Starting /dee2/code/volunteer_pipeline.sh ERR3317417 current disk space = 1526485577728 free memory = 1450304256 ERR3317417 SRAfilesize 8787137d3a4865e9545c9104c4fc8099 ERR3317417.sra ERR3317417.sra file validated ERR3317417 is paired end ERR3317417 is conventional basespace ERR3317417 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317417_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.31275 34.0 31.0 34.0 30.0 34.0 2 32.20075 34.0 31.0 34.0 30.0 34.0 3 32.84825 34.0 31.0 34.0 31.0 34.0 4 36.37875 37.0 37.0 37.0 35.0 37.0 5 36.42 37.0 37.0 37.0 35.0 37.0 6 36.414 37.0 37.0 37.0 35.0 37.0 7 36.43325 37.0 37.0 37.0 35.0 37.0 8 36.415 37.0 37.0 37.0 35.0 37.0 9 38.24 39.0 39.0 39.0 37.0 39.0 10-11 38.245000000000005 39.0 39.0 39.0 37.0 39.0 12-13 38.21025 39.0 39.0 39.0 37.0 39.0 14-15 39.6635 41.0 40.0 41.0 37.0 41.0 16-17 39.661625 41.0 40.0 41.0 37.0 41.0 18-19 39.574625 41.0 39.5 41.0 37.0 41.0 20-21 39.564375 41.0 40.0 41.0 37.0 41.0 22-23 39.446625 41.0 39.0 41.0 36.5 41.0 24-25 39.38275 41.0 39.0 41.0 36.0 41.0 26-27 39.201625 41.0 39.0 41.0 36.0 41.0 28-29 38.946124999999995 40.0 39.0 41.0 35.0 41.0 30-31 38.812875000000005 40.0 38.0 41.0 35.0 41.0 32-33 38.657 40.0 38.0 41.0 34.5 41.0 34-35 38.344625 40.0 38.0 41.0 34.0 41.0 36-37 38.1125 40.0 38.0 41.0 33.0 41.0 38-39 37.84 40.0 38.0 41.0 33.0 41.0 40-41 37.658125 40.0 37.5 41.0 33.0 41.0 42-43 37.704375 40.0 37.0 41.0 33.0 41.0 44-45 37.47 40.0 37.0 41.0 32.0 41.0 46-47 37.224875 40.0 36.5 41.0 32.0 41.0 48-49 36.83562499999999 39.5 36.0 41.0 31.0 41.0 50-51 37.156 40.0 36.0 41.0 31.5 41.0 52-53 37.099500000000006 40.0 36.0 41.0 31.5 41.0 54-55 36.880125 39.0 35.0 41.0 31.5 41.0 56-57 36.506 39.0 35.0 41.0 31.0 41.0 58-59 36.18675 38.5 35.0 41.0 31.0 41.0 60-61 35.868875 38.0 35.0 41.0 30.5 41.0 62-63 35.452625 37.0 35.0 40.0 29.5 41.0 64-65 35.035624999999996 37.0 34.5 40.0 29.0 41.0 66-67 34.5985 36.0 34.0 39.0 28.5 41.0 68-69 34.214375000000004 36.0 34.0 39.0 28.5 41.0 70-71 33.758250000000004 35.0 34.0 38.5 27.0 40.0 72-73 33.23025 35.0 34.0 37.0 26.0 39.0 74-75 32.804249999999996 35.0 33.0 37.0 25.5 39.0 76-77 31.6075 34.5 31.5 35.5 24.5 37.0 78-79 32.075125 35.0 33.0 36.0 25.0 37.0 80-81 31.9125 35.0 33.0 35.5 24.5 37.0 82-83 31.59475 35.0 33.0 35.0 24.0 36.5 84-85 31.257375 35.0 32.0 35.0 23.0 36.0 86-87 30.974125 35.0 32.0 35.0 21.5 36.0 88-89 30.73575 35.0 31.5 35.0 19.5 35.5 90-91 30.47025 35.0 31.0 35.0 18.0 35.0 92-93 30.186374999999998 35.0 31.0 35.0 15.5 35.0 94-95 29.95025 34.0 31.0 35.0 4.5 35.0 96-97 29.489125 34.0 31.0 35.0 2.0 35.0 98-99 28.903125000000003 34.0 30.0 35.0 2.0 35.0 100-101 26.247500000000002 32.0 24.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 4.0 9 3.0 10 6.0 11 4.0 12 7.0 13 19.0 14 16.0 15 11.0 16 9.0 17 11.0 18 14.0 19 23.0 20 18.0 21 12.0 22 17.0 23 18.0 24 21.0 25 21.0 26 33.0 27 39.0 28 55.0 29 60.0 30 58.0 31 93.0 32 101.0 33 148.0 34 213.0 35 322.0 36 535.0 37 1005.0 38 984.0 39 118.