Starting /dee2/code/volunteer_pipeline.sh ERR3317419 current disk space = 1526391476224 free memory = 1530675412 ERR3317419 SRAfilesize ea6f6a46564cbbf96562319fa76c3d5e ERR3317419.sra ERR3317419.sra file validated ERR3317419 is paired end ERR3317419 is conventional basespace ERR3317419 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317419_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.10075 33.0 31.0 34.0 30.0 34.0 2 32.39 34.0 31.0 34.0 31.0 34.0 3 32.5075 34.0 31.0 34.0 31.0 34.0 4 36.08325 37.0 35.0 37.0 35.0 37.0 5 35.621 37.0 35.0 37.0 35.0 37.0 6 35.75625 37.0 35.0 37.0 35.0 37.0 7 35.8 37.0 35.0 37.0 33.0 37.0 8 35.805 37.0 35.0 37.0 35.0 37.0 9 37.48525 39.0 37.0 39.0 35.0 39.0 10-11 37.441874999999996 39.0 37.0 39.0 34.0 39.0 12-13 37.418875 39.0 37.0 39.0 34.0 39.0 14-15 38.732 40.0 38.0 41.0 34.5 41.0 16-17 38.71875 40.0 38.0 41.0 34.0 41.0 18-19 38.685375 40.0 38.0 41.0 34.5 41.0 20-21 38.657250000000005 40.0 38.0 41.0 34.0 41.0 22-23 38.583625 40.0 38.0 41.0 34.0 41.0 24-25 38.528000000000006 40.0 38.0 41.0 34.0 41.0 26-27 38.306 40.0 38.0 41.0 33.5 41.0 28-29 38.090125 40.0 37.5 41.0 33.0 41.0 30-31 38.05025 40.0 37.5 41.0 33.0 41.0 32-33 37.9615 40.0 37.0 41.0 33.0 41.0 34-35 37.635125 40.0 37.0 41.0 32.0 41.0 36-37 37.595124999999996 40.0 37.0 41.0 32.5 41.0 38-39 37.553375 40.0 36.5 41.0 32.0 41.0 40-41 37.50175 40.0 36.0 41.0 32.0 41.0 42-43 37.257374999999996 39.5 36.0 41.0 31.0 41.0 44-45 36.830125 39.0 35.0 41.0 30.5 41.0 46-47 36.975625 39.0 35.0 41.0 30.5 41.0 48-49 37.152375 39.0 35.0 41.0 32.0 41.0 50-51 36.96175 39.0 35.0 41.0 31.5 41.0 52-53 36.6895 38.5 35.0 41.0 31.0 41.0 54-55 36.185625 38.0 35.0 40.0 30.0 41.0 56-57 35.836749999999995 37.5 34.5 40.0 29.5 41.0 58-59 35.8895 37.0 35.0 40.0 30.0 41.0 60-61 35.418 36.5 34.5 40.0 29.0 41.0 62-63 35.143625 36.0 34.0 39.5 29.5 41.0 64-65 34.830749999999995 35.5 34.0 39.0 29.0 41.0 66-67 34.572 35.0 34.0 39.0 29.0 40.5 68-69 34.385125 35.0 34.0 38.0 29.0 40.0 70-71 34.062 35.0 33.5 37.0 29.0 39.5 72-73 33.673500000000004 35.0 33.0 37.0 28.5 39.0 74-75 33.376374999999996 35.0 33.0 36.0 27.5 39.0 76-77 31.768375 33.5 30.5 35.0 25.0 36.5 78-79 33.007875 35.0 33.0 35.0 28.0 37.0 80-81 33.065875000000005 35.0 33.0 35.0 29.0 37.0 82-83 32.94925 35.0 33.0 35.0 28.5 36.0 84-85 32.70625 35.0 33.0 35.0 28.5 36.0 86-87 32.399625 35.0 33.0 35.0 27.0 36.0 88-89 32.346875 35.0 33.0 35.0 27.0 35.5 90-91 32.280125 35.0 33.0 35.0 27.0 35.0 92-93 32.122749999999996 35.0 33.0 35.0 27.0 35.0 94-95 31.924875 35.0 33.0 35.0 26.5 35.0 96-97 31.723750000000003 35.0 33.0 35.0 26.5 35.0 98-99 31.3235 35.0 32.0 35.0 25.0 35.0 100 30.0755 34.0 30.0 35.0 19.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 2.0 8 2.0 9 4.0 10 6.0 11 2.0 12 3.0 13 4.0 14 5.0 15 5.0 16 9.0 17 6.0 18 6.0 19 10.0 20 7.0 21 7.0 22 6.0 23 13.0 24 22.0 25 18.0 26 32.0 27 44.0 28 48.0 29 73.0 30 84.0 31 116.0 32 142.0 33 172.0 34 239.0 35 358.0 36 654.0 37 983.0 38 802.0 39 115.