Starting /dee2/code/volunteer_pipeline.sh ERR3317415 current disk space = 1526563450880 free memory = 1602358484 ERR3317415 SRAfilesize 163a4ee5ae3cf79d1e4efe4751e1eea8 ERR3317415.sra ERR3317415.sra file validated ERR3317415 is paired end ERR3317415 is conventional basespace ERR3317415 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317415_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.214 34.0 31.0 34.0 26.0 34.0 2 31.61825 34.0 31.0 34.0 27.0 34.0 3 32.5965 34.0 31.0 34.0 28.0 34.0 4 36.23925 37.0 35.0 37.0 35.0 37.0 5 36.2775 37.0 37.0 37.0 35.0 37.0 6 36.31275 37.0 37.0 37.0 35.0 37.0 7 36.295 37.0 37.0 37.0 35.0 37.0 8 36.29025 37.0 37.0 37.0 35.0 37.0 9 38.04725 39.0 39.0 39.0 37.0 39.0 10-11 38.105625 39.0 39.0 39.0 37.0 39.0 12-13 38.080124999999995 39.0 39.0 39.0 37.0 39.0 14-15 39.58175 41.0 40.0 41.0 37.0 41.0 16-17 39.513999999999996 41.0 40.0 41.0 36.0 41.0 18-19 39.556124999999994 41.0 40.0 41.0 36.5 41.0 20-21 39.433 41.0 39.5 41.0 36.0 41.0 22-23 39.360375000000005 41.0 39.0 41.0 36.0 41.0 24-25 39.370875 41.0 39.0 41.0 36.0 41.0 26-27 39.234750000000005 41.0 39.0 41.0 36.0 41.0 28-29 39.073625 41.0 39.0 41.0 35.0 41.0 30-31 38.931875000000005 40.0 39.0 41.0 35.0 41.0 32-33 38.756125 40.0 38.0 41.0 35.0 41.0 34-35 38.59925 40.0 38.0 41.0 34.5 41.0 36-37 38.362375 40.0 38.0 41.0 34.0 41.0 38-39 38.200874999999996 40.0 38.0 41.0 33.5 41.0 40-41 37.97175 40.0 38.0 41.0 33.0 41.0 42-43 37.723625 40.0 37.0 41.0 33.0 41.0 44-45 37.509625 40.0 36.5 41.0 32.5 41.0 46-47 37.403999999999996 40.0 36.0 41.0 32.0 41.0 48-49 37.32875 40.0 36.0 41.0 32.0 41.0 50-51 37.094375 39.5 35.0 41.0 31.5 41.0 52-53 37.27875 39.5 35.0 41.0 32.5 41.0 54-55 37.164874999999995 39.0 35.0 41.0 32.5 41.0 56-57 36.923500000000004 39.0 35.0 41.0 32.0 41.0 58-59 36.616625 39.0 35.0 41.0 32.0 41.0 60-61 36.289125 38.0 35.0 41.0 31.0 41.0 62-63 35.979875 37.0 35.0 40.0 31.0 41.0 64-65 35.611374999999995 37.0 35.0 40.0 30.5 41.0 66-67 35.283625 36.0 35.0 39.0 30.5 41.0 68-69 34.8915 36.0 35.0 39.0 30.0 41.0 70-71 34.425875000000005 35.0 34.5 38.5 29.5 40.5 72-73 34.1035 35.0 34.0 37.0 29.0 39.5 74-75 33.578875 35.0 34.0 37.0 29.0 39.0 76-77 32.679 35.0 32.5 36.0 27.0 38.0 78-79 32.902375 35.0 33.5 36.0 27.5 37.0 80-81 32.801 35.0 34.0 35.0 28.5 37.0 82-83 32.511625 35.0 33.0 35.0 27.0 36.5 84-85 32.269875 35.0 33.0 35.0 27.0 36.0 86-87 32.060625 35.0 33.0 35.0 25.5 36.0 88-89 31.873125 35.0 33.0 35.0 26.0 36.0 90-91 31.606375 35.0 33.0 35.0 25.0 35.0 92-93 31.3985 35.0 33.0 35.0 24.5 35.0 94-95 31.144375 35.0 33.0 35.0 23.5 35.0 96-97 30.811124999999997 35.0 32.5 35.0 20.0 35.0 98-99 30.441875 35.0 32.0 35.0 10.0 35.0 100-101 28.131875 33.0 28.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 1.0 9 1.0 10 5.0 11 6.0 12 5.0 13 8.0 14 5.0 15 6.0 16 6.0 17 4.0 18 14.0 19 17.0 20 12.0 21 13.0 22 18.0 23 15.0 24 22.0 25 27.0 26 24.0 27 35.0 28 39.0 29 51.0 30 70.0 31 71.0 32 88.0 33 132.0 34 204.0 35 287.0 36 579.0 37 1029.0 38 1063.0 39 139.