263375 35.0 33.0 35.0 23.5 36.0 92-93 30.958125000000003 35.0 33.0 35.0 20.0 35.0 94-95 30.835625 35.0 33.0 35.0 19.5 35.0 96-97 30.59425 35.0 32.5 35.0 16.5 35.0 98-99 30.29 35.0 32.0 35.0 2.0 35.0 100-101 28.502375 33.5 28.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 61.0 3 4.0 4 3.0 5 1.0 6 7.0 7 4.0 8 5.0 9 9.0 10 4.0 11 6.0 12 4.0 13 14.0 14 7.0 15 11.0 16 12.0 17 21.0 18 3.0 19 8.0 20 11.0 21 11.0 22 14.0 23 13.0 24 19.0 25 17.0 26 20.0 27 25.0 28 31.0 29 47.0 30 46.0 31 87.0 32 84.0 33 119.0 34 152.0 35 263.0 36 484.0 37 929.0 38 1216.0 39 228.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.25 11.325000000000001 30.099999999999998 29.325000000000003 2 25.575 10.674999999999999 26.85 36.9 3 22.6 13.825000000000001 30.15 33.425 4 23.549999999999997 12.2 27.474999999999998 36.775000000000006 5 25.474999999999998 14.45 24.725 35.35 6 26.325 17.849999999999998 29.925 25.900000000000002 7 19.75 24.474999999999998 38.75 17.025000000000002 8 17.95 23.95 36.275 21.825 9 18.15 26.625 34.300000000000004 20.925 10-11 19.925 25.887500000000003 32.4125 21.775 12-13 20.525 27.187499999999996 31.162499999999998 21.125 14-15 20.5 26.625 30.4625 22.412499999999998 16-17 20.1875 26.2875 29.125 24.4 18-19 19.525000000000002 27.1125 29.9 23.4625 20-21 21.5375 26.0625 28.675 23.724999999999998 22-23 21.55 24.25 28.625 25.575 24-25 20.0875 26.9125 28.849999999999998 24.15 26-27 21.5375 25.15 27.275 26.0375 28-29 20.125 26.125 27.275 26.474999999999998 30-31 19.9875 26.150000000000002 28.962500000000002 24.9 32-33 22.15 25.0125 27.700000000000003 25.137500000000003 34-35 21.6 25.025 27.800000000000004 25.575 36-37 21.5 25.0375 28.9875 24.474999999999998 38-39 21.8 26.3625 26.8625 24.975 40-41 22.237499999999997 24.925 27.35 25.4875 42-43 22.2 25.924999999999997 27.224999999999998 24.65 44-45 22.662499999999998 26.8625 26.087500000000002 24.3875 46-47 22.787499999999998 25.1 26.8375 25.275 48-49 21.575 26.525 27.775 24.125 50-51 22.55 25.324999999999996 27.675 24.45 52-53 22.2125 25.374999999999996 27.975 24.4375 54-55 21.65 26.3125 27.4125 24.625 56-57 22.25 25.337500000000002 27.237499999999997 25.174999999999997 58-59 22.112499999999997 25.074999999999996 27.1125 25.7 60-61 22.175 26.6125 26.375 24.837500000000002 62-63 23.45 26.775 25.4 24.375 64-65 22.4875 24.275 27.700000000000003 25.5375 66-67 22.3875 26.0125 27.6125 23.9875 68-69 22.975 26.437500000000004 26.450000000000003 24.1375 70-71 21.8125 24.762500000000003 27.0 26.424999999999997 72-73 22.625 25.6 26.924999999999997 24.85 74-75 24.05 25.2875 26.650000000000002 24.0125 76-77 22.9625 26.400000000000002 25.624999999999996 25.0125 78-79 23.4125 25.912499999999998 26.375 24.3 80-81 23.7125 25.9875 26.200000000000003 24.099999999999998 82-83 23.325000000000003 25.837500000000002 25.75 25.087500000000002 84-85 24.3625 25.900000000000002 27.05 22.6875 86-87 24.025 26.674999999999997 24.9 24.4 88-89 24.025 25.05 26.1125 24.8125 90-91 24.212500000000002 26.687499999999996 25.924999999999997 23.175 92-93 24.212500000000002 26.35 25.775 23.6625 94-95 24.224999999999998 25.45 25.324999999999996 25.0 96-97 25.0375 