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.02802802802803 23.773773773773772 19.244244244244243 28.953953953953953 2 25.724999999999998 24.575 18.625 31.075000000000003 3 24.45 25.8 18.475 31.275 4 25.35 26.0 17.7 30.95 5 28.229061553985872 24.394550958627647 16.649848637739655 30.726538849646822 6 28.675 27.3 19.45 24.575 7 28.825 22.7 22.025 26.450000000000003 8 28.599999999999998 26.375 25.275 19.75 9 29.875 26.674999999999997 26.575 16.875 10-11 30.725 27.6875 21.5625 20.025000000000002 12-13 29.375 26.1 24.2875 20.2375 14-15 26.674999999999997 26.625 24.325 22.375 16-17 27.487499999999997 24.099999999999998 25.0375 23.375 18-19 25.900000000000002 26.5375 24.65 22.912499999999998 20-21 25.0375 26.200000000000003 25.3 23.4625 22-23 25.7625 25.775 25.05 23.4125 24-25 25.2375 26.237500000000004 24.725 23.799999999999997 26-27 25.724999999999998 25.8 25.387500000000003 23.0875 28-29 25.637500000000003 25.75 24.825 23.7875 30-31 25.7625 26.05 25.2125 22.975 32-33 24.637500000000003 26.450000000000003 25.1 23.8125 34-35 25.587500000000002 25.900000000000002 24.25 24.2625 36-37 25.2625 25.8625 24.925 23.95 38-39 25.162499999999998 27.3875 24.75 22.7 40-41 25.5375 25.4625 24.8125 24.1875 42-43 26.400000000000002 25.15 25.5 22.95 44-45 25.137500000000003 27.0125 24.837500000000002 23.0125 46-47 25.2375 26.450000000000003 25.162499999999998 23.150000000000002 48-49 25.912499999999998 26.4625 24.1625 23.4625 50-51 26.0125 25.112499999999997 25.7625 23.1125 52-53 26.0125 26.187500000000004 25.424999999999997 22.375 54-55 25.05 26.2625 25.687500000000004 23.0 56-57 25.8625 25.674999999999997 25.424999999999997 23.0375 58-59 25.662499999999998 26.6125 24.275 23.45 60-61 25.4625 26.674999999999997 24.6125 23.25 62-63 25.75 26.575 24.45 23.225 64-65 25.8125 26.1625 24.7 23.325000000000003 66-67 25.55 25.525 25.224999999999998 23.7 68-69 23.9875 26.8375 25.2125 23.962500000000002 70-71 25.75 26.85 24.05 23.35 72-73 25.575 26.150000000000002 24.975 23.3 74-75 24.762500000000003 26.5625 24.962500000000002 23.7125 76-77 25.7875 26.525 23.9 23.7875 78-79 24.5625 27.6375 24.962500000000002 22.8375 80-81 25.174999999999997 26.4125 25.5 22.912499999999998 82-83 25.912499999999998 26.474999999999998 24.0625 23.549999999999997 84-85 25.124999999999996 26.937499999999996 25.424999999999997 22.5125 86-87 25.2 26.3 24.6875 23.8125 88-89 25.587500000000002 27.125 23.925 23.3625 90-91 24.5 27.3375 24.575 23.5875 92-93 25.8125 26.875 24.5125 22.8 94-95 26.4625 26.3625 24.587500000000002 22.5875 96-97 25.937500000000004 26.8375 24.762500000000003 22.4625 98-99 25.637500000000003 26.650000000000002 24.65 23.0625 100 25.374999999999996 27.3 23.325000000000003 24.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 1.0 4 1.0 5 1.5 6 2.5 7 1.5 8 0.5 9 0.0 10 0.5 11 1.5 12 2.0 13 1.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 2.0 20 4.0 21 3.5 22 2.0 23 2.0 24 2.5 25 3.5 26 6.0 27 5.0 28 7.0 29 10.0 30 10.0 31 14.0 32 20.0 33 22.0 34 29.0 35 33.5 36 42.5 37 64.0 38 76.0 39 89.5 40 105.5 41 134.0 42 162.0 43 173.0 44 180.5 45 192.0 46 199.0 47 207.0 48 200.0 49 172.0 50 171.5 51 148.5 52 121.5 53 128.0 54 115.5 55 96.5 56 91.0 57 82.0 58 76.5 59 76.5 60 65.5 61 59.0 62 60.5 63 62.0 64 56.5 65 51.0 66 49.5 67 46.5 68 40.0 69 41.5 70 39.0 71 27.5 72 23.0 73 22.5 74 19.0 75 13.0 76 9.0 77 4.5 78 4.0 79 4.0 80 2.5 81 1.5 82 1.