Starting /dee2/code/volunteer_pipeline.sh ERR3317416 current disk space = 1526576001024 free memory = 1602354124 ERR3317416 SRAfilesize c0fe70a570ca1f9669abf9630bec9899 ERR3317416.sra ERR3317416.sra file validated ERR3317416 is paired end ERR3317416 is conventional basespace ERR3317416 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317416_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.19425 34.0 31.0 34.0 26.0 34.0 2 31.654 34.0 31.0 34.0 27.0 34.0 3 32.64425 34.0 31.0 34.0 28.0 34.0 4 36.273 37.0 37.0 37.0 35.0 37.0 5 36.336 37.0 37.0 37.0 35.0 37.0 6 36.3515 37.0 37.0 37.0 35.0 37.0 7 36.36475 37.0 37.0 37.0 35.0 37.0 8 36.3425 37.0 37.0 37.0 35.0 37.0 9 38.1165 39.0 39.0 39.0 37.0 39.0 10-11 38.163 39.0 39.0 39.0 37.0 39.0 12-13 38.132875 39.0 39.0 39.0 37.0 39.0 14-15 39.6565 41.0 40.0 41.0 37.0 41.0 16-17 39.610375000000005 41.0 40.0 41.0 37.0 41.0 18-19 39.651375 41.0 40.0 41.0 37.0 41.0 20-21 39.52975 41.0 39.5 41.0 37.0 41.0 22-23 39.51275 41.0 40.0 41.0 37.0 41.0 24-25 39.378125 41.0 39.0 41.0 36.5 41.0 26-27 39.331 41.0 39.0 41.0 36.5 41.0 28-29 39.19499999999999 41.0 39.0 41.0 35.5 41.0 30-31 38.9925 40.5 39.0 41.0 35.0 41.0 32-33 38.841125000000005 40.0 38.5 41.0 35.0 41.0 34-35 38.69225 40.0 38.0 41.0 35.0 41.0 36-37 38.497125 40.0 38.0 41.0 34.0 41.0 38-39 38.312 40.0 38.0 41.0 33.5 41.0 40-41 38.034875 40.0 37.5 41.0 33.0 41.0 42-43 37.91175 40.0 37.0 41.0 33.0 41.0 44-45 37.506625 40.0 36.5 41.0 32.5 41.0 46-47 37.31375 40.0 36.0 41.0 32.0 41.0 48-49 37.2395 39.5 36.0 41.0 32.0 41.0 50-51 36.964625 39.0 35.0 41.0 31.5 41.0 52-53 37.1105 39.0 35.0 41.0 32.5 41.0 54-55 37.017875000000004 39.0 35.0 41.0 32.0 41.0 56-57 36.76275 39.0 35.0 41.0 32.0 41.0 58-59 36.482625 38.0 35.0 41.0 32.0 41.0 60-61 36.150999999999996 37.5 35.0 40.5 31.0 41.0 62-63 35.832750000000004 37.0 35.0 40.0 31.0 41.0 64-65 35.505624999999995 36.5 35.0 39.5 31.0 41.0 66-67 35.200374999999994 36.0 35.0 39.0 30.5 41.0 68-69 34.924125000000004 35.5 35.0 39.0 31.0 41.0 70-71 34.456375 35.0 34.0 37.5 30.0 40.0 72-73 34.053 35.0 34.0 37.0 29.0 39.0 74-75 33.673125 35.0 34.0 37.0 29.0 39.0 76-77 32.746625 34.5 32.5 36.0 27.0 37.5 78-79 33.02975 35.0 33.5 36.0 28.5 37.0 80-81 32.870375 35.0 33.5 35.0 28.0 37.0 82-83 32.59125 35.0 33.5 35.0 27.5 36.5 84-85 32.275999999999996 35.0 33.0 35.0 26.5 36.0 86-87 32.05375 35.0 33.0 35.0 25.5 36.0 88-89 31.9575 35.0 33.0 35.0 26.0 36.0 90-91 31.763624999999998 35.0 33.0 35.0 25.0 35.0 92-93 31.534125 35.0 33.0 35.0 25.0 35.0 94-95 31.2915 35.0 33.0 35.0 24.0 35.0 96-97 31.022750000000002 35.0 33.0 35.0 23.5 35.0 98-99 30.62125 35.0 32.0 35.0 18.0 35.0 100-101 28.281875 33.0 28.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 1.0 9 1.0 10 5.0 11 8.0 12 6.0 13 3.0 14 4.0 15 4.0 16 9.0 17 17.0 18 16.0 19 4.0 20 7.0 21 11.0 22 12.0 23 14.0 24 19.0 25 25.0 26 29.0 27 35.0 28 46.0 29 41.0 30 59.0 31 68.0 32 119.0 33 123.0 34 183.0 35 330.0 36 614.0 37 1019.0 38 1027.0 39 138.