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.394410756657003 26.46981281307672 18.61323490640654 26.522541523859744 2 27.650000000000002 23.875 17.849999999999998 30.625000000000004 3 27.275 26.125 17.8 28.799999999999997 4 29.2 25.650000000000002 14.424999999999999 30.725 5 28.325 24.25 16.05 31.374999999999996 6 28.349999999999998 28.325 19.475 23.849999999999998 7 31.175000000000004 24.25 22.375 22.2 8 31.724999999999998 25.825 24.775 17.675 9 31.924999999999997 25.424999999999997 26.075 16.575 10-11 31.162499999999998 26.9625 23.3125 18.5625 12-13 28.000000000000004 27.025 24.8125 20.1625 14-15 26.05 26.6625 25.75 21.5375 16-17 24.575 27.0 26.5625 21.8625 18-19 26.2625 26.174999999999997 26.25 21.3125 20-21 25.174999999999997 26.987499999999997 25.587500000000002 22.25 22-23 25.4625 27.400000000000002 24.575 22.5625 24-25 25.0125 26.637499999999996 26.087500000000002 22.2625 26-27 24.637500000000003 26.650000000000002 26.2625 22.45 28-29 25.662499999999998 26.2625 24.975 23.1 30-31 25.0125 26.6125 25.074999999999996 23.3 32-33 25.1 26.174999999999997 25.324999999999996 23.400000000000002 34-35 24.55 26.5375 25.362499999999997 23.549999999999997 36-37 25.2625 26.650000000000002 25.387500000000003 22.7 38-39 24.85 26.3125 25.724999999999998 23.1125 40-41 25.5 26.775 24.6875 23.0375 42-43 25.5125 26.575 25.337500000000002 22.575 44-45 25.5 26.087500000000002 24.95 23.4625 46-47 25.887500000000003 26.424999999999997 23.6125 24.075 48-49 25.974999999999998 27.0625 24.887500000000003 22.075 50-51 25.275 26.05 25.5625 23.1125 52-53 25.9875 26.025 25.337500000000002 22.650000000000002 54-55 26.0375 27.250000000000004 24.575 22.1375 56-57 25.0375 26.0375 25.8625 23.0625 58-59 25.1 26.125 25.874999999999996 22.900000000000002 60-61 25.2 26.987499999999997 24.95 22.8625 62-63 25.637500000000003 26.775 24.85 22.7375 64-65 25.362499999999997 27.55 24.0125 23.075000000000003 66-67 25.9875 26.2875 25.174999999999997 22.55 68-69 25.412499999999998 27.437499999999996 24.075 23.075000000000003 70-71 26.0625 27.1625 23.974999999999998 22.8 72-73 25.7125 26.3625 24.875 23.05 74-75 25.662499999999998 26.5375 24.9875 22.8125 76-77 24.75 26.987499999999997 24.775 23.4875 78-79 25.112499999999997 27.125 24.8 22.9625 80-81 24.5375 27.575 25.025 22.8625 82-83 25.05 27.400000000000002 24.462500000000002 23.0875 84-85 27.0 26.650000000000002 23.6375 22.7125 86-87 25.5 26.224999999999998 25.0625 23.2125 88-89 26.1625 26.525 24.3625 22.95 90-91 26.0 27.187499999999996 24.2625 22.55 92-93 24.762500000000003 26.1 25.337500000000002 23.799999999999997 94-95 25.687500000000004 27.6625 23.4375 23.2125 96-97 25.8125 26.9625 23.849999999999998 23.375 98-99 25.900000000000002 27.212500000000002 23.549999999999997 23.3375 100-101 26.1125 