Starting /dee2/code/volunteer_pipeline.sh ERR3317418 current disk space = 1526498942976 free memory = 1533401080 ERR3317418 SRAfilesize 2eb2d4c32b07460f7f181acab91755a4 ERR3317418.sra ERR3317418.sra file validated ERR3317418 is paired end ERR3317418 is conventional basespace ERR3317418 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317418_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3345 34.0 31.0 34.0 30.0 34.0 2 32.21 34.0 31.0 34.0 30.0 34.0 3 32.771 34.0 31.0 34.0 31.0 34.0 4 36.357 37.0 37.0 37.0 35.0 37.0 5 36.3475 37.0 37.0 37.0 35.0 37.0 6 36.368 37.0 37.0 37.0 35.0 37.0 7 36.33225 37.0 37.0 37.0 35.0 37.0 8 36.3355 37.0 37.0 37.0 35.0 37.0 9 38.207 39.0 39.0 39.0 37.0 39.0 10-11 38.144375 39.0 39.0 39.0 37.0 39.0 12-13 38.120374999999996 39.0 39.0 39.0 37.0 39.0 14-15 39.630750000000006 41.0 40.0 41.0 37.0 41.0 16-17 39.598875 41.0 40.0 41.0 37.0 41.0 18-19 39.48625 41.0 39.5 41.0 36.5 41.0 20-21 39.5585 41.0 40.0 41.0 37.0 41.0 22-23 39.4075 41.0 39.0 41.0 36.0 41.0 24-25 39.294250000000005 41.0 39.0 41.0 36.0 41.0 26-27 39.109375 41.0 39.0 41.0 35.5 41.0 28-29 38.9165 40.0 39.0 41.0 35.0 41.0 30-31 38.682125 40.0 38.0 41.0 35.0 41.0 32-33 38.562 40.0 38.0 41.0 34.5 41.0 34-35 38.368625 40.0 38.0 41.0 34.0 41.0 36-37 38.1045 40.0 38.0 41.0 33.5 41.0 38-39 37.79775 40.0 38.0 41.0 33.0 41.0 40-41 37.6285 40.0 37.0 41.0 33.0 41.0 42-43 37.7085 40.0 37.0 41.0 33.0 41.0 44-45 37.4825 40.0 37.0 41.0 32.0 41.0 46-47 37.199749999999995 40.0 36.5 41.0 31.5 41.0 48-49 36.947125 39.5 36.0 41.0 31.0 41.0 50-51 37.312 40.0 36.0 41.0 32.0 41.0 52-53 37.15925 40.0 35.5 41.0 32.0 41.0 54-55 36.908 39.0 35.0 41.0 32.0 41.0 56-57 36.571125 39.0 35.0 41.0 31.0 41.0 58-59 36.232124999999996 38.5 35.0 41.0 31.0 41.0 60-61 35.777249999999995 38.0 35.0 41.0 30.0 41.0 62-63 35.463 37.0 35.0 40.0 30.0 41.0 64-65 35.01625 36.5 34.5 40.0 29.5 41.0 66-67 34.638625000000005 36.0 34.0 39.0 29.0 41.0 68-69 34.292 35.5 34.0 39.0 28.5 41.0 70-71 33.76825 35.0 34.0 37.5 26.5 40.0 72-73 33.312125 35.0 33.5 37.0 26.0 39.0 74-75 32.833125 35.0 33.0 37.0 25.5 39.0 76-77 31.637375 34.5 31.5 35.5 24.5 37.0 78-79 32.099875 35.0 33.0 36.0 25.0 37.0 80-81 31.981875000000002 35.0 33.0 35.5 25.0 37.0 82-83 31.694 35.0 33.0 35.0 24.0 36.5 84-85 31.412625 35.0 32.5 35.0 24.0 36.0 86-87 31.17775 35.0 32.0 35.0 23.0 36.0 88-89 30.885375000000003 35.0 32.0 35.0 20.0 35.5 90-91 30.695 35.0 32.0 35.0 19.5 35.0 92-93 30.394875 35.0 31.5 35.0 17.5 35.0 94-95 30.123125 34.5 31.0 35.0 12.0 35.0 96-97 29.7325 34.0 31.0 35.0 2.0 35.0 98-99 29.359875000000002 34.0 31.0 35.0 2.0 35.0 100-101 26.725125 32.0 25.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 2.0 7 0.0 8 3.0 9 7.0 10 5.0 11 8.0 12 3.0 13 7.0 14 7.0 15 18.0 16 11.0 17 13.0 18 22.0 19 17.0 20 15.0 21 13.0 22 17.0 23 25.0 24 15.0 25 23.0 26 32.0 27 43.0 28 38.0 29 49.0 30 74.0 31 97.0 32 95.0 33 147.0 34 209.0 35 306.0 36 562.0 37 989.0 38 993.0 39 132.