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 26.701427003293084 26.7563117453348 20.801317233809 25.740944017563116 2 26.924999999999997 25.025 18.975 29.075 3 27.05 26.525 18.2 28.225 4 28.349999999999998 25.575 15.275 30.8 5 27.450000000000003 26.174999999999997 16.075 30.3 6 29.45 28.849999999999998 17.4 24.3 7 33.175 25.25 19.0 22.575 8 33.1 26.625 22.675 17.599999999999998 9 32.25 27.400000000000002 22.725 17.625 10-11 35.075 25.924999999999997 20.8125 18.1875 12-13 30.049999999999997 26.174999999999997 24.2625 19.5125 14-15 27.500000000000004 26.3125 24.637500000000003 21.55 16-17 27.0625 25.387500000000003 24.5125 23.0375 18-19 25.525 26.924999999999997 25.624999999999996 21.925 20-21 25.025 26.325 26.0375 22.6125 22-23 26.787499999999998 26.3125 24.337500000000002 22.5625 24-25 25.8125 25.687500000000004 26.087500000000002 22.412499999999998 26-27 27.0625 26.1125 24.925 21.9 28-29 26.137500000000003 25.624999999999996 24.7 23.5375 30-31 26.75 26.474999999999998 23.974999999999998 22.8 32-33 25.624999999999996 27.1 24.3875 22.8875 34-35 26.424999999999997 26.05 24.9 22.625 36-37 26.474999999999998 25.887500000000003 25.1 22.537499999999998 38-39 26.437500000000004 26.6 24.337500000000002 22.625 40-41 25.9625 26.150000000000002 24.3625 23.525 42-43 27.1 25.474999999999998 24.275 23.150000000000002 44-45 25.775 26.974999999999998 24.2375 23.0125 46-47 26.4625 26.2125 24.8625 22.4625 48-49 26.937499999999996 25.15 24.0375 23.875 50-51 26.087500000000002 25.674999999999997 24.6875 23.549999999999997 52-53 26.3625 26.7625 23.9 22.975 54-55 26.724999999999998 26.5375 24.1375 22.6 56-57 25.424999999999997 25.9625 25.337500000000002 23.275000000000002 58-59 25.912499999999998 25.9625 24.8625 23.2625 60-61 25.2625 26.875 24.925 22.9375 62-63 25.650000000000002 26.1625 24.425 23.7625 64-65 25.4625 27.224999999999998 24.4 22.912499999999998 66-67 25.2625 26.087500000000002 25.124999999999996 23.525 68-69 25.937500000000004 26.775 24.349999999999998 22.9375 70-71 26.2875 25.674999999999997 24.587500000000002 23.45 72-73 25.687500000000004 26.687499999999996 24.675 22.95 74-75 25.35 27.325 24.5625 22.7625 76-77 26.6625 26.450000000000003 23.575 23.3125 78-79 25.775 27.5625 23.5375 23.125 80-81 26.525 26.575 24.525 22.375 82-83 25.890736342042754 26.465808226028255 24.52806600825103 23.11538942367796 84-85 25.324999999999996 27.400000000000002 24.087500000000002 23.1875 86-87 25.25 28.1125 23.5625 23.075000000000003 88-89 25.974999999999998 26.737499999999997 23.9125 23.375 90-91 24.95 26.337500000000002 25.124999999999996 23.5875 92-93 25.137500000000003 27.650000000000002 23.5375 23.674999999999997 94-95 25.693923480870218 27.019254813703427 23.980995248812203 23.305826456614152 96-97 25.087500000000002 26.8625 24.9375 23.1125 98-99 25.1937984496124 27.481870467616904 23.69342335583896 