27.237499999999997 23.4125 23.2375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 1.0 3 1.5 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.5 10 1.5 11 1.5 12 1.0 13 0.5 14 0.5 15 1.5 16 1.0 17 1.5 18 2.0 19 2.5 20 2.0 21 1.0 22 1.5 23 1.0 24 1.5 25 2.0 26 2.5 27 3.0 28 7.5 29 10.0 30 10.0 31 12.5 32 13.5 33 18.5 34 27.0 35 32.5 36 38.0 37 55.0 38 76.5 39 104.0 40 135.0 41 144.0 42 165.5 43 191.5 44 204.5 45 218.0 46 213.0 47 197.5 48 186.5 49 175.5 50 176.0 51 166.0 52 137.5 53 117.5 54 115.0 55 112.0 56 90.0 57 82.5 58 78.5 59 76.0 60 67.5 61 52.5 62 51.5 63 46.5 64 43.5 65 40.0 66 35.0 67 28.0 68 24.5 69 27.5 70 25.5 71 21.0 72 17.5 73 14.0 74 10.5 75 10.0 76 7.5 77 7.5 78 7.5 79 6.0 80 8.0 81 6.5 82 2.0 83 2.0 84 1.5 85 0.5 86 3.0 87 4.5 88 3.0 89 1.5 90 0.5 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08883826879271 97.875 2 0.7086813464945584 1.4000000000000001 3 0.12655024044545685 0.375 4 0.02531004808909137 0.1 5 0.05062009617818274 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGACCTTGTTATTGTGAGAATTCTTAATTCAAGAGTTGTAAGGAGGGACT 5 0.125 No Hit AGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCGAGTTCGCGCCGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.0625 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.0875 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.15 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.16249999999999998 0.0 0.0 0.0 0.0 40-41 0.2 0.0 0.0 0.0 0.0 42-43 0.275 0.0 0.0 0.0 0.0 44-45 0.2875 0.0 0.0 0.0 0.0 46-47 0.3875 0.0 0.0 0.0 0.0 48-49 0.4375 0.0 0.0 0.0 0.0 50-51 0.5625 0.0 0.0 0.0 0.0 52-53 0.725 0.0 0.0 0.0 0.0 54-55 0.875 0.0 0.0 0.0 0.0 56-57 1.0125 0.0 0.0 0.0 0.0 58-59 1.2125 0.0 0.0 0.0 0.0 60-61 1.425 0.0 0.0 0.0 0.0 62-63 1.6375 0.0 0.0 0.0 0.0 64-65 1.85 0.0 0.0 0.0 0.0 66-67 2.025 0.0 0.0 0.0 0.0 68-69 2.3 0.0 0.0 0.0 0.0 70-71 2.625 0.0 0.0 0.0 0.0 72-73 3.0375 0.0 0.0 0.0 0.0 74-75 3.5 0.0 0.0 0.0 0.0 76-77 3.8875 0.0 0.0 0.0 0.0 78-79 4.3 0.0 0.0 0.0 0.0 80-81 4.7375 0.0 0.0 0.0 0.0 82-83 5.15 0.0 0.0 0.0 0.0 84-85 5.6125 0.0 0.0 0.0 0.0 86-87 6.0375 0.0 0.0 0.0 0.0 88-89 6.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317417 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317417_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.2845 33.0 31.0 34.0 30.0 34.0 2 31.6535 33.0 31.0 34.0 30.0 34.0 3 31.932 34.0 31.0 34.0 30.0 34.0 4 35.318 37.0 35.0 37.0 33.0 37.0 5 34.573 37.0 35.0 37.0 33.0 37.0 6 34.98475 37.0 35.0 37.0 33.0 37.0 7 35.3825 37.0 36.0 37.0 33.0 37.0 8 35.516 37.0 36.0 37.0 35.0 37.0 9 37.3685 39.0 38.0 39.0 35.0 39.0 10-11 37.24912500000001 39.0 38.0 39.0 35.0 39.0 12-13 37.27275 39.0 38.0 39.0 35.0 39.0 14-15 38.75475 41.0 39.5 41.0 35.5 41.0 16-17 38.764375 41.0 39.0 41.0 36.0 41.0 18-19 38.685 41.0 39.0 41.0 35.0 41.0 20-21 38.659 41.0 39.0 41.0 35.0 41.0 22-23 38.518875 41.0 39.0 41.0 35.0 41.0 