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.0 25.105263157894736 18.052631578947366 26.842105263157894 2 26.375 26.5 17.474999999999998 29.65 3 27.975 25.2 18.275 28.549999999999997 4 28.749999999999996 24.85 15.1 31.3 5 29.15 23.974999999999998 16.325 30.55 6 29.15 27.625 18.6 24.625 7 31.35 24.725 22.025 21.9 8 32.525 25.3 24.275 17.9 9 32.025 27.950000000000003 24.325 15.7 10-11 32.3125 26.275 22.787499999999998 18.625 12-13 28.6375 26.937499999999996 24.712500000000002 19.7125 14-15 26.0375 27.3625 25.224999999999998 21.375 16-17 25.687500000000004 26.974999999999998 25.5625 21.775 18-19 25.3 28.025 25.4625 21.212500000000002 20-21 26.424999999999997 26.724999999999998 25.900000000000002 20.95 22-23 24.7375 27.725 25.35 22.1875 24-25 25.074999999999996 26.674999999999997 25.5625 22.6875 26-27 25.112499999999997 27.55 24.75 22.5875 28-29 24.9875 26.437500000000004 25.55 23.025000000000002 30-31 25.074999999999996 26.8 25.5 22.625 32-33 24.7875 27.3 24.725 23.1875 34-35 25.025 26.4625 25.674999999999997 22.8375 36-37 25.9625 26.525 25.5 22.0125 38-39 26.0125 26.4125 25.224999999999998 22.35 40-41 24.825 26.275 25.637500000000003 23.2625 42-43 25.575 26.5375 25.0625 22.825 44-45 25.374999999999996 26.337500000000002 25.174999999999997 23.1125 46-47 25.112499999999997 26.3 24.3875 24.2 48-49 25.2875 26.687499999999996 25.4 22.625 50-51 25.775 26.5625 25.162499999999998 22.5 52-53 25.412499999999998 27.075 24.4875 23.025000000000002 54-55 24.75 26.3 26.3125 22.6375 56-57 24.9 27.0125 25.25 22.8375 58-59 25.0 26.775 24.887500000000003 23.3375 60-61 25.025 27.175 25.0625 22.7375 62-63 25.174999999999997 26.900000000000002 24.7 23.225 64-65 25.25 26.724999999999998 24.887500000000003 23.1375 66-67 25.1875 26.525 25.3125 22.975 68-69 26.0625 27.075 24.2625 22.6 70-71 26.025 26.8625 23.6625 23.45 72-73 25.6125 27.075 24.8125 22.5 74-75 24.9875 26.8 24.9375 23.275000000000002 76-77 26.1 27.3125 23.9125 22.675 78-79 26.125 27.675 24.637500000000003 21.5625 80-81 25.7875 27.537499999999998 23.9875 22.6875 82-83 25.4375 26.674999999999997 24.4 23.4875 84-85 25.95 26.474999999999998 24.5 23.075000000000003 86-87 25.2 27.3 24.3875 23.1125 88-89 25.374999999999996 27.2625 23.825 23.5375 90-91 25.7375 25.887500000000003 25.224999999999998 23.150000000000002 92-93 25.1875 26.8125 24.962500000000002 23.0375 94-95 25.8625 26.7125 24.0625 23.3625 96-97 25.3 27.05 25.2375 22.412499999999998 98-99 25.4625 26.5 24.5 23.5375 100-101 26.987499999999997 26.424999999999997 23.2625 23.325000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.5 2 1.5 3 0.5 4 0.0 5 0.5 6 1.0 7 1.0 8 1.0 9 0.5 10 0.0 11 0.5 12 0.5 13 0.5 14 1.0 15 1.0 16 1.5 17 1.0 18 0.0 19 0.0 20 0.5 21 2.0 22 2.5 23 2.5 24 2.0 