23.63090772693173 100-101 25.746924428822492 27.11523976901833 23.060507155410495 24.077328646748683 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.5 6 1.0 7 1.5 8 1.5 9 2.0 10 2.5 11 1.5 12 0.5 13 1.0 14 2.5 15 2.0 16 1.0 17 1.0 18 0.5 19 0.0 20 2.5 21 3.5 22 2.0 23 1.5 24 1.0 25 1.5 26 1.5 27 3.5 28 8.5 29 9.0 30 7.5 31 13.0 32 18.5 33 20.5 34 23.5 35 29.5 36 46.0 37 59.0 38 77.0 39 97.0 40 112.5 41 122.0 42 146.5 43 180.0 44 197.0 45 219.5 46 211.0 47 184.5 48 182.0 49 175.5 50 165.5 51 154.0 52 139.5 53 127.5 54 119.0 55 109.5 56 92.5 57 86.0 58 81.5 59 68.0 60 62.0 61 62.5 62 54.5 63 53.0 64 47.5 65 45.0 66 45.0 67 39.5 68 38.5 69 31.5 70 24.0 71 23.5 72 25.0 73 23.5 74 19.0 75 14.0 76 14.5 77 11.5 78 8.5 79 6.5 80 5.5 81 5.5 82 5.0 83 6.0 84 3.5 85 1.5 86 2.5 87 2.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0125 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.025 96-97 0.0 98-99 0.025 100-101 0.42500000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.77862595419847 97.05 2 0.8651399491094147 1.7000000000000002 3 0.22900763358778628 0.675 4 0.07633587786259542 0.3 5 0.02544529262086514 0.125 6 0.02544529262086514 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCCACGCCGGTACAGTAGTAGGTAAGTTAGAAGGGGAACGCGAAATCAC 6 0.15 No Hit TAACTGGGGGATTCACCGCAAATACTACTTTGGCTCATTATTGCCGCGAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0125 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.0875 0.0 0.0 0.0 0.0 32-33 0.175 0.0 0.0 0.0 0.0 34-35 0.21250000000000002 0.0 0.0 0.0 0.0 36-37 0.32499999999999996 0.0 0.0 0.0 0.0 38-39 0.4125 0.0 0.0 0.0 0.0 40-41 0.4875 0.0 0.0 0.0 0.0 42-43 0.5625 0.0 0.0 0.0 0.0 44-45 0.6625 0.0 0.0 0.0 0.0 46-47 0.8 0.0 0.0 0.0 0.0 48-49 0.9875 0.0 0.0 0.0 0.0 50-51 1.125 0.0 0.0 0.0 0.0 52-53 1.2125 0.0 0.0 0.0 0.0 54-55 1.3624999999999998 0.0 0.0 0.0 0.0 56-57 1.5625 0.0 0.0 0.0 0.0 58-59 1.7125 0.0 0.0 0.0 0.0 60-61 1.8875000000000002 0.0 0.0 0.0 0.0 62-63 2.1125 0.0 0.0 0.0 0.0 64-65 2.3875 0.0 0.0 0.0 0.0 66-67 2.8 0.0 0.0 0.0 0.0 68-69 3.175 0.0 0.0 0.0 0.0 70-71 3.525 0.0 0.0 0.0 0.0 72-73 4.025 0.0 0.0 0.0 0.0 74-75 4.5125 0.0 0.0 0.0 0.0 76-77 5.0625 0.0 0.0 0.0 0.0 78-79 5.7125 0.0 0.0 0.0 0.0 80-81 6.35 0.0 0.0 0.0 0.0 82-83 6.95 0.0 0.0 0.0 0.0 84-85 7.4875 0.0 0.0 0.0 0.0 86-87 8.175 0.0 0.0 0.0 0.0 88-89 8.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317416 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317416_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.06725 34.0 31.0 34.0 30.0 34.0 2 31.83175 34.0 31.0 34.0 30.0 34.0 3 32.13825 34.0 31.0 34.0 30.0 34.0 4 34.91575 37.0 35.0 37.0 33.0 37.0 5 35.543 37.0 35.0 37.0 33.0 37.0 6 35.55125 37.0 35.0 37.0 35.0 37.0 7 35.56175 37.0 36.0 37.0 35.0 37.0 8 35.60025 37.0 37.0 37.0 35.0 37.0 9 37.4395 39.0 39.0 39.0 35.0 39.0 10-11 37.453125 39.0 38.5 39.0 35.0 39.0 12-13 37.498875 39.0 38.5 39.0 35.0 39.0 14-15 