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 25.603070175438596 26.069078947368425 20.80592105263158 27.521929824561404 2 25.825 25.75 20.1 28.325 3 26.150000000000002 25.974999999999998 19.8 28.075 4 27.775 25.474999999999998 16.475 30.275000000000002 5 29.075 25.174999999999997 15.950000000000001 29.799999999999997 6 29.2 26.424999999999997 18.7 25.674999999999997 7 29.825000000000003 23.575 22.35 24.25 8 32.85 26.950000000000003 23.35 16.85 9 33.225 26.525 23.400000000000002 16.85 10-11 32.35 26.55 22.787499999999998 18.3125 12-13 29.9375 25.224999999999998 24.725 20.1125 14-15 27.3125 25.7375 24.9375 22.0125 16-17 27.150000000000002 25.45 24.7375 22.662499999999998 18-19 25.2125 27.075 25.2875 22.425 20-21 25.55 26.55 25.974999999999998 21.925 22-23 25.662499999999998 25.6125 25.7375 22.9875 24-25 26.0125 25.5625 26.0625 22.3625 26-27 25.9875 26.0375 24.9875 22.9875 28-29 26.6 26.825 24.337500000000002 22.237499999999997 30-31 25.687500000000004 26.575 25.3 22.4375 32-33 25.174999999999997 26.2625 26.150000000000002 22.412499999999998 34-35 26.7625 25.874999999999996 24.4875 22.875 36-37 25.5 26.437500000000004 25.224999999999998 22.8375 38-39 25.837500000000002 26.924999999999997 25.5375 21.7 40-41 25.924999999999997 25.637500000000003 26.025 22.412499999999998 42-43 25.6125 25.374999999999996 25.95 23.0625 44-45 25.275 26.900000000000002 24.95 22.875 46-47 26.8 26.5125 24.6 22.0875 48-49 25.474999999999998 26.625 24.925 22.975 50-51 26.2875 26.8625 24.775 22.075 52-53 26.437500000000004 25.724999999999998 24.8 23.0375 54-55 25.3 26.825 25.837500000000002 22.037499999999998 56-57 25.1875 26.0375 24.9375 23.8375 58-59 25.137500000000003 26.474999999999998 25.4875 22.900000000000002 60-61 24.925 26.1125 25.3125 23.65 62-63 24.7 26.974999999999998 24.7375 23.5875 64-65 25.5125 26.275 25.5375 22.675 66-67 24.55 27.1375 24.474999999999998 23.8375 68-69 25.124999999999996 27.187499999999996 25.2375 22.45 70-71 26.174999999999997 25.5625 24.3125 23.95 72-73 25.887500000000003 26.674999999999997 24.5125 22.925 74-75 25.0125 26.650000000000002 25.374999999999996 22.9625 76-77 27.17839729966246 26.56582072759095 23.365420677584698 22.890361295161895 78-79 25.5375 27.0125 24.9 22.55 80-81 25.775 26.5375 24.2375 23.45 82-83 25.203150393799223 26.378297287160894 24.82810351293912 23.590448806100763 84-85 25.087500000000002 27.175 24.637500000000003 23.1 86-87 24.4375 26.700000000000003 24.5625 24.3 88-89 25.2875 27.05 24.6875 22.975 90-91 25.162499999999998 27.150000000000002 24.1625 23.525 92-93 25.7 26.55 24.7375 23.0125 94-95 26.2782847855982 27.103387923490434 22.877859732466558 23.740467558444806 96-97 25.0625 27.0875 25.162499999999998 22.6875 98-99 24.94061757719715 26.878359794974372 23.75296912114014 24.428053506688336 