26.1625 25.937500000000004 22.8625 98-99 24.099999999999998 25.8 25.5 24.6 100-101 25.02508780732564 26.07877571500251 24.77420973406924 24.12192674360261 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 23.0 1 17.0 2 7.5 3 3.0 4 1.5 5 0.5 6 1.5 7 2.0 8 1.5 9 1.5 10 0.5 11 1.5 12 3.0 13 2.0 14 1.5 15 3.0 16 2.5 17 1.0 18 1.0 19 2.5 20 3.5 21 2.0 22 0.5 23 2.0 24 3.5 25 5.5 26 7.5 27 6.5 28 6.5 29 11.5 30 17.0 31 22.0 32 26.5 33 29.0 34 36.0 35 44.5 36 54.0 37 76.5 38 99.0 39 110.0 40 130.5 41 163.0 42 191.5 43 198.5 44 208.0 45 210.5 46 199.0 47 195.0 48 182.0 49 158.0 50 145.5 51 143.0 52 131.5 53 118.0 54 108.0 55 98.5 56 84.0 57 74.5 58 65.0 59 56.0 60 50.5 61 48.0 62 48.5 63 43.0 64 33.5 65 34.5 66 36.0 67 33.0 68 32.5 69 22.5 70 20.5 71 23.0 72 15.5 73 13.0 74 14.5 75 10.5 76 6.5 77 6.5 78 6.0 79 4.0 80 2.0 81 2.0 82 2.5 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.35000000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1583779648049 97.2 2 0.6630961489415965 1.3 3 0.07651109410864575 0.22499999999999998 4 0.0510073960724305 0.2 5 0.02550369803621525 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02550369803621525 0.95 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 38 0.95 No Hit CCACCGAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.16249999999999998 0.0 0.0 0.0 0.0 36-37 0.25 0.0 0.0 0.0 0.0 38-39 0.35 0.0 0.0 0.0 0.0 40-41 0.45 0.0 0.0 0.0 0.0 42-43 0.575 0.0 0.0 0.0 0.0 44-45 0.7375 0.0 0.0 0.0 0.0 46-47 0.8374999999999999 0.0 0.0 0.0 0.0 48-49 0.95 0.0 0.0 0.0 0.0 50-51 1.15 0.0 0.0 0.0 0.0 52-53 1.3375 0.0 0.0 0.0 0.0 54-55 1.5625 0.0 0.0 0.0 0.0 56-57 1.9 0.0 0.0 0.0 0.0 58-59 2.15 0.0 0.0 0.0 0.0 60-61 2.5 0.0 0.0 0.0 0.0 62-63 2.9000000000000004 0.0 0.0 0.0 0.0 64-65 3.1624999999999996 0.0 0.0 0.0 0.0 66-67 3.45 0.0 0.0 0.0 0.0 68-69 3.7750000000000004 0.0 0.0 0.0 0.0 70-71 4.1 0.0 0.0 0.0 0.0 72-73 4.5625 0.0 0.0 0.0 0.0 74-75 5.025 0.0 0.0 0.0 0.0 76-77 5.6625 0.0 0.0 0.0 0.0 78-79 6.225 0.0 0.0 0.0 0.0 80-81 6.8 0.0 0.0 0.0 0.0 82-83 7.5 0.0 0.0 0.0 0.0 84-85 8.075 0.0 0.0 0.0 0.0 86-87 8.7 0.0 0.0 0.0 0.0 88-89 9.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2017807 spots for ERR3317414.sra Written 2017807 spots for ERR3317414.sra Read 2017807 spots for ERR3317414.sra Written 2017807 spots for ERR3317414.sra Read 2017807 spots for ERR3317414.sra Written 2017807 spots for ERR3317414.sra Read 2017807 spots for ERR3317414.sra Written 2017807 spots for ERR3317414.sra Read 2017807 spots for ERR3317414.sra Written 2017807 spots for ERR3317414.sra Read 2017807 spots for ERR3317414.sra Written 2017807 spots for ERR3317414.sra Read 2017807 spots for ERR3317414.sra Written 2017807 spots for ERR3317414.sra Read 2017807 spots for ERR3317414.sra Written 2017807 spots for ERR3317414.sra Read 2017807 spots for ERR3317414.sra Written 2017807 spots for ERR3317414.sra Read 2017815 spots for ERR3317414.sra Written 2017815 spots for ERR3317414.sra Read 2017807 spots for ERR3317414.sra Written 2017807 spots for ERR3317414.sra Read 2017807 spots for ERR3317414.sra Written 2017807 spots for ERR3317414.sra Read 2017807 