38.937875 41.0 40.0 41.0 36.0 41.0 16-17 38.8145 41.0 39.5 41.0 36.0 41.0 18-19 38.70025 41.0 39.0 41.0 35.0 41.0 20-21 38.658625 41.0 39.0 41.0 35.0 41.0 22-23 38.645125 41.0 39.0 41.0 35.0 41.0 24-25 38.551375 41.0 39.0 41.0 35.0 41.0 26-27 38.42975 41.0 39.0 41.0 35.0 41.0 28-29 38.35325 41.0 39.0 41.0 35.0 41.0 30-31 38.239000000000004 41.0 39.0 41.0 34.5 41.0 32-33 38.164375 40.5 38.0 41.0 34.0 41.0 34-35 38.003 40.0 38.0 41.0 34.0 41.0 36-37 37.908375 40.0 38.0 41.0 33.5 41.0 38-39 37.72375 40.0 38.0 41.0 33.0 41.0 40-41 37.573875 40.0 38.0 41.0 33.0 41.0 42-43 37.482124999999996 40.0 38.0 41.0 32.5 41.0 44-45 37.205125 40.0 37.0 41.0 31.5 41.0 46-47 37.052375 40.0 37.0 41.0 31.5 41.0 48-49 37.009375000000006 40.0 37.0 41.0 32.0 41.0 50-51 36.448499999999996 39.0 35.5 40.5 31.0 40.5 52-53 36.439499999999995 39.0 35.0 40.5 31.0 41.0 54-55 36.624125 40.0 35.0 41.0 31.0 41.0 56-57 36.3995 39.0 35.0 41.0 31.0 41.0 58-59 36.01 39.0 35.0 41.0 29.5 41.0 60-61 35.64375 38.5 35.0 41.0 29.5 41.0 62-63 35.405249999999995 38.0 35.0 40.5 29.0 41.0 64-65 35.05675 37.0 35.0 40.0 29.0 41.0 66-67 34.677375 36.5 34.0 40.0 28.0 41.0 68-69 34.177875 36.0 34.0 39.0 26.5 41.0 70-71 33.752125 35.5 34.0 39.0 26.0 41.0 72-73 33.509375000000006 35.0 34.0 38.5 25.5 40.0 74-75 33.464 35.0 34.0 37.0 27.0 39.5 76-77 33.205125 35.0 34.0 37.0 27.0 39.0 78-79 32.814750000000004 35.0 34.0 36.5 26.0 39.0 80-81 32.41675 35.0 33.5 36.0 25.5 37.0 82-83 32.12975 35.0 33.0 36.0 25.5 37.0 84-85 31.92875 35.0 33.0 35.0 25.0 36.5 86-87 31.630000000000003 35.0 33.0 35.0 24.0 36.0 88-89 31.33475 35.0 33.0 35.0 23.0 36.0 90-91 31.20125 35.0 33.0 35.0 23.0 36.0 92-93 31.0325 35.0 33.0 35.0 20.5 35.0 94-95 30.823999999999998 35.0 33.0 35.0 19.5 35.0 96-97 30.508875 35.0 32.0 35.0 17.0 35.0 98-99 30.110500000000002 35.0 32.0 35.0 2.0 35.0 100-101 28.319875 33.5 28.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 48.0 3 4.0 4 8.0 5 8.0 6 6.0 7 6.0 8 6.0 9 4.0 10 4.0 11 9.0 12 7.0 13 11.0 14 7.0 15 8.0 16 17.0 17 13.0 18 11.0 19 8.0 20 11.0 21 8.0 22 17.0 23 19.0 24 17.0 25 19.0 26 15.0 27 23.0 28 26.0 29 43.0 30 46.0 31 61.0 32 105.0 33 122.0 34 182.0 35 288.0 36 451.0 37 903.0 38 1216.0 39 243.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.625000000000004 11.1 28.9 29.375 2 25.924999999999997 10.625 25.624999999999996 37.824999999999996 3 22.900000000000002 12.525 29.875 34.699999999999996 4 25.25 11.35 27.125 36.275 5 25.8 14.174999999999999 25.25 34.775 6 24.625 18.9 30.625000000000004 25.85 7 19.075 23.95 39.574999999999996 17.4 8 19.125 23.825 36.3 20.75 9 18.4 28.299999999999997 34.125 19.175 10-11 18.975 26.525 31.8625 22.6375 12-13 19.725 27.650000000000002 31.2875 21.337500000000002 14-15 19.8375 25.324999999999996 31.162499999999998 23.674999999999997 16-17 21.4375 25.4 29.15 24.0125 18-19 21.55 25.412499999999998 29.775000000000002 23.2625 20-21 20.75 26.4125 28.525 