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.8999999999999999 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.95 #Duplication Level Percentage of deduplicated Percentage of total 1 98.28994384890251 96.275 2 1.4293006636038794 2.8000000000000003 3 0.20418580908626852 0.6 4 0.05104645227156713 0.2 5 0.025523226135783564 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATGCCAGCTCTGACCGAAATCTTTGGGGATGATTCTGTATTACAATTTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.037500000000000006 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1375 0.0 0.0 0.0 0.0 36-37 0.175 0.0 0.0 0.0 0.0 38-39 0.2375 0.0 0.0 0.0 0.0 40-41 0.30000000000000004 0.0 0.0 0.0 0.0 42-43 0.425 0.0 0.0 0.0 0.0 44-45 0.5625 0.0 0.0 0.0 0.0 46-47 0.65 0.0 0.0 0.0 0.0 48-49 0.7875 0.0 0.0 0.0 0.0 50-51 0.875 0.0 0.0 0.0 0.0 52-53 1.025 0.0 0.0 0.0 0.0 54-55 1.175 0.0 0.0 0.0 0.0 56-57 1.275 0.0 0.0 0.0 0.0 58-59 1.425 0.0 0.0 0.0 0.0 60-61 1.6 0.0 0.0 0.0 0.0 62-63 1.85 0.0 0.0 0.0 0.0 64-65 2.125 0.0 0.0 0.0 0.0 66-67 2.475 0.0 0.0 0.0 0.0 68-69 2.8125 0.0 0.0 0.0 0.0 70-71 3.0 0.0 0.0 0.0 0.0 72-73 3.275 0.0 0.0 0.0 0.0 74-75 3.725 0.0 0.0 0.0 0.0 76-77 4.1125 0.0 0.0 0.0 0.0 78-79 4.45 0.0 0.0 0.0 0.0 80-81 4.8 0.0 0.0 0.0 0.0 82-83 5.25 0.0 0.0 0.0 0.0 84-85 5.6125 0.0 0.0 0.0 0.0 86-87 6.125 0.0 0.0 0.0 0.0 88 6.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317419 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317419_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.26725 33.0 31.0 34.0 30.0 34.0 2 31.1715 33.0 31.0 34.0 27.0 34.0 3 30.93075 31.0 31.0 34.0 27.0 34.0 4 34.633 37.0 35.0 37.0 32.0 37.0 5 34.78125 37.0 35.0 37.0 32.0 37.0 6 34.8245 37.0 35.0 37.0 32.0 37.0 7 34.909 37.0 35.0 37.0 32.0 37.0 8 35.00525 37.0 35.0 37.0 32.0 37.0 9 36.53775 39.0 37.0 39.0 32.0 39.0 10-11 36.610749999999996 39.0 37.0 39.0 32.0 39.0 12-13 36.513875 39.0 37.0 39.0 32.0 39.0 14-15 37.675124999999994 40.0 38.0 41.0 32.0 41.0 16-17 37.583625 40.0 37.5 41.0 32.0 41.0 18-19 37.464875 40.0 37.5 41.0 31.5 41.0 20-21 37.527375 40.0 38.0 41.0 32.0 41.0 22-23 37.35225 40.0 37.0 41.0 32.0 41.0 24-25 37.222 40.0 37.0 41.0 31.5 41.0 26-27 37.235 40.0 37.0 41.0 31.0 41.0 28-29 37.080749999999995 40.0 37.0 41.0 30.5 41.0 30-31 36.9125 40.0 36.5 41.0 30.5 41.0 32-33 36.693375 40.0 36.0 41.0 30.0 41.0 34-35 36.6295 40.0 36.0 41.0 30.0 41.0 36-37 36.45325 39.5 36.0 41.0 30.0 41.0 38-39 36.185375 39.0 35.0 41.0 28.5 41.0 40-41 36.207499999999996 39.0 35.0 41.0 29.5 41.0 42-43 36.067125000000004 39.0 35.0 41.0 28.5 41.0 44-45 36.088875 39.0 35.0 41.0 28.0 41.0 46-47 36.02825 39.0 35.0 41.0 28.5 41.0 48-49 35.94725 39.0 35.0 41.0 29.0 41.0 50-51 34.62425 38.0 33.5 40.0 25.5 40.5 52-53 34.825 38.0 33.5 39.5 26.5 40.5 54-55 35.494625 39.0 35.0 40.5 28.0 41.0 56-57 35.289 38.0 35.0 41.0 26.5 41.0 58-59 35.179500000000004 38.0 34.5 41.0 26.5 41.0 60-61 34.958 38.0 34.0 40.0 26.5 41.0 62-63 34.62025 37.0 34.0 40.0 26.0 41.0 64-65 34.074375 37.0 34.0 40.0 24.5 41.0 66-67 33.582625 