25 2.0 26 3.0 27 5.0 28 5.5 29 8.0 30 11.5 31 14.5 32 16.0 33 21.0 34 31.5 35 34.5 36 43.0 37 56.0 38 82.5 39 111.0 40 127.0 41 159.0 42 188.5 43 196.5 44 204.0 45 207.0 46 192.5 47 185.0 48 197.5 49 187.0 50 158.5 51 147.5 52 140.0 53 120.0 54 104.0 55 96.0 56 93.0 57 93.5 58 87.0 59 70.5 60 53.0 61 57.5 62 62.5 63 46.5 64 33.5 65 35.0 66 35.0 67 30.5 68 30.0 69 28.5 70 21.0 71 19.0 72 17.0 73 14.5 74 14.5 75 10.5 76 11.0 77 10.5 78 8.5 79 7.5 80 5.5 81 4.5 82 3.0 83 2.5 84 2.5 85 3.0 86 3.5 87 2.0 88 1.5 89 1.5 90 0.0 91 0.5 92 0.5 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 5.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.72999745999492 97.175 2 1.0922021844043688 2.15 3 0.0762001524003048 0.22499999999999998 4 0.0762001524003048 0.3 5 0.0 0.0 6 0.025400050800101596 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCGAGTTCGCGCCGG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.0625 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.2 0.0 0.0 0.0 0.0 40-41 0.225 0.0 0.0 0.0 0.0 42-43 0.25 0.0 0.0 0.0 0.0 44-45 0.25 0.0 0.0 0.0 0.0 46-47 0.3625 0.0 0.0 0.0 0.0 48-49 0.4375 0.0 0.0 0.0 0.0 50-51 0.4625 0.0 0.0 0.0 0.0 52-53 0.525 0.0 0.0 0.0 0.0 54-55 0.6000000000000001 0.0 0.0 0.0 0.0 56-57 0.8375 0.0 0.0 0.0 0.0 58-59 0.9874999999999999 0.0 0.0 0.0 0.0 60-61 1.1625 0.0 0.0 0.0 0.0 62-63 1.35 0.0 0.0 0.0 0.0 64-65 1.5 0.0 0.0 0.0 0.0 66-67 1.6124999999999998 0.0 0.0 0.0 0.0 68-69 1.7125 0.0 0.0 0.0 0.0 70-71 2.1 0.0 0.0 0.0 0.0 72-73 2.5375 0.0 0.0 0.0 0.0 74-75 2.7750000000000004 0.0 0.0 0.0 0.0 76-77 3.0875000000000004 0.0 0.0 0.0 0.0 78-79 3.4125 0.0 0.0 0.0 0.0 80-81 3.7249999999999996 0.0 0.0 0.0 0.0 82-83 4.025 0.0 0.0 0.0 0.0 84-85 4.3875 0.0 0.0 0.0 0.0 86-87 4.8 0.0 0.0 0.0 0.0 88-89 5.199999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317418 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317418_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.052 33.0 31.0 34.0 28.0 34.0 2 31.571 33.0 31.0 34.0 30.0 34.0 3 31.86325 34.0 31.0 34.0 30.0 34.0 4 35.22725 37.0 35.0 37.0 33.0 37.0 5 34.49575 37.0 35.0 37.0 33.0 37.0 6 34.93975 37.0 35.0 37.0 32.0 37.0 7 35.348 37.0 35.0 37.0 33.0 37.0 8 35.495 37.0 36.0 37.0 35.0 37.0 9 37.2765 39.0 38.0 39.0 35.0 39.0 10-11 37.218875 39.0 38.0 39.0 35.0 39.0 12-13 37.211 39.0 38.0 39.0 35.0 39.0 14-15 38.661625 41.0 39.0 41.0 35.0 41.0 16-17 38.7185 41.0 39.0 41.0 36.0 41.0 18-19 38.639624999999995 41.0 39.0 41.0 35.0 41.0 20-21 38.585375 41.0 39.0 41.0 35.0 41.0 22-23 38.4845 41.0 39.0 41.0 35.0 41.0 24-25 38.330124999999995 41.0 39.0 41.0 34.5 41.0 26-27 38.220625 41.0 39.0 41.0 34.0 41.0 28-29 38.08 41.0 38.5 41.0 34.0 41.0 30-31 37.8665 40.0 38.0 41.0 33.0 41.0 32-33 37.810874999999996 40.0 38.0 41.0 33.0 41.0 34-35 37.669 40.0 38.0 41.0 33.0 41.0 36-37 37.705375000000004 40.0 38.0 41.0 33.0 