24.3125 22-23 22.175 25.55 28.475 23.799999999999997 24-25 20.7375 26.05 29.2 24.0125 26-27 22.025 24.95 27.462500000000002 25.5625 28-29 21.5625 25.5 26.987499999999997 25.95 30-31 20.7375 25.587500000000002 29.4 24.275 32-33 22.45 25.374999999999996 28.000000000000004 24.175 34-35 21.45 25.4 27.500000000000004 25.650000000000002 36-37 21.675 25.0 28.775000000000002 24.55 38-39 21.987499999999997 25.15 27.287499999999998 25.575 40-41 22.5625 23.974999999999998 27.750000000000004 25.7125 42-43 22.2125 25.662499999999998 27.1 25.025 44-45 22.1375 26.487500000000004 26.387500000000003 24.9875 46-47 21.6 25.775 26.150000000000002 26.474999999999998 48-49 21.725 26.887499999999996 27.900000000000002 23.4875 50-51 22.1375 25.2875 26.325 26.25 52-53 21.3625 24.9 27.500000000000004 26.237500000000004 54-55 21.875 26.05 27.425 24.65 56-57 22.175 26.137500000000003 26.437500000000004 25.25 58-59 22.4625 25.7125 26.3 25.525 60-61 21.625 25.087500000000002 29.15 24.1375 62-63 22.8625 26.0125 26.075 25.05 64-65 22.625 24.65 26.5125 26.2125 66-67 22.15 25.9875 27.575 24.2875 68-69 22.775000000000002 25.674999999999997 26.737499999999997 24.8125 70-71 23.2375 25.6 25.900000000000002 25.2625 72-73 22.8125 25.4875 26.737499999999997 24.962500000000002 74-75 23.7125 25.15 26.775 24.3625 76-77 24.05 24.8 25.5375 25.6125 78-79 22.6875 25.7625 25.887500000000003 25.662499999999998 80-81 23.0875 26.7125 25.887500000000003 24.3125 82-83 23.525 25.137500000000003 25.5125 25.825 84-85 23.95 25.55 25.825 24.675 86-87 25.0125 25.174999999999997 24.6875 25.124999999999996 88-89 23.875 25.025 25.362499999999997 25.7375 90-91 24.3875 27.212500000000002 25.924999999999997 22.475 92-93 24.5625 24.7375 26.0375 24.6625 94-95 24.4875 25.474999999999998 25.15 24.887500000000003 96-97 24.575 26.575 25.7875 23.0625 98-99 24.875 26.400000000000002 25.0125 23.7125 100-101 25.141065830721004 25.15360501567398 24.63949843260188 25.065830721003135 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 22.0 1 15.0 2 5.5 3 3.5 4 4.5 5 3.0 6 1.5 7 1.0 8 1.5 9 1.5 10 0.5 11 1.5 12 2.0 13 2.5 14 3.0 15 2.5 16 1.5 17 0.5 18 0.0 19 1.0 20 1.5 21 1.5 22 2.0 23 2.0 24 3.0 25 3.0 26 3.0 27 7.0 28 10.5 29 7.5 30 7.5 31 16.0 32 29.0 33 34.5 34 34.0 35 43.0 36 55.0 37 66.5 38 83.5 39 121.5 40 153.0 41 160.0 42 186.0 43 205.0 44 199.5 45 202.0 46 195.0 47 182.5 48 175.0 49 160.5 50 156.0 51 152.5 52 140.5 53 118.0 54 96.5 55 88.5 56 85.0 57 85.5 58 78.0 59 59.5 60 49.5 61 50.0 62 52.0 63 50.0 64 39.5 65 32.5 66 29.5 67 26.5 68 23.5 69 21.0 70 22.0 71 20.5 72 20.5 73 22.5 74 14.0 75 7.5 76 8.0 77 7.0 78 7.0 79 7.5 80 5.0 81 2.0 82 2.0 83 3.5 84 2.