36.0 34.0 39.0 22.5 41.0 68-69 32.72475 35.5 33.0 39.0 18.5 41.0 70-71 32.45025 35.0 33.0 38.5 19.0 40.0 72-73 32.096125 35.0 32.5 37.5 17.0 39.5 74-75 32.033 35.0 32.0 37.0 19.5 39.0 76-77 32.03375 35.0 32.0 36.5 23.5 39.0 78-79 31.798625 35.0 32.5 36.0 22.0 37.5 80-81 31.40325 35.0 32.0 35.5 20.5 37.0 82-83 30.956 35.0 31.5 35.0 19.0 37.0 84-85 30.857625 35.0 32.0 35.0 19.0 36.0 86-87 30.560875 35.0 31.0 35.0 18.0 36.0 88-89 30.479750000000003 35.0 31.0 35.0 18.0 36.0 90-91 29.958750000000002 34.5 31.0 35.0 9.5 35.0 92-93 29.758625000000002 34.0 31.0 35.0 4.5 35.0 94-95 29.582375 34.0 31.0 35.0 2.0 35.0 96-97 29.333750000000002 34.0 31.0 35.0 2.0 35.0 98-99 28.862375 34.0 30.0 35.0 2.0 35.0 100 27.5105 33.0 27.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 43.0 3 8.0 4 4.0 5 2.0 6 4.0 7 3.0 8 11.0 9 8.0 10 8.0 11 16.0 12 9.0 13 13.0 14 12.0 15 14.0 16 17.0 17 10.0 18 15.0 19 9.0 20 29.0 21 16.0 22 22.0 23 30.0 24 38.0 25 40.0 26 48.0 27 47.0 28 53.0 29 67.0 30 70.0 31 111.0 32 136.0 33 191.0 34 220.0 35 353.0 36 522.0 37 732.0 38 910.0 39 159.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.772727272727273 11.691919191919192 30.328282828282827 28.20707070707071 2 26.156178923426836 10.765731614859742 26.434167298458426 36.64392216325499 3 23.156565656565657 12.196969696969697 29.797979797979796 34.84848484848485 4 23.106060606060606 12.828282828282827 26.691919191919194 37.37373737373738 5 26.35169277412835 14.451743304699344 23.06720565942395 36.12935826174836 6 24.85549132947977 17.642623774817793 29.98240764011058 27.519477255591855 7 18.748429253581303 25.257602412666497 38.703191756722795 17.290776577029405 8 17.27774987443496 25.13812154696133 36.865896534404826 20.718232044198896 9 17.818547373711986 27.46921337019352 36.59210856999246 18.120130686102033 10-11 18.86152299572757 26.991706458909277 33.07363659210857 21.073133953254587 12-13 19.163106308117616 27.142498115104296 32.608695652173914 21.085699924604175 14-15 20.733852726815783 26.41367177682835 31.339532545865794 21.51294295049007 16-17 20.87939698492462 26.38190954773869 29.64824120603015 23.09045226130653 18-19 20.482533299824077 27.519477255591855 29.178185473737116 22.819803970846948 20-21 20.686188261907752 25.474425034560767 29.144149805202968 24.695236898328517 22-23 21.09630374654262 25.86120191098818 29.016846869499624 24.025647472969574 24-25 20.758984669514955 27.155064086453883 28.34883136466449 23.737119879366674 26-27 20.713478206255495 26.943851274965457 27.622158020349204 24.720512498429844 28-29 21.60090474993717 25.82307112339784 26.313144006031663 26.262880120633326 30-31 20.595627041970342 26.16235234983664 28.48705704950993 24.754963558683084 32-33 21.774092222641038 25.6816182937555 27.616534740545294 24.927754743058173 34-35 21.651813731643028 25.26672524162169 27.111836324839967 25.969624701895317 36-37 21.378358021591765 25.985438111975895 28.069294501631937 24.566909364800402 38-39 21.458150332538587 26.45250345087213 27.293261387878026 24.79608482871126 40-41 22.096814647604717 25.20692249811889 27.702533233007276 24.993729621269125 42-43 22.468671679197996 