41.0 38-39 37.568875 40.0 38.0 41.0 33.0 41.0 40-41 37.588499999999996 40.0 38.0 41.0 33.0 41.0 42-43 37.51375 40.0 38.0 41.0 33.0 41.0 44-45 37.39375 40.0 38.0 41.0 33.0 41.0 46-47 37.270125 40.0 37.5 41.0 31.5 41.0 48-49 37.055 40.0 37.0 41.0 32.0 41.0 50-51 36.256875 39.0 36.0 40.5 30.0 40.5 52-53 36.097875 39.0 35.0 40.5 30.0 41.0 54-55 36.316625 39.0 35.0 41.0 30.5 41.0 56-57 36.30225 39.0 35.0 41.0 31.0 41.0 58-59 36.016625000000005 39.0 35.0 41.0 30.0 41.0 60-61 35.5945 38.5 35.0 41.0 28.0 41.0 62-63 35.350750000000005 38.0 35.0 40.5 29.0 41.0 64-65 35.088499999999996 37.5 35.0 40.0 29.0 41.0 66-67 35.16 37.0 35.0 40.0 30.0 41.0 68-69 34.8035 37.0 35.0 39.5 29.0 41.0 70-71 34.473 36.0 35.0 39.0 29.0 41.0 72-73 34.026875000000004 35.5 34.0 39.0 28.5 41.0 74-75 33.586 35.0 34.0 37.5 27.0 39.5 76-77 33.396625 35.0 34.0 37.0 28.5 39.0 78-79 33.017624999999995 35.0 34.0 36.5 27.5 39.0 80-81 32.694500000000005 35.0 34.0 36.0 26.5 37.0 82-83 32.441125 35.0 34.0 36.0 26.5 37.0 84-85 32.204125000000005 35.0 34.0 35.0 26.5 36.5 86-87 31.896625 35.0 33.0 35.0 25.5 36.0 88-89 31.689875 35.0 33.0 35.0 25.0 36.0 90-91 31.400624999999998 35.0 33.0 35.0 24.0 36.0 92-93 31.283375 35.0 33.0 35.0 24.0 35.5 94-95 31.120625 35.0 33.0 35.0 23.0 35.0 96-97 30.94525 35.0 33.0 35.0 19.5 35.0 98-99 30.672375000000002 35.0 33.0 35.0 12.5 35.0 100-101 28.633249999999997 33.5 28.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 65.0 3 5.0 4 0.0 5 7.0 6 8.0 7 7.0 8 2.0 9 7.0 10 10.0 11 10.0 12 8.0 13 8.0 14 11.0 15 8.0 16 6.0 17 10.0 18 7.0 19 8.0 20 12.0 21 9.0 22 11.0 23 13.0 24 12.0 25 17.0 26 26.0 27 26.0 28 35.0 29 36.0 30 46.0 31 63.0 32 84.0 33 113.0 34 174.0 35 261.0 36 456.0 37 890.0 38 1294.0 39 235.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.51575787893947 10.830415207603803 27.913956978489246 29.739869934967484 2 26.650000000000002 10.725 25.5 37.125 3 23.325000000000003 13.3 29.299999999999997 34.075 4 23.549999999999997 11.700000000000001 27.6 37.15 5 24.017467248908297 15.001284356537376 24.5825841253532 36.398664269201134 6 25.724999999999998 18.4 30.075000000000003 25.8 7 19.1 23.025000000000002 39.65 18.224999999999998 8 18.224999999999998 25.75 34.75 21.275 9 17.1 28.075 35.425000000000004 19.400000000000002 10-11 18.6875 27.075 32.7875 21.45 12-13 19.825 26.687499999999996 32.337500000000006 21.15 14-15 19.8125 26.0125 31.8125 22.3625 16-17 20.599999999999998 25.637500000000003 29.825000000000003 23.9375 18-19 20.125 26.937499999999996 30.362499999999997 22.575 20-21 20.2625 26.275 28.775000000000002 24.6875 22-23 20.474999999999998 24.5625 29.3375 25.624999999999996 24-25 20.175 26.1 29.475 24.25 26-27 21.2875 26.2625 27.325 25.124999999999996 28-29 21.075 25.162499999999998 28.1 25.662499999999998 30-31 20.5875 26.2875 29.512500000000003 23.6125 32-33 22.1 25.825 27.975 