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.3125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.00383141762453 96.89999999999999 2 0.7918263090676885 1.55 3 0.07662835249042146 0.22499999999999998 4 0.02554278416347382 0.1 5 0.05108556832694764 0.25 6 0.02554278416347382 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02554278416347382 0.8250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 33 0.8250000000000001 No Hit CCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGG 6 0.15 No Hit TGGGGGTGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 5 0.125 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0125 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.0875 0.0 0.0 0.0 0.0 32-33 0.175 0.0 0.0 0.0 0.0 34-35 0.21250000000000002 0.0 0.0 0.0 0.0 36-37 0.30000000000000004 0.0 0.0 0.0 0.0 38-39 0.375 0.0 0.0 0.0 0.0 40-41 0.4375 0.0 0.0 0.0 0.0 42-43 0.5125 0.0 0.0 0.0 0.0 44-45 0.6125 0.0 0.0 0.0 0.0 46-47 0.75 0.0 0.0 0.0 0.0 48-49 0.9375 0.0 0.0 0.0 0.0 50-51 1.0875 0.0 0.0 0.0 0.0 52-53 1.1875 0.0 0.0 0.0 0.0 54-55 1.3125 0.0 0.0 0.0 0.0 56-57 1.4625 0.0 0.0 0.0 0.0 58-59 1.65 0.0 0.0 0.0 0.0 60-61 1.8375 0.0 0.0 0.0 0.0 62-63 2.0875 0.0 0.0 0.0 0.0 64-65 2.3625 0.0 0.0 0.0 0.0 66-67 2.7750000000000004 0.0 0.0 0.0 0.0 68-69 3.1500000000000004 0.0 0.0 0.0 0.0 70-71 3.4875 0.0 0.0 0.0 0.0 72-73 3.9375 0.0 0.0 0.0 0.0 74-75 4.387499999999999 0.0 0.0 0.0 0.0 76-77 4.9125 0.0 0.0 0.0 0.0 78-79 5.5375 0.0 0.0 0.0 0.0 80-81 6.137499999999999 0.0 0.0 0.0 0.0 82-83 6.6875 0.0 0.0 0.0 0.0 84-85 7.2375 0.0 0.0 0.0 0.0 86-87 7.9125 0.0 0.0 0.0 0.0 88-89 8.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1954704 spots for ERR3317416.sra Written 1954704 spots for ERR3317416.sra Read 1954704 spots for ERR3317416.sra Written 1954704 spots for ERR3317416.sra Read 1954704 spots for ERR3317416.sra Written 1954704 spots for ERR3317416.sra Read 1954704 spots for ERR3317416.sra Written 1954704 spots for ERR3317416.sra Read 1954704 spots for ERR3317416.sra Written 1954704 spots for ERR3317416.sra Read 1954704 spots for ERR3317416.sra Written 1954704 spots for ERR3317416.sra Read 1954704 spots for ERR3317416.sra Written 1954704 spots for ERR3317416.sra Read 1954710 spots for ERR3317416.sra Written 1954710 spots for ERR3317416.sra Read 1954704 spots for ERR3317416.sra Written 1954704 spots for ERR3317416.sra Read 1954704 spots for ERR3317416.sra Written 1954704 spots for ERR3317416.sra Read 1954704 spots for ERR3317416.sra Written 1954704 spots for ERR3317416.sra Read 1954704 spots for ERR3317416.sra Written 1954704 spots for ERR3317416.sra Read 1954704 spots for ERR3317416.sra Written 1954704 spots for ERR3317416.sra Read 1954704 spots for ERR3317416.sra Written 1954704 spots for ERR3317416.sra Read 1954704 spots for ERR3317416.sra Written 1954704 spots for ERR3317416.sra Read 1954704 spots for ERR3317416.sra Written 1954704 spots for ERR3317416.sra Read 1954704 spots for ERR3317416.sra Written 1954704 spots for ERR3317416.sra Read 1954704 spots for ERR3317416.sra Written 1954704 spots for ERR3317416.sra Read 1954704 spots for ERR3317416.sra Written 1954704 spots for ERR3317416.sra Read 1954704 spots for ERR3317416.sra Written 1954704 spots for ERR3317416.sra SRR ids: ['ERR3317416.