25.526315789473685 27.11779448621554 24.887218045112782 44-45 22.096245905769717 27.03451751070799 26.06449987402368 24.804736709498616 46-47 21.630448436126116 25.273206883557343 27.370933299836704 25.72541138047984 48-49 22.25009406747774 26.36397842719177 27.27956854383545 24.106358961495044 50-51 21.407035175879397 26.494974874371856 27.047738693467338 25.05025125628141 52-53 22.64388037195275 25.634581553154057 26.388539834129176 25.33299824076401 54-55 21.46267906509173 25.936164865544107 28.02211610957527 24.579039959788894 56-57 21.909547738693465 26.017587939698494 27.8643216080402 24.20854271356784 58-59 22.24453929199096 24.830529751443635 27.54205372834547 25.382877228219936 60-61 21.783295711060948 26.699272636067217 27.80285929270128 23.714572360170553 62-63 22.44104365278475 27.00702458605118 25.32614149523332 25.22579026593076 64-65 23.170422891871358 24.90503925044315 25.72803241326918 26.196505444416307 66-67 21.940659620527185 26.02826945116516 28.078441359989814 23.95262956831784 68-69 22.343991748323877 26.19907168643631 26.41825683341929 25.038679731820523 70-71 22.411128284389488 26.120556414219475 26.069036579082947 25.39927872230809 72-73 22.45654396728016 24.821063394683026 26.738241308793455 25.984151329243353 74-75 23.041243575278926 25.974677196941204 26.062429484768714 24.921649743011155 76-77 23.184952978056426 25.467084639498434 25.981191222570533 25.366771159874606 78-79 22.49247743229689 26.278836509528585 26.06569709127382 25.162988966900702 80-81 23.542685220007524 26.288078224896577 26.250470101541936 23.918766453553967 82-83 22.467956773058557 25.647147524503644 25.5968836391053 26.288012063332495 84-85 23.106820461384153 25.877632898696092 27.08124373119358 23.93430290872618 86-87 24.445280180518992 26.125109690359782 25.047010154193305 24.382599974927917 88-89 23.8375736307808 24.66474495550821 25.642311066549695 25.855370347161298 90-91 23.853096014038606 25.745800952619703 26.146903985961394 24.254199047380297 92-93 23.76535472549511 26.197041865129105 26.372524442216093 23.66507896715969 94-95 24.213560596565987 25.491916280235614 25.980699335756363 24.313823787442036 96-97 25.375939849624064 25.438596491228072 25.68922305764411 23.49624060150376 98-99 23.884152457372114 25.952858575727184 25.33851554663992 24.82447342026078 100 22.868605817452355 25.827482447342025 25.576730190571716 25.727181544633904 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 29.0 1 18.5 2 5.5 3 2.0 4 1.5 5 3.0 6 4.0 7 3.5 8 2.0 9 1.5 10 1.5 11 2.0 12 3.0 13 3.5 14 2.0 15 0.5 16 1.5 17 1.5 18 2.5 19 5.0 20 3.5 21 2.0 22 5.0 23 5.0 24 4.5 25 6.5 26 5.0 27 6.0 28 10.0 29 12.5 30 17.0 31 20.5 32 24.5 33 33.5 34 34.5 35 41.5 36 65.5 37 89.5 38 105.0 39 117.5 40 139.0 41 174.0 42 200.0 43 206.5 44 208.5 45 207.0 46 198.0 47 182.5 48 176.0 49 160.0 50 147.5 51 138.0 52 122.0 53 114.0 54 101.5 55 80.5 56 65.0 57 62.5 58 58.5 59 54.5 60 51.5 61 52.5 62 46.5 63 38.0 64 35.0 65 32.0 66 33.5 67 31.0 68 31.0 69 31.5 70 23.5 71 22.0 72 19.5 73 14.5 74 13.0 75 10.0 76 5.5 77 3.5 78 6.0 79 5.5 80 3.5 81 4.0 82 3.