24-25 38.42375 41.0 39.0 41.0 35.0 41.0 26-27 38.414874999999995 41.0 39.0 41.0 35.0 41.0 28-29 38.237625 41.0 39.0 41.0 35.0 41.0 30-31 38.073125000000005 40.0 38.0 41.0 34.0 41.0 32-33 37.92075 40.0 38.0 41.0 33.5 41.0 34-35 37.786375 40.0 38.0 41.0 33.0 41.0 36-37 37.675875000000005 40.0 38.0 41.0 33.0 41.0 38-39 37.6345 40.0 38.0 41.0 33.0 41.0 40-41 37.72 40.0 38.0 41.0 33.0 41.0 42-43 37.58775 40.0 38.0 41.0 33.0 41.0 44-45 37.536125 40.0 38.0 41.0 33.0 41.0 46-47 37.3635 40.0 37.5 41.0 32.5 41.0 48-49 37.058375 40.0 37.0 41.0 32.0 41.0 50-51 36.291250000000005 39.0 36.0 40.5 30.5 40.5 52-53 36.234625 39.0 35.0 40.5 30.5 41.0 54-55 36.482749999999996 39.5 35.0 41.0 31.0 41.0 56-57 36.368375 39.0 35.0 41.0 31.0 41.0 58-59 36.11725 39.0 35.0 41.0 30.5 41.0 60-61 35.688 38.5 35.0 41.0 29.5 41.0 62-63 35.405125 38.0 35.0 40.0 28.5 41.0 64-65 35.0835 37.0 35.0 40.0 29.0 41.0 66-67 35.125 37.0 35.0 40.0 29.0 41.0 68-69 34.681875 36.0 35.0 39.0 29.0 41.0 70-71 34.47375 36.0 35.0 39.0 29.0 41.0 72-73 34.00325 35.0 34.5 39.0 28.5 40.5 74-75 33.50725 35.0 34.0 37.0 27.0 39.5 76-77 33.3035 35.0 34.0 37.0 28.0 39.0 78-79 32.974875 35.0 34.0 36.5 27.0 39.0 80-81 32.639125 35.0 34.0 36.0 27.0 37.0 82-83 32.40925 35.0 34.0 36.0 26.5 37.0 84-85 32.153125 35.0 33.5 35.0 26.0 36.5 86-87 31.953 35.0 33.0 35.0 25.5 36.0 88-89 31.73975 35.0 33.0 35.0 25.0 36.0 90-91 31.541375000000002 35.0 33.0 35.0 24.5 36.0 92-93 31.354999999999997 35.0 33.0 35.0 24.0 35.0 94-95 31.147125000000003 35.0 33.0 35.0 23.0 35.0 96-97 30.997625 35.0 33.0 35.0 21.5 35.0 98-99 30.6875 35.0 33.0 35.0 18.0 35.0 100-101 28.63225 33.5 28.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 64.0 3 10.0 4 4.0 5 2.0 6 3.0 7 3.0 8 5.0 9 4.0 10 12.0 11 5.0 12 7.0 13 5.0 14 5.0 15 11.0 16 10.0 17 12.0 18 9.0 19 5.0 20 13.0 21 9.0 22 8.0 23 13.0 24 20.0 25 14.0 26 23.0 27 21.0 28 30.0 29 42.0 30 45.0 31 59.0 32 96.0 33 120.0 34 179.0 35 256.0 36 450.0 37 963.0 38 1237.0 39 226.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.657164291072768 9.65241310327582 26.356589147286826 35.33383345836459 2 25.900000000000002 11.25 25.974999999999998 36.875 3 22.75 13.65 29.549999999999997 34.050000000000004 4 25.025 11.325000000000001 26.575 37.075 5 26.745379876796715 13.783367556468173 24.12731006160164 35.34394250513347 6 25.674999999999997 18.575 28.625 27.125 7 18.2 25.8 38.800000000000004 17.2 8 18.5 26.1 35.5 19.900000000000002 9 18.25 27.474999999999998 34.050000000000004 20.225 10-11 18.9625 27.2625 31.7875 21.987499999999997 12-13 19.325 27.075 32.225 21.375 14-15 19.2375 26.924999999999997 30.525000000000002 23.3125 16-17 20.2375 26.4125 29.2375 24.1125 18-19 19.9875 26.950000000000003 30.325000000000003 22.7375 20-21 21.087500000000002 26.150000000000002 28.787499999999998 23.974999999999998 22-23 21.125 25.35 28.449999999999996 25.074999999999996 24-25 