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_eioci96_ ERR3317416.sra spots: 39094086 blocks: [[1, 1954704], [1954705, 3909408], [3909409, 5864112], [5864113, 7818816], [7818817, 9773520], [9773521, 11728224], [11728225, 13682928], [13682929, 15637632], [15637633, 17592336], [17592337, 19547040], [19547041, 21501744], [21501745, 23456448], [23456449, 25411152], [25411153, 27365856], [27365857, 29320560], [29320561, 31275264], [31275265, 33229968], [33229969, 35184672], [35184673, 37139376], [37139377, 39094086]] ERR3317416 file size 9408220 ERR3317416 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317416 ERR3317416_1.fastq ERR3317416_2.fastq Input file: ERR3317416_1.fastq Paired file: ERR3317416_2.fastq trimmed: ERR3317416-trimmed-pair1.fastq, ERR3317416-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 08:40:22 2024 >> started Tue Dec 10 08:41:00 2024 >> done (37.785s) 39094086 read pairs processed; of these: 273026 ( 0.70%) short read pairs filtered out after trimming by size control 666177 ( 1.70%) empty read pairs filtered out after trimming by size control 38154883 (97.60%) read pairs available; of these: 12413085 (32.53%) trimmed read pairs available after processing 25741798 (67.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1096 0.00% 19 1255 0.00% 20 1664 0.00% 21 1855 0.00% 22 2293 0.01% 23 3081 0.01% 24 3877 0.01% 25 4376 0.01% 26 5345 0.01% 27 5988 0.02% 28 6522 0.02% 29 8132 0.02% 30 9520 0.02% 31 13146 0.03% 32 11431 0.03% 33 12294 0.03% 34 15801 0.04% 35 15335 0.04% 36 16733 0.04% 37 17847 0.05% 38 20807 0.05% 39 21462 0.06% 40 22073 0.06% 41 24626 0.06% 42 25750 0.07% 43 26860 0.07% 44 29174 0.08% 45 30289 0.08% 46 32386 0.08% 47 37432 0.10% 48 38196 0.10% 49 39772 0.10% 50 45885 0.12% 51 44497 0.12% 52 46316 0.12% 53 50241 0.13% 54 53122 0.14% 55 56897 0.15% 56 60439 0.16% 57 63944 0.17% 58 67781 0.18% 59 85101 0.22% 60 97728 0.26% 61 101450 0.27% 62 109743 0.29% 63 115080 0.30% 64 120987 0.32% 65 128216 0.34% 66 138974 0.36% 67 140210 0.37% 68 144465 0.38% 69 147335 0.39% 70 152058 0.40% 71 157040 0.41% 72 161738 0.42% 73 170880 0.45% 74 170161 0.45% 75 173564 0.45% 76 167829 0.44% 77 180130 0.47% 78 192797 0.51% 79 202216 0.53% 80 207938 0.54% 81 206149 0.54% 82 202350 0.53% 83 211804 0.56% 84 219054 0.57% 85 231301 0.61% 86 232890 0.61% 87 236235 0.62% 88 243541 0.64% 89 269702 0.71% 90 257142 0.67% 91 271634 0.71% 92 294469 0.77% 93 311987 0.82% 94 338516 0.89% 95 379222 0.99% 96 426828 1.12% 97 501986 1.32% 98 615995 1.61% 99 834359 2.19% 100 1866741 4.89% 101 25741798 67.47% 38154883 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=17 prefix-density=0.78 prefix-fanout=2.4 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=95.48 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=13.1 