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0 2 1.075 3 1.0 4 1.0 5 1.05 6 0.525 7 0.525 8 0.44999999999999996 9 0.525 10-11 0.525 12-13 0.525 14-15 0.525 16-17 0.5 18-19 0.525 20-21 0.5375 22-23 0.575 24-25 0.525 26-27 0.4875 28-29 0.525 30-31 0.525 32-33 0.5125000000000001 34-35 0.41250000000000003 36-37 0.42500000000000004 38-39 0.3875 40-41 0.325 42-43 0.25 44-45 0.775 46-47 0.4875 48-49 0.3375 50-51 0.5 52-53 0.525 54-55 0.525 56-57 0.5 58-59 0.42500000000000004 60-61 0.325 62-63 0.35000000000000003 64-65 1.275 66-67 1.8375 68-69 3.05 70-71 2.9499999999999997 72-73 2.1999999999999997 74-75 0.2875 76-77 0.3125 78-79 0.3 80-81 0.2875 82-83 0.525 84-85 0.3 86-87 0.2875 88-89 0.2625 90-91 0.27499999999999997 92-93 0.27499999999999997 94-95 0.2625 96-97 0.25 98-99 0.3 100 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.02763561924259 96.75 2 0.6908904810644831 1.35 3 0.1023541453428864 0.3 4 0.07676560900716478 0.3 5 0.0255885363357216 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0255885363357216 0.2 9 0.0255885363357216 0.22499999999999998 >10 0.0255885363357216 0.75 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 30 0.75 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 8 0.2 No Hit TCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.037500000000000006 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1375 0.0 0.0 0.0 0.0 36-37 0.175 0.0 0.0 0.0 0.0 38-39 0.2375 0.0 0.0 0.0 0.0 40-41 0.30000000000000004 0.0 0.0 0.0 0.0 42-43 0.4125 0.0 0.0 0.0 0.0 44-45 0.5375 0.0 0.0 0.0 0.0 46-47 0.625 0.0 0.0 0.0 0.0 48-49 0.7625 0.0 0.0 0.0 0.0 50-51 0.85 0.0 0.0 0.0 0.0 52-53 0.9874999999999999 0.0 0.0 0.0 0.0 54-55 1.1124999999999998 0.0 0.0 0.0 0.0 56-57 1.2000000000000002 0.0 0.0 0.0 0.0 58-59 1.35 0.0 0.0 0.0 0.0 60-61 1.525 0.0 0.0 0.0 0.0 62-63 1.725 0.0 0.0 0.0 0.0 64-65 1.975 0.0 0.0 0.0 0.0 66-67 2.3 0.0 0.0 0.0 0.0 68-69 2.625 0.0 0.0 0.0 0.0 70-71 2.8 0.0 0.0 0.0 0.0 72-73 3.0625 0.0 0.0 0.0 0.0 74-75 3.5 0.0 0.0 0.0 0.0 76-77 3.8375000000000004 0.0 0.0 0.0 0.0 78-79 4.2 0.0 0.0 0.0 0.0 80-81 4.525 0.0 0.0 0.0 0.0 82-83 4.925 0.0 0.0 0.0 0.0 84-85 5.25 0.0 0.0 0.0 0.0 86-87 5.725 0.0 0.0 0.0 0.0 88 6.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1757749 spots for ERR3317419.sra Written 1757749 spots for ERR3317419.sra Read 1757749 spots for ERR3317419.sra Written 1757749 spots for ERR3317419.sra Read 1757749 spots for ERR3317419.sra Written 1757749 spots for ERR3317419.sra Read 1757749 spots for ERR3317419.sra Written 1757749 spots for ERR3317419.sra Read 1757749 spots for ERR3317419.sra Written 1757749 spots for ERR3317419.sra Read 1757749 spots for ERR3317419.sra Written 1757749 spots for ERR3317419.sra Read 1757749 spots for ERR3317419.sra Written 1757749 spots for ERR3317419.sra Read 1757749 spots for ERR3317419.sra Written 1757749 spots for ERR3317419.sra Read 1757749 spots for ERR3317419.sra Written 1757749 spots for ERR3317419.sra Read 1757749 spots for ERR3317419.sra Written 1757749 spots for ERR3317419.sra Read 1757749 spots for ERR3317419.sra Written 1757749 spots for ERR3317419.sra Read 1757749 spots for ERR3317419.sra Written 1757749 