20.5 25.974999999999998 29.862499999999997 23.6625 26-27 21.4875 26.450000000000003 28.249999999999996 23.8125 28-29 21.65 25.337500000000002 26.7625 26.25 30-31 20.525 26.400000000000002 28.499999999999996 24.575 32-33 21.7375 25.7625 27.700000000000003 24.8 34-35 20.8875 25.6 27.187499999999996 26.325 36-37 22.0625 25.3125 27.925 24.7 38-39 22.025 25.674999999999997 27.325 24.975 40-41 22.55 24.5125 27.212500000000002 25.724999999999998 42-43 20.925 25.95 28.125 25.0 44-45 22.1 25.85 26.375 25.674999999999997 46-47 22.15 26.0125 26.387500000000003 25.45 48-49 21.2375 27.425 27.200000000000003 24.1375 50-51 22.3875 26.075 27.150000000000002 24.3875 52-53 22.05 25.525 26.2125 26.2125 54-55 21.25 26.8 27.8125 24.1375 56-57 21.85 25.650000000000002 27.450000000000003 25.05 58-59 21.0625 26.55 27.6375 24.75 60-61 21.175 26.4625 27.6375 24.725 62-63 22.225 27.125 25.924999999999997 24.725 64-65 22.5125 25.525 27.250000000000004 24.712500000000002 66-67 22.95 26.7125 26.487500000000004 23.849999999999998 68-69 23.45 25.074999999999996 26.5 24.975 70-71 21.7375 25.937500000000004 26.5 25.825 72-73 22.1375 25.825 27.3 24.7375 74-75 22.6 26.0625 26.987499999999997 24.349999999999998 76-77 23.0125 25.2 26.0625 25.724999999999998 78-79 22.325 26.0125 26.937499999999996 24.725 80-81 22.537499999999998 26.637499999999996 25.95 24.875 82-83 23.4875 25.650000000000002 25.9875 24.875 84-85 23.0375 25.074999999999996 27.224999999999998 24.6625 86-87 24.0125 25.837500000000002 26.375 23.775 88-89 24.3 24.349999999999998 26.9125 24.4375 90-91 24.0375 25.575 26.3 24.087500000000002 92-93 24.474999999999998 24.8625 27.1625 23.5 94-95 24.775 24.9 26.224999999999998 24.099999999999998 96-97 24.962500000000002 25.474999999999998 26.5125 23.05 98-99 24.575 25.525 26.224999999999998 23.674999999999997 100-101 25.7125 24.6125 25.224999999999998 24.45 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 23.0 1 15.5 2 5.5 3 2.0 4 1.0 5 1.5 6 2.5 7 1.5 8 0.5 9 1.5 10 1.5 11 3.5 12 3.5 13 1.0 14 0.5 15 2.0 16 2.5 17 1.0 18 2.0 19 2.5 20 1.5 21 2.5 22 3.5 23 2.0 24 0.5 25 2.5 26 6.5 27 6.5 28 8.5 29 13.0 30 13.0 31 15.5 32 22.0 33 28.5 34 33.5 35 40.0 36 56.5 37 78.5 38 97.0 39 125.0 40 150.5 41 173.0 42 203.0 43 219.5 44 212.0 45 190.5 46 198.0 47 192.0 48 170.5 49 155.0 50 151.5 51 159.5 52 137.0 53 121.0 54 103.5 55 83.0 56 85.5 57 81.0 58 69.0 59 65.5 60 54.0 61 47.0 62 41.0 63 32.0 64 30.5 65 32.0 66 28.5 67 22.0 68 24.0 69 25.0 70 18.5 71 16.0 72 18.5 73 15.5 74 10.5 75 6.5 76 7.5 77 7.5 78 4.5 79 3.0 80 2.5 81 1.5 82 2.5 83 3.5 84 1.0 85 0.0 86 1.0 87 1.5 88 0.5 89 0.0 90 0.0 91 0.5 92 0.5 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 2.6 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.82352941176471 96.6 2 0.9718670076726342 1.9 3 0.07672634271099744 0.22499999999999998 4 0.051150895140664954 0.2 5 0.025575447570332477 