24.099999999999998 34-35 20.724999999999998 25.0125 28.1125 26.150000000000002 36-37 21.375 26.7125 28.6625 23.25 38-39 21.925 25.674999999999997 27.650000000000002 24.75 40-41 21.9625 25.2125 26.8125 26.0125 42-43 20.674999999999997 26.1125 27.925 25.2875 44-45 21.425 26.474999999999998 27.325 24.775 46-47 21.5 25.337500000000002 27.1 26.0625 48-49 20.8125 27.625 27.712500000000002 23.849999999999998 50-51 22.3 26.5 26.424999999999997 24.775 52-53 22.1875 25.5375 27.2625 25.0125 54-55 20.325 26.2875 29.2875 24.099999999999998 56-57 21.075 26.075 28.1125 24.7375 58-59 21.912499999999998 25.0 27.737499999999997 25.35 60-61 20.962500000000002 26.0375 27.9375 25.0625 62-63 21.912499999999998 26.224999999999998 27.224999999999998 24.637500000000003 64-65 22.45 24.837500000000002 26.674999999999997 26.0375 66-67 21.375 25.9625 28.812500000000004 23.849999999999998 68-69 22.95 26.05 26.950000000000003 24.05 70-71 22.662499999999998 26.2125 26.4625 24.6625 72-73 21.85 25.6 27.962500000000002 24.587500000000002 74-75 21.8625 25.637500000000003 27.325 25.174999999999997 76-77 22.15 26.1125 25.7625 25.974999999999998 78-79 22.5 25.8 26.8 24.9 80-81 23.175 26.125 26.25 24.45 82-83 23.3125 25.5125 25.85 25.324999999999996 84-85 22.675 26.125 27.425 23.775 86-87 23.6125 26.400000000000002 26.187500000000004 23.799999999999997 88-89 23.325000000000003 26.187500000000004 25.324999999999996 25.162499999999998 90-91 23.400000000000002 26.7625 26.5375 23.3 92-93 22.825 26.2125 26.924999999999997 24.0375 94-95 23.5875 24.675 26.7625 24.975 96-97 23.75 27.075 25.874999999999996 23.3 98-99 23.0875 25.8125 26.387500000000003 24.712500000000002 100-101 25.0 25.0 25.662499999999998 24.337500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 24.0 1 19.0 2 7.5 3 2.0 4 3.0 5 2.5 6 1.0 7 1.0 8 2.0 9 1.0 10 2.5 11 2.5 12 0.5 13 1.0 14 2.0 15 1.5 16 0.5 17 3.5 18 3.5 19 1.5 20 1.5 21 0.5 22 1.5 23 3.5 24 6.0 25 7.0 26 5.0 27 8.0 28 9.0 29 9.0 30 13.0 31 18.0 32 27.5 33 29.5 34 40.0 35 54.0 36 60.0 37 82.0 38 117.0 39 136.0 40 153.5 41 173.5 42 200.0 43 218.5 44 208.0 45 200.0 46 195.0 47 184.0 48 169.5 49 158.0 50 149.5 51 143.5 52 134.5 53 113.0 54 83.5 55 74.5 56 86.5 57 71.5 58 51.0 59 56.5 60 56.5 61 46.5 62 41.5 63 46.5 64 43.0 65 32.0 66 26.0 67 25.5 68 23.0 69 18.0 70 19.0 71 19.5 72 12.0 73 7.5 74 8.0 75 7.0 76 7.5 77 8.5 78 5.5 79 4.0 80 6.0 81 5.0 82 2.0 83 0.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.5 89 1.0 90 1.5 91 1.0 92 0.0 93 0.5 94 0.5 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 2.675 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.02713773681515 96.7 2 0.7168458781362007 1.4000000000000001 3 0.051203277009728626 0.15 4 0.07680491551459294 0.3 5 0.025601638504864313 0.125 6 0.025601638504864313 0.15 7 0.025601638504864313 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.051203277009728626 1.