100-101 24.79286969620889 27.454180266131058 23.110720562390156 24.642229475269897 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 1.0 11 1.5 12 1.0 13 0.0 14 0.0 15 1.5 16 2.5 17 1.0 18 0.0 19 0.0 20 1.0 21 3.0 22 3.0 23 2.0 24 1.5 25 2.0 26 4.5 27 4.5 28 4.0 29 6.0 30 8.0 31 10.0 32 17.0 33 20.5 34 26.0 35 35.5 36 47.0 37 64.5 38 79.5 39 101.5 40 128.0 41 155.0 42 183.5 43 184.0 44 186.0 45 205.0 46 196.0 47 189.5 48 192.5 49 179.0 50 167.5 51 148.5 52 136.5 53 131.5 54 126.5 55 113.5 56 95.0 57 82.5 58 67.5 59 63.5 60 58.5 61 53.0 62 53.0 63 50.5 64 41.0 65 37.5 66 35.0 67 37.0 68 34.0 69 30.0 70 28.5 71 23.5 72 23.0 73 25.0 74 24.0 75 15.0 76 10.0 77 7.0 78 4.5 79 3.5 80 3.5 81 3.0 82 4.0 83 4.5 84 3.0 85 2.0 86 1.0 87 0.5 88 0.5 89 0.5 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.799999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0125 78-79 0.0 80-81 0.0 82-83 0.0125 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0125 96-97 0.0 98-99 0.0125 100-101 0.42500000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.575 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85873700228252 97.45 2 0.9383717981232563 1.8499999999999999 3 0.12680699974638598 0.375 4 0.050722799898554397 0.2 5 0.025361399949277198 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGGCACCCAGAGACGAGGAAGGGCGTAGCAAGCGACGAAATGCTTCGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0125 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.07500000000000001 0.0 0.0 0.0 0.0 30-31 0.175 0.0 0.0 0.0 0.0 32-33 0.2 0.0 0.0 0.0 0.0 34-35 0.275 0.0 0.0 0.0 0.0 36-37 0.3375 0.0 0.0 0.0 0.0 38-39 0.4625 0.0 0.0 0.0 0.0 40-41 0.5125 0.0 0.0 0.0 0.0 42-43 0.55 0.0 0.0 0.0 0.0 44-45 0.7125 0.0 0.0 0.0 0.0 46-47 1.0 0.0 0.0 0.0 0.0 48-49 1.225 0.0 0.0 0.0 0.0 50-51 1.4125 0.0 0.0 0.0 0.0 52-53 1.5625 0.0 0.0 0.0 0.0 54-55 1.725 0.0 0.0 0.0 0.0 56-57 1.9 0.0 0.0 0.0 0.0 58-59 2.125 0.0 0.0 0.0 0.0 60-61 2.4625000000000004 0.0 0.0 0.0 0.0 62-63 2.6875 0.0 0.0 0.0 0.0 64-65 3.025 0.0 0.0 0.0 0.0 66-67 3.4625000000000004 0.0 0.0 0.0 0.0 68-69 3.8375 0.0 0.0 0.0 0.0 70-71 4.1125 0.0 0.0 0.0 0.0 72-73 4.65 0.0 0.0 0.0 0.0 74-75 5.125 0.0 0.0 0.0 0.0 76-77 5.612500000000001 0.0 0.0 0.0 0.0 78-79 6.175 0.0 0.0 0.0 0.0 80-81 6.737500000000001 0.0 0.0 0.0 0.0 82-83 7.3375 0.0 0.0 0.0 0.0 84-85 8.1375 0.0 0.0 0.0 0.0 86-87 8.8875 0.0 0.0 0.0 0.0 88-89 9.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAAGGC 15 0.009988314 47.462498 16-17 >>END_MODULE ERR3317415 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317415_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.81325 33.0 31.0 34.0 30.0 34.0 2 31.52625 34.0 31.0 34.0 28.0 34.0 3 31.8545 34.0 31.0 34.0 30.0 34.0 4 34.68975 37.0 35.0 37.0 32.0 37.0 5 35.33575 37.0 35.0 37.0 33.0 37.0 6 35.377 37.0 35.0 37.0 33.0 37.0 7 35.3685 37.0 35.0 37.0 33.0 37.0 8 35.34675 37.0 35.0 