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025575447570332477 0.22499999999999998 >10 0.025575447570332477 0.7250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 29 0.7250000000000001 No Hit TGGGGGTGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 9 0.22499999999999998 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.0625 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.0875 0.0 0.0 0.0 0.0 34-35 0.1375 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.16249999999999998 0.0 0.0 0.0 0.0 40-41 0.2 0.0 0.0 0.0 0.0 42-43 0.275 0.0 0.0 0.0 0.0 44-45 0.2875 0.0 0.0 0.0 0.0 46-47 0.3875 0.0 0.0 0.0 0.0 48-49 0.4375 0.0 0.0 0.0 0.0 50-51 0.5375 0.0 0.0 0.0 0.0 52-53 0.7 0.0 0.0 0.0 0.0 54-55 0.8500000000000001 0.0 0.0 0.0 0.0 56-57 0.9875 0.0 0.0 0.0 0.0 58-59 1.1875 0.0 0.0 0.0 0.0 60-61 1.4 0.0 0.0 0.0 0.0 62-63 1.55 0.0 0.0 0.0 0.0 64-65 1.75 0.0 0.0 0.0 0.0 66-67 1.9625 0.0 0.0 0.0 0.0 68-69 2.25 0.0 0.0 0.0 0.0 70-71 2.5875 0.0 0.0 0.0 0.0 72-73 3.0 0.0 0.0 0.0 0.0 74-75 3.4625000000000004 0.0 0.0 0.0 0.0 76-77 3.875 0.0 0.0 0.0 0.0 78-79 4.325 0.0 0.0 0.0 0.0 80-81 4.7375 0.0 0.0 0.0 0.0 82-83 5.1375 0.0 0.0 0.0 0.0 84-85 5.6 0.0 0.0 0.0 0.0 86-87 6.025 0.0 0.0 0.0 0.0 88-89 6.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1680667 spots for ERR3317417.sra Written 1680667 spots for ERR3317417.sra Read 1680667 spots for ERR3317417.sra Written 1680667 spots for ERR3317417.sra Read 1680667 spots for ERR3317417.sra Written 1680667 spots for ERR3317417.sra Read 1680667 spots for ERR3317417.sra Written 1680667 spots for ERR3317417.sra Read 1680667 spots for ERR3317417.sra Written 1680667 spots for ERR3317417.sra Read 1680667 spots for ERR3317417.sra Written 1680667 spots for ERR3317417.sra Read 1680667 spots for ERR3317417.sra Written 1680667 spots for ERR3317417.sra Read 1680667 spots for ERR3317417.sra Written 1680667 spots for ERR3317417.sra Read 1680667 spots for ERR3317417.sra Written 1680667 spots for ERR3317417.sra Read 1680667 spots for ERR3317417.sra Written 1680667 spots for ERR3317417.sra Read 1680667 spots for ERR3317417.sra Written 1680667 spots for ERR3317417.sra Read 1680667 spots for ERR3317417.sra Written 1680667 spots for ERR3317417.sra Read 1680667 spots for ERR3317417.sra Written 1680667 spots for ERR3317417.sra Read 1680667 spots for ERR3317417.sra Written 1680667 spots for ERR3317417.sra Read 1680667 spots for ERR3317417.sra Written 1680667 spots for ERR3317417.sra Read 1680667 spots for ERR3317417.sra Written 1680667 spots for ERR3317417.sra Read 1680667 spots for ERR3317417.sra Written 1680667 spots for ERR3317417.sra Read 1680667 spots for ERR3317417.sra Written 1680667 spots for ERR3317417.sra Read 1680674 spots for ERR3317417.sra Written 1680674 spots for ERR3317417.sra Read 1680667 spots for ERR3317417.sra Written 1680667 spots for ERR3317417.sra SRR ids: ['ERR3317417.