sequence=GCCGCCGCCGCCA criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=26 prefix-density=0.73 prefix-fanout=1.0 sequence=ATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=47 fanout-score=164.35 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=2.4 sequence=TATAAGAAAGAAAGTGATTTTCTCAACTCTTTCAAACTTTTAGGAATTCACATATGCAAGCTAGCTCCTCGATCGAGAGCCAGGTTGCTACACACAACAACAATCTTGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTGAGCTGACACTTTATATATGGTCCATCTTAATACGGAGCTGTCCTTGGTTGTTTATGCCTTGCCGGATTCCTCGCAGCCCGGTGGCTT ERR3317416 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 08:41:39 Started mapping on | Dec 10 08:41:41 Finished on | Dec 10 08:43:41 Mapping speed, Million of reads per hour | 1144.65 Number of input reads | 38154883 Average input read length | 191 UNIQUE READS: Uniquely mapped reads number | 34785402 Uniquely mapped reads % | 91.17% Average mapped length | 189.79 Number of splices: Total | 21609180 Number of splices: Annotated (sjdb) | 20523671 Number of splices: GT/AG | 21293296 Number of splices: GC/AG | 283818 Number of splices: AT/AC | 13016 Number of splices: Non-canonical | 19050 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.00% Deletion average length | 1.21 Insertion rate per base | 0.00% Insertion average length | 1.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2379101 % of reads mapped to multiple loci | 6.24% Number of reads mapped to too many loci | 36798 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.90% % of reads unmapped: other | 0.60% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1163615 1163615 1163615 N_multimapping 2379101 2379101 2379101 N_noFeature 1251296 2869778 32411634 N_ambiguous 1035400 308264 15976 UnstrandedReadsAssigned:32498706 PositiveStrandReadsAssigned:31607360 NegativeStrandReadsAssigned:2357792 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=99 echo kmer=95 ERR3317416 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317416-trimmed-pair1.fastq ERR3317416-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,154,883 reads, 33,468,981 reads pseudoaligned [quant] estimated average fragment length: 191.204 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,297 rounds 52973 ERR3317416.ke.tsv 35125 ERR3317416.se.tsv 88098 total ==> ERR3317416.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 745.952 0 0 PNS24247 1044 853.796 55.0583 2.91373 PNS24249 1928 1737.8 135.564 3.52472 PNS24246 1044 853.796 55.0583 2.91373 PNS24248 1044 853.796 55.0583 2.91373 PNS24244 1471 1280.8 299.261 10.5572 PNS24243 293 132.436 5 1.70586 KQK14069 1603 1412.8 21370.2 683.453 KQK14071 474 290.923 35.3735 5.49389 ==> ERR3317416.se.tsv <== BRADI_1g14170v3 23491 BRADI_1g53295v3 64 BRADI_1g59795v3 393 BRADI_1g07683v3 0 BRADI_1g00485v3 59 BRADI_1g20270v3 737 BRADI_1g74790v3 1109 BRADI_1g09890v3 11 BRADI_1g77505v3 444 BRADI_1g48960v3 0 ERR3317416 completed mapping pipeline successfully