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 30 0.75 No Hit TCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 10 0.25 No Hit TCTTCGTATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 7 0.17500000000000002 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 6 0.15 No Hit TTTTTCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.0625 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.15 0.0 0.0 0.0 0.0 40-41 0.175 0.0 0.0 0.0 0.0 42-43 0.2 0.0 0.0 0.0 0.0 44-45 0.2 0.0 0.0 0.0 0.0 46-47 0.3125 0.0 0.0 0.0 0.0 48-49 0.3875 0.0 0.0 0.0 0.0 50-51 0.4125 0.0 0.0 0.0 0.0 52-53 0.475 0.0 0.0 0.0 0.0 54-55 0.55 0.0 0.0 0.0 0.0 56-57 0.7875 0.0 0.0 0.0 0.0 58-59 0.9375 0.0 0.0 0.0 0.0 60-61 1.1125 0.0 0.0 0.0 0.0 62-63 1.3 0.0 0.0 0.0 0.0 64-65 1.45 0.0 0.0 0.0 0.0 66-67 1.5625 0.0 0.0 0.0 0.0 68-69 1.65 0.0 0.0 0.0 0.0 70-71 2.0 0.0 0.0 0.0 0.0 72-73 2.4625000000000004 0.0 0.0 0.0 0.0 74-75 2.7249999999999996 0.0 0.0 0.0 0.0 76-77 3.025 0.0 0.0 0.0 0.0 78-79 3.325 0.0 0.0 0.0 0.0 80-81 3.625 0.0 0.0 0.0 0.0 82-83 3.9250000000000003 0.0 0.0 0.0 0.0 84-85 4.3125 0.0 0.0 0.0 0.0 86-87 4.725 0.0 0.0 0.0 0.0 88-89 5.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1827752 spots for ERR3317418.sra Written 1827752 spots for ERR3317418.sra Read 1827752 spots for ERR3317418.sra Written 1827752 spots for ERR3317418.sra Read 1827752 spots for ERR3317418.sra Written 1827752 spots for ERR3317418.sra Read 1827752 spots for ERR3317418.sra Written 1827752 spots for ERR3317418.sra Read 1827752 spots for ERR3317418.sra Written 1827752 spots for ERR3317418.sra Read 1827752 spots for ERR3317418.sra Written 1827752 spots for ERR3317418.sra Read 1827752 spots for ERR3317418.sra Written 1827752 spots for ERR3317418.sra Read 1827752 spots for ERR3317418.sra Written 1827752 spots for ERR3317418.sra Read 1827755 spots for ERR3317418.sra Written 1827755 spots for ERR3317418.sra Read 1827752 spots for ERR3317418.sra Written 1827752 spots for ERR3317418.sra Read 1827752 spots for ERR3317418.sra Written 1827752 spots for ERR3317418.sra Read 1827752 spots for ERR3317418.sra Written 1827752 spots for ERR3317418.sra Read 1827752 spots for ERR3317418.sra Written 1827752 spots for ERR3317418.sra Read 1827752 spots for ERR3317418.sra Written 1827752 spots for ERR3317418.sra Read 1827752 spots for ERR3317418.sra Written 1827752 spots for ERR3317418.sra Read 1827752 spots for ERR3317418.sra Written 1827752 spots for ERR3317418.sra Read 1827752 spots for ERR3317418.sra Written 1827752 spots for ERR3317418.sra Read 1827752 spots for ERR3317418.sra Written 1827752 spots for ERR3317418.sra Read 1827752 spots for ERR3317418.sra Written 1827752 spots for ERR3317418.sra Read 1827752 spots for ERR3317418.sra Written 1827752 spots for ERR3317418.sra SRR ids: ['ERR3317418.