spots for ERR3317419.sra Read 1757749 spots for ERR3317419.sra Written 1757749 spots for ERR3317419.sra Read 1757749 spots for ERR3317419.sra Written 1757749 spots for ERR3317419.sra Read 1757749 spots for ERR3317419.sra Written 1757749 spots for ERR3317419.sra Read 1757749 spots for ERR3317419.sra Written 1757749 spots for ERR3317419.sra Read 1757749 spots for ERR3317419.sra Written 1757749 spots for ERR3317419.sra Read 1757749 spots for ERR3317419.sra Written 1757749 spots for ERR3317419.sra Read 1757749 spots for ERR3317419.sra Written 1757749 spots for ERR3317419.sra Read 1757767 spots for ERR3317419.sra Written 1757767 spots for ERR3317419.sra SRR ids: ['ERR3317419.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m8zovk2d ERR3317419.sra spots: 35154998 blocks: [[1, 1757749], [1757750, 3515498], [3515499, 5273247], [5273248, 7030996], [7030997, 8788745], [8788746, 10546494], [10546495, 12304243], [12304244, 14061992], [14061993, 15819741], [15819742, 17577490], [17577491, 19335239], [19335240, 21092988], [21092989, 22850737], [22850738, 24608486], [24608487, 26366235], [26366236, 28123984], [28123985, 29881733], [29881734, 31639482], [31639483, 33397231], [33397232, 35154998]] ERR3317419 file size 9172550 ERR3317419 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317419 ERR3317419_1.fastq ERR3317419_2.fastq Input file: ERR3317419_1.fastq Paired file: ERR3317419_2.fastq trimmed: ERR3317419-trimmed-pair1.fastq, ERR3317419-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 08:43:09 2024 >> started Tue Dec 10 08:43:45 2024 >> done (35.626s) 35154998 read pairs processed; of these: 268561 ( 0.76%) short read pairs filtered out after trimming by size control 398143 ( 1.13%) empty read pairs filtered out after trimming by size control 34488294 (98.10%) read pairs available; of these: 11071429 (32.10%) trimmed read pairs available after processing 23416865 (67.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 493 0.00% 19 563 0.00% 20 878 0.00% 21 1184 0.00% 22 1437 0.00% 23 2108 0.01% 24 2580 0.01% 25 3138 0.01% 26 3654 0.01% 27 4427 0.01% 28 4747 0.01% 29 6010 0.02% 30 6528 0.02% 31 8352 0.02% 32 8597 0.02% 33 9077 0.03% 34 10630 0.03% 35 11265 0.03% 36 12290 0.04% 37 13225 0.04% 38 15366 0.04% 39 17235 0.05% 40 17138 0.05% 41 18545 0.05% 42 19450 0.06% 43 20844 0.06% 44 22598 0.07% 45 23568 0.07% 46 25261 0.07% 47 28538 0.08% 48 29680 0.09% 49 30763 0.09% 50 34011 0.10% 51 34104 0.10% 52 36099 0.10% 53 39169 0.11% 54 42190 0.12% 55 44867 0.13% 56 47676 0.14% 57 52049 0.15% 58 57643 0.17% 59 80553 0.23% 60 87023 0.25% 61 92957 0.27% 62 96139 0.28% 63 99815 0.29% 64 106719 0.31% 65 112713 0.33% 66 123660 0.36% 67 124028 0.36% 68 125422 0.36% 69 129027 0.37% 70 132378 0.38% 71 138431 0.40% 72 141880 0.41% 73 150872 0.44% 74 155391 0.45% 75 147373 0.43% 76 146740 0.43% 77 155090 0.45% 78 163994 0.48% 79 172886 0.50% 80 178943 0.52% 81 185600 0.54% 82 191850 0.56% 83 201614 0.58% 84 210489 0.61% 85 224675 0.65% 86 233541 0.68% 87 238535 0.69% 88 236998 0.69% 89 263484 0.76% 90 268891 0.78% 91 291075 0.84% 92 321465 0.93% 93 355616 1.03% 94 409463 