spots for ERR3317414.sra Written 2017807 spots for ERR3317414.sra Read 2017807 spots for ERR3317414.sra Written 2017807 spots for ERR3317414.sra Read 2017807 spots for ERR3317414.sra Written 2017807 spots for ERR3317414.sra Read 2017807 spots for ERR3317414.sra Written 2017807 spots for ERR3317414.sra Read 2017807 spots for ERR3317414.sra Written 2017807 spots for ERR3317414.sra Read 2017807 spots for ERR3317414.sra Written 2017807 spots for ERR3317414.sra Read 2017807 spots for ERR3317414.sra Written 2017807 spots for ERR3317414.sra Read 2017807 spots for ERR3317414.sra Written 2017807 spots for ERR3317414.sra SRR ids: ['ERR3317414.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kdpqmqsh ERR3317414.sra spots: 40356148 blocks: [[1, 2017807], [2017808, 4035614], [4035615, 6053421], [6053422, 8071228], [8071229, 10089035], [10089036, 12106842], [12106843, 14124649], [14124650, 16142456], [16142457, 18160263], [18160264, 20178070], [20178071, 22195877], [22195878, 24213684], [24213685, 26231491], [26231492, 28249298], [28249299, 30267105], [30267106, 32284912], [32284913, 34302719], [34302720, 36320526], [36320527, 38338333], [38338334, 40356148]] ERR3317414 file size 9712643 ERR3317414 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317414 ERR3317414_1.fastq ERR3317414_2.fastq Input file: ERR3317414_1.fastq Paired file: ERR3317414_2.fastq trimmed: ERR3317414-trimmed-pair1.fastq, ERR3317414-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 08:41:25 2024 >> started Tue Dec 10 08:42:11 2024 >> done (46.131s) 40356148 read pairs processed; of these: 290684 ( 0.72%) short read pairs filtered out after trimming by size control 616975 ( 1.53%) empty read pairs filtered out after trimming by size control 39448489 (97.75%) read pairs available; of these: 13464130 (34.13%) trimmed read pairs available after processing 25984359 (65.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1330 0.00% 19 1513 0.00% 20 2174 0.01% 21 2656 0.01% 22 2836 0.01% 23 4021 0.01% 24 4736 0.01% 25 5764 0.01% 26 6853 0.02% 27 8426 0.02% 28 8862 0.02% 29 10783 0.03% 30 11825 0.03% 31 15418 0.04% 32 15051 0.04% 33 15734 0.04% 34 18316 0.05% 35 18735 0.05% 36 21248 0.05% 37 21956 0.06% 38 25799 0.07% 39 27959 0.07% 40 27347 0.07% 41 29660 0.08% 42 31279 0.08% 43 33088 0.08% 44 35947 0.09% 45 37365 0.09% 46 39338 0.10% 47 44310 0.11% 48 45517 0.12% 49 47807 0.12% 50 53530 0.14% 51 53331 0.14% 52 55354 0.14% 53 60749 0.15% 54 63419 0.16% 55 69027 0.17% 56 72624 0.18% 57 75942 0.19% 58 84270 0.21% 59 100462 0.25% 60 110811 0.28% 61 119361 0.30% 62 125157 0.32% 63 131471 0.33% 64 139108 0.35% 65 146839 0.37% 66 158081 0.40% 67 159301 0.40% 68 163611 0.41% 69 167791 0.43% 70 172576 0.44% 71 177832 0.45% 72 184751 0.47% 73 188797 0.48% 74 192895 0.49% 75 195623 0.50% 76 189657 0.48% 77 201472 0.51% 78 213551 0.54% 79 224854 0.57% 80 230300 0.58% 81 224096 0.57% 82 226706 0.57% 83 236218 0.60% 84 241752 0.61% 85 254948 0.65% 86 256580 0.65% 87 259962 0.66% 88 266480 0.68% 89 292930 0.74% 90 282922 0.72% 91 295589 0.75% 92 317602 0.81% 93 334291 0.85% 94 362742 0.92% 95 400766 1.02% 96 449921 