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fqt1y7fd ERR3317418.sra spots: 36555043 blocks: [[1, 1827752], [1827753, 3655504], [3655505, 5483256], [5483257, 7311008], [7311009, 9138760], [9138761, 10966512], [10966513, 12794264], [12794265, 14622016], [14622017, 16449768], [16449769, 18277520], [18277521, 20105272], [20105273, 21933024], [21933025, 23760776], [23760777, 25588528], [25588529, 27416280], [27416281, 29244032], [29244033, 31071784], [31071785, 32899536], [32899537, 34727288], [34727289, 36555043]] ERR3317418 file size 8795775 ERR3317418 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317418 ERR3317418_1.fastq ERR3317418_2.fastq Input file: ERR3317418_1.fastq Paired file: ERR3317418_2.fastq trimmed: ERR3317418-trimmed-pair1.fastq, ERR3317418-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 08:40:33 2024 >> started Tue Dec 10 08:41:07 2024 >> done (34.670s) 36555043 read pairs processed; of these: 245640 ( 0.67%) short read pairs filtered out after trimming by size control 708886 ( 1.94%) empty read pairs filtered out after trimming by size control 35600517 (97.39%) read pairs available; of these: 10031054 (28.18%) trimmed read pairs available after processing 25569463 (71.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 503 0.00% 19 515 0.00% 20 640 0.00% 21 874 0.00% 22 1167 0.00% 23 1583 0.00% 24 2085 0.01% 25 2393 0.01% 26 2702 0.01% 27 3356 0.01% 28 3656 0.01% 29 4168 0.01% 30 4740 0.01% 31 6334 0.02% 32 6309 0.02% 33 6766 0.02% 34 8215 0.02% 35 8700 0.02% 36 9489 0.03% 37 10028 0.03% 38 11843 0.03% 39 12160 0.03% 40 13106 0.04% 41 14549 0.04% 42 15656 0.04% 43 16465 0.05% 44 17683 0.05% 45 18706 0.05% 46 20122 0.06% 47 22670 0.06% 48 23444 0.07% 49 24607 0.07% 50 27731 0.08% 51 27984 0.08% 52 29442 0.08% 53 31879 0.09% 54 36488 0.10% 55 39535 0.11% 56 39287 0.11% 57 42807 0.12% 58 44517 0.13% 59 59453 0.17% 60 71261 0.20% 61 74977 0.21% 62 80913 0.23% 63 85767 0.24% 64 91238 0.26% 65 96132 0.27% 66 105717 0.30% 67 105452 0.30% 68 107785 0.30% 69 109509 0.31% 70 114663 0.32% 71 120342 0.34% 72 126053 0.35% 73 132272 0.37% 74 132425 0.37% 75 133242 0.37% 76 132044 0.37% 77 138809 0.39% 78 153260 0.43% 79 148502 0.42% 80 153150 0.43% 81 159160 0.45% 82 157264 0.44% 83 169154 0.48% 84 170084 0.48% 85 182424 0.51% 86 185914 0.52% 87 194951 0.55% 88 199338 0.56% 89 221788 0.62% 90 211739 0.59% 91 222654 0.63% 92 233628 0.66% 93 252592 0.71% 94 271262 0.76% 95 294471 0.83% 96 328059 0.92% 97 390767 1.10% 98 542858 1.52% 99 698407 1.96% 100 1856670 5.22% 101 25569463 71.82% 35600517 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=3.11 fanout-score-rank=19 prefix-density=0.70 prefix-fanout=2.8 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.07 sequence-density-rank=23 fanout-score=182.27 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=20.8 