1.19% 95 484517 1.40% 96 571735 1.66% 97 715774 2.08% 98 904974 2.62% 99 1131122 3.28% 100 23416865 67.90% 34488294 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.62 fanout-score-rank=17 prefix-density=0.59 prefix-fanout=3.1 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.12 sequence-density-rank=20 fanout-score=76.33 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=11.3 sequence=GCCGCCGCCGCCA criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.02 fanout-score-rank=23 prefix-density=0.21 prefix-fanout=2.6 sequence=TTACAACACAAAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=23 fanout-score=143.78 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=13.6 sequence=CCTTCTTCTCCGGGTCC ERR3317419 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 08:44:33 Started mapping on | Dec 10 08:44:33 Finished on | Dec 10 08:46:33 Mapping speed, Million of reads per hour | 1034.65 Number of input reads | 34488294 Average input read length | 189 UNIQUE READS: Uniquely mapped reads number | 31228294 Uniquely mapped reads % | 90.55% Average mapped length | 188.70 Number of splices: Total | 18761068 Number of splices: Annotated (sjdb) | 17857383 Number of splices: GT/AG | 18482472 Number of splices: GC/AG | 249099 Number of splices: AT/AC | 15295 Number of splices: Non-canonical | 14202 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.00% Deletion average length | 1.22 Insertion rate per base | 0.00% Insertion average length | 1.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2061158 % of reads mapped to multiple loci | 5.98% Number of reads mapped to too many loci | 73903 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.20% % of reads unmapped: other | 1.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1467564 1467564 1467564 N_multimapping 2061158 2061158 2061158 N_noFeature 1105604 2600083 29083491 N_ambiguous 977566 377159 16695 UnstrandedReadsAssigned:29145124 PositiveStrandReadsAssigned:28251052 NegativeStrandReadsAssigned:2128108 Dataset is classified positive stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 ERR3317419 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317419-trimmed-pair1.fastq ERR3317419-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,488,294 reads, 29,853,841 reads pseudoaligned [quant] estimated average fragment length: 195.625 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,058 rounds 52973 ERR3317419.ke.tsv 35125 ERR3317419.se.tsv 88098 total ==> ERR3317419.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 741.634 0 0 PNS24247 1044 849.375 32.9172 1.94455 PNS24249 1928 1733.37 104.422 3.0227 PNS24246 1044 849.375 32.9172 1.94455 PNS24248 1044 849.375 32.9172 1.94455 PNS24244 1471 1276.37 225.826 8.8775 PNS24243 293 129.186 2 0.776803 KQK14069 1603 1408.37 4559.23 162.431 KQK14071 474 287.28 32.9147 5.74883 ==> ERR3317419.se.tsv <== BRADI_1g14170v3 5712 BRADI_1g53295v3 421 BRADI_1g59795v3 738 BRADI_1g07683v3 0 BRADI_1g00485v3 80 BRADI_1g20270v3 2480 BRADI_1g74790v3 157 BRADI_1g09890v3 13 BRADI_1g77505v3 448 BRADI_1g48960v3 0 ERR3317419 completed mapping pipeline successfully