37.0 33.0 37.0 9 37.152 39.0 38.0 39.0 35.0 39.0 10-11 37.186875 39.0 38.0 39.0 35.0 39.0 12-13 37.159375 39.0 38.0 39.0 35.0 39.0 14-15 38.592875 41.0 39.0 41.0 35.0 41.0 16-17 38.521375 41.0 39.0 41.0 35.0 41.0 18-19 38.445499999999996 41.0 39.0 41.0 35.0 41.0 20-21 38.415125 41.0 39.0 41.0 34.5 41.0 22-23 38.316375 41.0 39.0 41.0 34.0 41.0 24-25 38.319874999999996 41.0 39.0 41.0 34.0 41.0 26-27 38.19625 40.5 38.5 41.0 34.0 41.0 28-29 38.110749999999996 40.5 38.5 41.0 34.0 41.0 30-31 37.99975 40.0 38.0 41.0 33.0 41.0 32-33 37.855374999999995 40.0 38.0 41.0 33.0 41.0 34-35 37.6555 40.0 38.0 41.0 33.0 41.0 36-37 37.57775 40.0 38.0 41.0 32.5 41.0 38-39 37.40325 40.0 38.0 41.0 32.0 41.0 40-41 37.341125000000005 40.0 38.0 41.0 32.5 41.0 42-43 37.268 40.0 37.5 41.0 32.5 41.0 44-45 36.8705 40.0 36.5 41.0 30.5 41.0 46-47 36.781000000000006 40.0 36.5 41.0 31.0 41.0 48-49 36.70625 40.0 36.5 41.0 31.0 41.0 50-51 36.175875000000005 39.0 35.5 40.5 30.5 40.5 52-53 36.1925 39.0 35.0 40.5 30.5 41.0 54-55 36.288624999999996 39.0 35.0 41.0 30.0 41.0 56-57 36.052875 39.0 35.0 41.0 30.0 41.0 58-59 35.738 39.0 35.0 41.0 28.5 41.0 60-61 35.5265 38.5 35.0 41.0 28.0 41.0 62-63 35.247375 38.0 35.0 40.5 28.0 41.0 64-65 34.873374999999996 37.0 34.5 40.0 28.0 41.0 66-67 34.48725 36.5 34.0 40.0 28.0 41.0 68-69 34.03575 36.0 34.0 39.0 26.0 41.0 70-71 33.636250000000004 35.5 33.0 39.0 26.0 40.5 72-73 33.421875 35.0 33.5 38.0 26.0 40.0 74-75 33.41725 35.0 34.0 37.0 27.0 39.5 76-77 33.007875 35.0 34.0 37.0 26.0 39.0 78-79 32.654375 35.0 33.0 36.5 26.0 39.0 80-81 32.330625 35.0 33.0 36.0 25.5 37.0 82-83 31.993125 35.0 33.0 35.5 25.0 37.0 84-85 31.810125 35.0 33.0 35.0 24.5 36.5 86-87 31.448375 35.0 33.0 35.0 23.5 36.0 88-89 31.252875 35.0 33.0 35.0 23.0 36.0 90-91 31.047874999999998 35.0 32.5 35.0 20.0 36.0 92-93 30.719875000000002 35.0 32.0 35.0 19.0 35.0 94-95 30.563375 35.0 32.0 35.0 18.5 35.0 96-97 30.313375 35.0 32.0 35.0 15.0 35.0 98-99 29.996000000000002 35.0 31.5 35.0 2.0 35.0 100-101 28.178625 33.5 28.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 57.0 3 9.0 4 6.0 5 6.0 6 6.0 7 4.0 8 9.0 9 5.0 10 8.0 11 8.0 12 9.0 13 7.0 14 5.0 15 9.0 16 15.0 17 6.0 18 13.0 19 11.0 20 5.0 21 15.0 22 16.0 23 21.0 24 16.0 25 26.0 26 21.0 27 35.0 28 35.0 29 42.0 30 51.0 31 77.0 32 93.0 33 135.0 34 158.0 35 299.0 36 469.0 37 919.0 38 1158.0 39 216.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.875 12.049999999999999 29.125 28.95 2 27.3 11.200000000000001 24.875 36.625 3 23.525 12.5 30.15 33.825 4 25.775 11.675 26.75 35.8 5 25.7 14.274999999999999 24.575 35.449999999999996 6 25.674999999999997 18.0 30.2 26.125 7 18.65 25.7 38.65 17.0 8 18.325 25.624999999999996 35.8 20.25 9 17.724999999999998 27.425 34.975 19.875 10-11 19.3375 27.3 31.5375 21.825 12-13 18.875 26.4625 32.025 22.6375 14-15 21.2 25.4625 30.2125 23.125 16-17 20.6625 26.6 28.262500000000003 