sequence=GAAGAAGAAGAAA criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=29 prefix-density=0.31 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=131.22 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=10.7 sequence=TTTCCTTTTTGTTTGTTTCGAGAAAGATATCGTCCGATTCTCCTTCTATTGATTCTTTTCCGATCGAGATGTATGGATCCATGTGTCTACATACCTAGATTCTGTTCATGGATTAACGAAAATGTGCAAGAGCTCTATTTGCCTCTGCCATTCTATGAGTCGCTTCCTTTTTGCGTATGGCACCCCCACTCCCTTTGGCAGCATCTACTAATT ERR3317418 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 08:41:45 Started mapping on | Dec 10 08:41:45 Finished on | Dec 10 08:43:52 Mapping speed, Million of reads per hour | 1009.15 Number of input reads | 35600517 Average input read length | 193 UNIQUE READS: Uniquely mapped reads number | 32456929 Uniquely mapped reads % | 91.17% Average mapped length | 192.22 Number of splices: Total | 20637583 Number of splices: Annotated (sjdb) | 19621984 Number of splices: GT/AG | 20345867 Number of splices: GC/AG | 259205 Number of splices: AT/AC | 15774 Number of splices: Non-canonical | 16737 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.00% Deletion average length | 1.18 Insertion rate per base | 0.00% Insertion average length | 1.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2149499 % of reads mapped to multiple loci | 6.04% Number of reads mapped to too many loci | 47122 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.92% % of reads unmapped: other | 0.74% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1166522 1166522 1166522 N_multimapping 2149499 2149499 2149499 N_noFeature 1219222 3550217 29439967 N_ambiguous 982387 332360 24370 UnstrandedReadsAssigned:30255320 PositiveStrandReadsAssigned:28574352 NegativeStrandReadsAssigned:2992592 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=99 echo kmer=95 ERR3317418 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317418-trimmed-pair1.fastq ERR3317418-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,600,517 reads, 30,330,417 reads pseudoaligned [quant] estimated average fragment length: 203.896 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,223 rounds 52973 ERR3317418.ke.tsv 35125 ERR3317418.se.tsv 88098 total ==> ERR3317418.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 733.453 0 0 PNS24247 1044 841.104 37.0002 2.21718 PNS24249 1928 1725.1 110.602 3.23142 PNS24246 1044 841.104 37.0002 2.21718 PNS24248 1044 841.104 37.0002 2.21718 PNS24244 1471 1268.1 253.398 10.0715 PNS24243 293 125.61 1 0.401256 KQK14069 1603 1400.1 4272.22 153.794 KQK14071 474 282.197 32.9639 5.88754 ==> ERR3317418.se.tsv <== BRADI_1g14170v3 5671 BRADI_1g53295v3 32 BRADI_1g59795v3 265 BRADI_1g07683v3 0 BRADI_1g00485v3 93 BRADI_1g20270v3 1367 BRADI_1g74790v3 580 BRADI_1g09890v3 10 BRADI_1g77505v3 413 BRADI_1g48960v3 0 ERR3317418 completed mapping pipeline successfully