1.14% 97 522986 1.33% 98 627926 1.59% 99 842002 2.13% 100 1861511 4.72% 101 25984359 65.87% 39448489 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=4.10 fanout-score-rank=11 prefix-density=0.46 prefix-fanout=3.4 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=16 fanout-score=111.08 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=15.1 sequence=GCCGCCGCCGCCA criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=22 prefix-density=0.29 prefix-fanout=2.2 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCT criterion=fanout-score sequence-density=0.11 sequence-density-rank=12 fanout-score=80.93 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=17.2 sequence=CCTTCTTCTCCTCCTTGGTGGCCTTGGAGGAGATGACGGTCTTG ERR3317414 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 08:43:11 Started mapping on | Dec 10 08:43:11 Finished on | Dec 10 08:46:26 Mapping speed, Million of reads per hour | 728.28 Number of input reads | 39448489 Average input read length | 189 UNIQUE READS: Uniquely mapped reads number | 35663617 Uniquely mapped reads % | 90.41% Average mapped length | 188.58 Number of splices: Total | 21589812 Number of splices: Annotated (sjdb) | 20534788 Number of splices: GT/AG | 21268384 Number of splices: GC/AG | 284269 Number of splices: AT/AC | 17114 Number of splices: Non-canonical | 20045 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.00% Deletion average length | 1.24 Insertion rate per base | 0.00% Insertion average length | 1.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2414049 % of reads mapped to multiple loci | 6.12% Number of reads mapped to too many loci | 85393 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.04% % of reads unmapped: other | 1.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1573090 1573090 1573090 N_multimapping 2414049 2414049 2414049 N_noFeature 1336574 3395656 32889784 N_ambiguous 1009126 331191 19309 UnstrandedReadsAssigned:33317917 PositiveStrandReadsAssigned:31936770 NegativeStrandReadsAssigned:2754524 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=98 echo kmer=93 ERR3317414 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317414-trimmed-pair1.fastq ERR3317414-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,448,489 reads, 33,707,781 reads pseudoaligned [quant] estimated average fragment length: 177.934 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,540 rounds 52973 ERR3317414.ke.tsv 35125 ERR3317414.se.tsv 88098 total ==> ERR3317414.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 759.342 0 0 PNS24247 1044 867.066 37.1133 1.93556 PNS24249 1928 1751.07 197.028 5.08808 PNS24246 1044 867.066 37.1133 1.93556 PNS24248 1044 867.066 37.1133 1.93556 PNS24244 1471 1294.07 173.632 6.0674 PNS24243 293 139.465 1 0.324238 KQK14069 1603 1426.07 11155.2 353.725 KQK14071 474 302.928 56.592 8.4478 ==> ERR3317414.se.tsv <== BRADI_1g14170v3 13736 BRADI_1g53295v3 104 BRADI_1g59795v3 1220 BRADI_1g07683v3 0 BRADI_1g00485v3 87 BRADI_1g20270v3 3359 BRADI_1g74790v3 243 BRADI_1g09890v3 14 BRADI_1g77505v3 469 BRADI_1g48960v3 0 ERR3317414 completed mapping pipeline successfully