24.474999999999998 18-19 20.474999999999998 27.55 28.4 23.575 20-21 21.8875 26.075 27.875 24.1625 22-23 21.975 24.5375 29.299999999999997 24.1875 24-25 21.3 26.25 29.1875 23.2625 26-27 20.9875 26.787499999999998 26.5375 25.687500000000004 28-29 21.587500000000002 25.0625 26.787499999999998 26.5625 30-31 20.9875 26.387500000000003 28.749999999999996 23.875 32-33 22.9625 25.724999999999998 26.887499999999996 24.425 34-35 21.4 25.45 27.3625 25.7875 36-37 21.8125 25.85 27.3375 25.0 38-39 22.5625 26.0625 26.625 24.75 40-41 22.475 25.324999999999996 26.875 25.324999999999996 42-43 21.7875 26.1125 27.575 24.525 44-45 22.325 26.0625 26.0125 25.6 46-47 22.175 26.2125 26.224999999999998 25.387500000000003 48-49 21.349999999999998 26.887499999999996 26.875 24.887500000000003 50-51 22.125 26.8625 25.55 25.4625 52-53 23.375 25.674999999999997 25.2625 25.687500000000004 54-55 21.425 27.5125 27.3875 23.674999999999997 56-57 22.162499999999998 26.1125 26.387500000000003 25.337500000000002 58-59 22.375 25.025 27.775 24.825 60-61 22.125 26.35 27.725 23.799999999999997 62-63 22.825 25.900000000000002 26.087500000000002 25.1875 64-65 22.225 26.25 26.474999999999998 25.05 66-67 22.55 26.787499999999998 26.525 24.1375 68-69 22.975 26.075 26.437500000000004 24.5125 70-71 22.6375 25.1875 26.3625 25.8125 72-73 23.25 25.0375 26.474999999999998 25.2375 74-75 23.0875 26.6125 25.5375 24.762500000000003 76-77 23.6125 25.05 25.8 25.5375 78-79 23.599999999999998 25.587500000000002 26.437500000000004 24.375 80-81 23.575 25.674999999999997 26.5125 24.2375 82-83 24.087500000000002 24.837500000000002 26.2875 24.7875 84-85 24.075 25.5375 26.0 24.3875 86-87 24.975 26.3625 25.4 23.2625 88-89 24.175 25.55 25.087500000000002 25.1875 90-91 24.5125 26.0375 25.45 24.0 92-93 23.95 26.625 25.3 24.125 94-95 24.85 25.7875 24.775 24.587500000000002 96-97 25.374999999999996 25.55 25.7375 23.3375 98-99 23.8625 25.525 25.2375 25.374999999999996 100-101 25.90316106372303 25.501756146512793 24.460612142498743 24.13447064726543 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 14.0 1 12.5 2 6.5 3 1.5 4 2.0 5 1.5 6 1.0 7 1.5 8 1.0 9 1.5 10 2.0 11 1.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 1.5 20 2.0 21 1.5 22 0.5 23 0.5 24 3.5 25 4.5 26 5.5 27 7.0 28 8.0 29 9.5 30 11.5 31 19.5 32 26.0 33 28.0 34 33.0 35 49.0 36 67.0 37 79.0 38 103.0 39 131.5 40 140.5 41 162.5 42 187.0 43 198.5 44 192.5 45 194.5 46 224.5 47 214.5 48 172.0 49 159.0 50 154.5 51 139.0 52 129.5 53 113.5 54 97.5 55 90.0 56 77.0 57 72.5 58 71.0 59 58.5 60 50.5 61 50.5 62 51.5 63 40.5 64 36.0 65 37.0 66 34.5 67 30.5 68 23.5 69 22.0 70 19.5 71 12.5 72 13.5 73 13.5 74 11.0 75 13.0 76 11.5 77 11.0 78 9.5 79 9.5 80 9.0 81 3.0 82 1.0 83 0.5 84 0.5 85 0.5 86 0.0 87 0.5 88 0.5 89 0.0 90 1.0 91 1.