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0bwdxs0f ERR3317417.sra spots: 33613347 blocks: [[1, 1680667], [1680668, 3361334], [3361335, 5042001], [5042002, 6722668], [6722669, 8403335], [8403336, 10084002], [10084003, 11764669], [11764670, 13445336], [13445337, 15126003], [15126004, 16806670], [16806671, 18487337], [18487338, 20168004], [20168005, 21848671], [21848672, 23529338], [23529339, 25210005], [25210006, 26890672], [26890673, 28571339], [28571340, 30252006], [30252007, 31932673], [31932674, 33613347]] ERR3317417 file size 8086206 ERR3317417 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317417 ERR3317417_1.fastq ERR3317417_2.fastq Input file: ERR3317417_1.fastq Paired file: ERR3317417_2.fastq trimmed: ERR3317417-trimmed-pair1.fastq, ERR3317417-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 08:40:25 2024 >> started Tue Dec 10 08:40:59 2024 >> done (34.572s) 33613347 read pairs processed; of these: 231458 ( 0.69%) short read pairs filtered out after trimming by size control 702040 ( 2.09%) empty read pairs filtered out after trimming by size control 32679849 (97.22%) read pairs available; of these: 9994322 (30.58%) trimmed read pairs available after processing 22685527 (69.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 441 0.00% 19 509 0.00% 20 665 0.00% 21 907 0.00% 22 1347 0.00% 23 1692 0.01% 24 2112 0.01% 25 2531 0.01% 26 3133 0.01% 27 3435 0.01% 28 4008 0.01% 29 4484 0.01% 30 4968 0.02% 31 6647 0.02% 32 6561 0.02% 33 7318 0.02% 34 8644 0.03% 35 9039 0.03% 36 9817 0.03% 37 10744 0.03% 38 12227 0.04% 39 13045 0.04% 40 13831 0.04% 41 15603 0.05% 42 16929 0.05% 43 17595 0.05% 44 18874 0.06% 45 20025 0.06% 46 21838 0.07% 47 24000 0.07% 48 25053 0.08% 49 25958 0.08% 50 29795 0.09% 51 30207 0.09% 52 31582 0.10% 53 34845 0.11% 54 39222 0.12% 55 42624 0.13% 56 42762 0.13% 57 45279 0.14% 58 47956 0.15% 59 62089 0.19% 60 73096 0.22% 61 76536 0.23% 62 83077 0.25% 63 87864 0.27% 64 93052 0.28% 65 98534 0.30% 66 107192 0.33% 67 107391 0.33% 68 110272 0.34% 69 113533 0.35% 70 118164 0.36% 71 123513 0.38% 72 128599 0.39% 73 136037 0.42% 74 136403 0.42% 75 136595 0.42% 76 137100 0.42% 77 142688 0.44% 78 158076 0.48% 79 153307 0.47% 80 158509 0.49% 81 164142 0.50% 82 162632 0.50% 83 172857 0.53% 84 175745 0.54% 85 187635 0.57% 86 191972 0.59% 87 198698 0.61% 88 203969 0.62% 89 224974 0.69% 90 214798 0.66% 91 226177 0.69% 92 237562 0.73% 93 254577 0.78% 94 273757 0.84% 95 292414 0.89% 96 323865 0.99% 97 380669 1.16% 98 518330 1.59% 99 663308 2.03% 100 1726362 5.28% 101 22685527 69.42% 32679849 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=3.04 fanout-score-rank=14 prefix-density=0.66 prefix-fanout=2.7 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.14 sequence-density-rank=13 fanout-score=9.75 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=9.8 