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.35000000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44190766108574 98.0 2 0.3297818366311517 0.65 3 0.15220700152207 0.44999999999999996 4 0.025367833587011668 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025367833587011668 0.22499999999999998 >10 0.025367833587011668 0.575 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 23 0.575 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0125 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.07500000000000001 0.0 0.0 0.0 0.0 30-31 0.175 0.0 0.0 0.0 0.0 32-33 0.2 0.0 0.0 0.0 0.0 34-35 0.275 0.0 0.0 0.0 0.0 36-37 0.3375 0.0 0.0 0.0 0.0 38-39 0.4625 0.0 0.0 0.0 0.0 40-41 0.5125 0.0 0.0 0.0 0.0 42-43 0.55 0.0 0.0 0.0 0.0 44-45 0.7125 0.0 0.0 0.0 0.0 46-47 0.9750000000000001 0.0 0.0 0.0 0.0 48-49 1.2 0.0 0.0 0.0 0.0 50-51 1.4 0.0 0.0 0.0 0.0 52-53 1.5375 0.0 0.0 0.0 0.0 54-55 1.7 0.0 0.0 0.0 0.0 56-57 1.875 0.0 0.0 0.0 0.0 58-59 2.075 0.0 0.0 0.0 0.0 60-61 2.4124999999999996 0.0 0.0 0.0 0.0 62-63 2.5999999999999996 0.0 0.0 0.0 0.0 64-65 2.9125 0.0 0.0 0.0 0.0 66-67 3.3375000000000004 0.0 0.0 0.0 0.0 68-69 3.7249999999999996 0.0 0.0 0.0 0.0 70-71 4.0 0.0 0.0 0.0 0.0 72-73 4.5125 0.0 0.0 0.0 0.0 74-75 4.9625 0.0 0.0 0.0 0.0 76-77 5.387499999999999 0.0 0.0 0.0 0.0 78-79 5.975 0.0 0.0 0.0 0.0 80-81 6.55 0.0 0.0 0.0 0.0 82-83 7.15 0.0 0.0 0.0 0.0 84-85 7.9375 0.0 0.0 0.0 0.0 86-87 8.7 0.0 0.0 0.0 0.0 88-89 9.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1933755 spots for ERR3317415.sra Written 1933755 spots for ERR3317415.sra Read 1933755 spots for ERR3317415.sra Written 1933755 spots for ERR3317415.sra Read 1933755 spots for ERR3317415.sra Written 1933755 spots for ERR3317415.sra Read 1933755 spots for ERR3317415.sra Written 1933755 spots for ERR3317415.sra Read 1933755 spots for ERR3317415.sra Written 1933755 spots for ERR3317415.sra Read 1933755 spots for ERR3317415.sra Written 1933755 spots for ERR3317415.sra Read 1933755 spots for ERR3317415.sra Written 1933755 spots for ERR3317415.sra Read 1933755 spots for ERR3317415.sra Written 1933755 spots for ERR3317415.sra Read 1933755 spots for ERR3317415.sra Written 1933755 spots for ERR3317415.sra Read 1933755 spots for ERR3317415.sra Written 1933755 spots for ERR3317415.sra Read 1933755 spots for ERR3317415.sra Written 1933755 spots for ERR3317415.sra Read 1933755 spots for ERR3317415.sra Written 1933755 spots for ERR3317415.sra Read 1933755 spots for ERR3317415.sra Written 1933755 spots for ERR3317415.sra Read 1933755 spots for ERR3317415.sra Written 1933755 spots for ERR3317415.sra Read 1933755 spots for ERR3317415.sra Written 1933755 spots for ERR3317415.sra Read 1933755 spots for ERR3317415.sra Written 1933755 spots for ERR3317415.sra Read 1933755 spots for ERR3317415.sra Written 1933755 spots for ERR3317415.sra Read 1933755 spots for ERR3317415.sra Written 1933755 spots for ERR3317415.sra Read 1933755 spots for ERR3317415.sra Written 1933755 spots for ERR3317415.sra Read 1933758 spots for ERR3317415.sra Written 1933758 spots for ERR3317415.sra SRR ids: ['ERR3317415.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6257u05a ERR3317415.sra spots: 38675103 blocks: [[1, 1933755], [1933756, 3867510], [3867511, 5801265], [5801266, 7735020], [7735021, 9668775], [9668776, 11602530], [11602531, 13536285], [13536286, 15470040], [15470041, 17403795], [17403796, 19337550], [19337551, 21271305], [21271306, 23205060], [23205061, 25138815], [25138816, 27072570], [27072571, 29006325], [29006326, 30940080], [30940081, 32873835], [32873836, 34807590], [34807591, 36741345], [36741346, 38675103]] ERR3317415 file size 9307157 ERR3317415 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317415 ERR3317415_1.fastq ERR3317415_2.fastq Input file: ERR3317415_1.fastq Paired file: ERR3317415_2.fastq trimmed: ERR3317415-trimmed-pair1.fastq, ERR3317415-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 08:45:23 2024 >> started Tue Dec 10 08:45:59 2024 >> done (36.103s) 38675103 read pairs processed; of these: 261916 ( 0.68%) short read pairs filtered out after trimming by size control 568199 ( 1.47%) empty read pairs filtered out after trimming by size control 37844988 (97.85%) read pairs available; of these: 13128255 (34.69%) trimmed read pairs available after processing 24716733 (65.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1513 0.00% 19 1675 0.00% 20 2379 0.01% 21 2579 0.01% 22 3064 0.01% 23 3945 0.01% 24 4820 0.01% 25 5814 0.02% 26 6748 0.02% 27 7766 0.02% 28 8520 0.02% 29 10345 0.03% 30 12052 0.03% 31 13838 0.04% 32 13866 0.04% 33 14958 0.04% 34 19114 0.05% 35 18557 0.05% 36 20682 0.05% 37 21542 0.06% 38 26080 0.07% 39 26560 0.07% 40 26774 0.07% 41 29584 0.08% 42 31339 0.08% 43 32416 0.09% 44 34504 0.09% 45 36231 0.10% 46 38291 0.10% 47 44119 0.12% 48 46100 0.12% 49 47476 0.13% 50 55303 0.15% 51 53541 0.14% 52 55094 0.15% 53 60132 0.16% 54 61993 0.16% 55 67131 0.18% 56 71329 0.19% 57 74905 0.20% 58 79652 0.21% 59 96897 0.26% 60 108489 0.29% 61 112757 0.30% 62 120819 0.32% 63 126244 0.33% 64 134472 0.36% 65 141228 0.37% 66 153604 0.41% 67 153257 0.40% 68 157518 0.42% 69 161401 0.43% 70 165779 0.44% 71 171828 0.45% 72 176699 0.47% 73 183095 0.48% 74 185086 0.49% 75 188461 0.50% 76 182811 0.48% 77 195094 0.52% 78 206585 0.55% 79 216506 0.57% 80 223311 0.59% 81 220860 0.58% 82 219808 0.58% 83 227433 0.60% 84 234774 0.62% 85 246303 0.65% 86 247884 0.65% 87 251925 0.67% 88 258739 0.68% 89 279487 0.74% 90 272978 0.72% 91 286610 0.76% 92 309330 0.82% 93 327057 0.86% 94 355550 0.94% 95 394417 1.04% 96 440055 1.16% 97 513189 1.36% 98 622681 1.65% 99 832794 2.20% 100 1832109 4.84% 101 24716733 65.31% 37844988 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=16 prefix-density=0.68 prefix-fanout=2.7 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=52.25 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=1.6 