sequence=AGATCGGAAGAGCACACC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=17.48 fanout-score-rank=5 prefix-density=0.19 prefix-fanout=17.5 sequence=GGTGTGCTCTTCCGATCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=120.23 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=10.6 sequence=TTTCCTTTTTGTTTGTTTCGAGAAAGATATCGTCCGATTCTCCTTCTATTGATTCTTTTCCGATCGAGATGTATGGATCCATGTGTCTACATACCTAGATTCTGTTCATGGATTAACGAAAATGTGCAAGAGCTCTATTTGCCTCTGCCATTCTATGAGTCGCTTCCTTTTTGCGTATGGCACCCCCACTCCCTTTGGCAGCATCTACTAATT ERR3317417 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 08:41:49 Started mapping on | Dec 10 08:41:49 Finished on | Dec 10 08:43:35 Mapping speed, Million of reads per hour | 1109.88 Number of input reads | 32679849 Average input read length | 192 UNIQUE READS: Uniquely mapped reads number | 29550089 Uniquely mapped reads % | 90.42% Average mapped length | 191.02 Number of splices: Total | 18554782 Number of splices: Annotated (sjdb) | 17659841 Number of splices: GT/AG | 18292154 Number of splices: GC/AG | 231312 Number of splices: AT/AC | 14201 Number of splices: Non-canonical | 17115 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.00% Deletion average length | 1.21 Insertion rate per base | 0.00% Insertion average length | 1.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2090259 % of reads mapped to multiple loci | 6.40% Number of reads mapped to too many loci | 58287 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.05% % of reads unmapped: other | 0.95% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1207830 1207830 1207830 N_multimapping 2090259 2090259 2090259 N_noFeature 1036053 3333785 26631032 N_ambiguous 879806 289552 20986 UnstrandedReadsAssigned:27634230 PositiveStrandReadsAssigned:25926752 NegativeStrandReadsAssigned:2898071 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=97 echo kmer=93 ERR3317417 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317417-trimmed-pair1.fastq ERR3317417-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,679,849 reads, 27,538,375 reads pseudoaligned [quant] estimated average fragment length: 190.854 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52973 ERR3317417.ke.tsv 35125 ERR3317417.se.tsv 88098 total ==> ERR3317417.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 746.485 0 0 PNS24247 1044 854.146 25.2412 1.64448 PNS24249 1928 1738.15 119.626 3.82995 PNS24246 1044 854.146 25.2412 1.64448 PNS24248 1044 854.146 25.2412 1.64448 PNS24244 1471 1281.15 221.65 9.62767 PNS24243 293 134.431 0 0 KQK14069 1603 1413.15 3306.57 130.21 KQK14071 474 294.916 16.4315 3.10049 ==> ERR3317417.se.tsv <== BRADI_1g14170v3 4008 BRADI_1g53295v3 21 BRADI_1g59795v3 244 BRADI_1g07683v3 0 BRADI_1g00485v3 68 BRADI_1g20270v3 1583 BRADI_1g74790v3 767 BRADI_1g09890v3 5 BRADI_1g77505v3 425 BRADI_1g48960v3 0 ERR3317417 completed mapping pipeline successfully