sequence=CAACACCAGCCACCAGCTCATCTCTCACTGACCTTACCACTTGAATTGGGATCGAAATGGCCGCGTCGGCGCTGCACCAGACCACCAGCTTCCTCGGCACCGCCCCACGCCGCGATGACCTCGTCCGCAGCGTCGGCGACTTCGGCGGC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.91 fanout-score-rank=35 prefix-density=0.40 prefix-fanout=1.0 sequence=GTCCAGTACCTGCCATCATAGTACCCAGGGGAGCTGTTGTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=19 fanout-score=146.05 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=14.7 sequence=CCTTCTTCTCCGGGTCC ERR3317415 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 08:46:34 Started mapping on | Dec 10 08:46:34 Finished on | Dec 10 08:48:29 Mapping speed, Million of reads per hour | 1184.71 Number of input reads | 37844988 Average input read length | 189 UNIQUE READS: Uniquely mapped reads number | 34592991 Uniquely mapped reads % | 91.41% Average mapped length | 188.38 Number of splices: Total | 21647221 Number of splices: Annotated (sjdb) | 20554585 Number of splices: GT/AG | 21325214 Number of splices: GC/AG | 286571 Number of splices: AT/AC | 14192 Number of splices: Non-canonical | 21244 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.00% Deletion average length | 1.22 Insertion rate per base | 0.00% Insertion average length | 1.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2231194 % of reads mapped to multiple loci | 5.90% Number of reads mapped to too many loci | 46841 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.93% % of reads unmapped: other | 0.65% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1189281 1189281 1189281 N_multimapping 2231194 2231194 2231194 N_noFeature 1295775 3249436 31919405 N_ambiguous 980606 284955 16829 UnstrandedReadsAssigned:32316610 PositiveStrandReadsAssigned:31058600 NegativeStrandReadsAssigned:2656757 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=97 echo kmer=93 ERR3317415 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317415-trimmed-pair1.fastq ERR3317415-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,844,988 reads, 32,653,573 reads pseudoaligned [quant] estimated average fragment length: 175.317 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,215 rounds 52973 ERR3317415.ke.tsv 35125 ERR3317415.se.tsv 88098 total ==> ERR3317415.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 761.894 0 0 PNS24247 1044 869.683 39.7387 2.11582 PNS24249 1928 1753.68 181.166 4.78357 PNS24246 1044 869.683 39.7387 2.11582 PNS24248 1044 869.683 39.7387 2.11582 PNS24244 1471 1296.68 228.618 8.16398 PNS24243 293 139.671 1 0.331528 KQK14069 1603 1428.68 10243.5 332.001 KQK14071 474 304.833 40.5425 6.15849 ==> ERR3317415.se.tsv <== BRADI_1g14170v3 11311 BRADI_1g53295v3 127 BRADI_1g59795v3 784 BRADI_1g07683v3 0 BRADI_1g00485v3 63 BRADI_1g20270v3 1474 BRADI_1g74790v3 486 BRADI_1g09890v3 7 BRADI_1g77505v3 462 BRADI_1g48960v3 0 ERR3317415 completed mapping pipeline successfully