Starting /dee2/code/volunteer_pipeline.sh ERR3317420 current disk space = 1525519192064 free memory = 1435430480 ERR3317420 SRAfilesize 7908824a08997c349a8d465feed9230b ERR3317420.sra ERR3317420.sra file validated ERR3317420 is paired end ERR3317420 is conventional basespace ERR3317420 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317420_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.05275 33.0 31.0 34.0 30.0 34.0 2 32.3925 34.0 31.0 34.0 30.0 34.0 3 32.526 34.0 31.0 34.0 31.0 34.0 4 36.123 37.0 35.0 37.0 35.0 37.0 5 35.536 37.0 35.0 37.0 35.0 37.0 6 35.695 37.0 35.0 37.0 35.0 37.0 7 35.77575 37.0 35.0 37.0 33.0 37.0 8 35.778 37.0 35.0 37.0 33.0 37.0 9 37.4115 39.0 37.0 39.0 34.0 39.0 10-11 37.468 39.0 37.0 39.0 34.5 39.0 12-13 37.401624999999996 39.0 37.0 39.0 34.0 39.0 14-15 38.692875 40.0 38.0 41.0 34.5 41.0 16-17 38.6345 40.0 38.0 41.0 34.0 41.0 18-19 38.632 40.0 38.0 41.0 34.0 41.0 20-21 38.647999999999996 40.0 38.0 41.0 34.0 41.0 22-23 38.57325 40.0 38.0 41.0 34.0 41.0 24-25 38.504374999999996 40.0 38.0 41.0 34.0 41.0 26-27 38.330749999999995 40.0 38.0 41.0 34.0 41.0 28-29 38.137625 40.0 37.5 41.0 33.0 41.0 30-31 38.007374999999996 40.0 37.0 41.0 33.0 41.0 32-33 38.017250000000004 40.0 37.0 41.0 33.0 41.0 34-35 37.678625 40.0 37.0 41.0 32.5 41.0 36-37 37.56275 40.0 36.5 41.0 32.5 41.0 38-39 37.48475 39.5 36.5 41.0 32.0 41.0 40-41 37.32875 39.5 36.0 41.0 31.5 41.0 42-43 37.300625 39.0 36.0 41.0 32.0 41.0 44-45 36.947 39.0 35.0 41.0 31.0 41.0 46-47 36.991 39.0 35.0 41.0 31.0 41.0 48-49 37.16125 39.0 35.0 41.0 31.5 41.0 50-51 36.857375000000005 39.0 35.0 41.0 31.0 41.0 52-53 36.696875 39.0 35.0 41.0 31.0 41.0 54-55 36.314125000000004 38.0 35.0 40.5 30.0 41.0 56-57 35.968125 38.0 35.0 40.0 30.0 41.0 58-59 35.957 37.0 35.0 40.0 30.5 41.0 60-61 35.559749999999994 37.0 34.5 40.0 29.5 41.0 62-63 35.295625 36.0 34.0 39.5 29.5 41.0 64-65 34.87525 35.5 34.0 39.0 29.0 41.0 66-67 34.626875 35.0 34.0 39.0 29.0 40.5 68-69 34.394125 35.0 33.5 38.5 29.0 40.0 70-71 33.977000000000004 35.0 33.0 37.0 28.5 39.5 72-73 33.62775 35.0 33.0 37.0 28.0 39.0 74-75 33.33525 35.0 33.0 36.0 27.5 39.0 76-77 31.67375 33.5 30.5 35.0 25.0 37.0 78-79 32.875375000000005 35.0 33.0 35.0 28.0 37.0 80-81 32.89149999999999 35.0 33.0 35.0 28.5 37.0 82-83 32.73725 35.0 33.0 35.0 28.0 36.0 84-85 32.49325 35.0 33.0 35.0 27.0 36.0 86-87 32.450500000000005 35.0 33.0 35.0 28.0 36.0 88-89 32.306125 35.0 33.0 35.0 27.0 35.5 90-91 32.167500000000004 35.0 33.0 35.0 27.0 35.0 92-93 32.007625000000004 35.0 33.0 35.0 26.5 35.0 94-95 31.7775 35.0 32.5 35.0 26.0 35.0 96-97 31.7205 35.0 32.5 35.0 27.0 35.0 98-99 31.278375 35.0 32.0 35.0 24.5 35.0 100 30.1515 34.0 30.0 35.0 20.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 2.0 9 3.0 10 4.0 11 4.0 12 3.0 13 5.0 14 10.0 15 3.0 16 5.0 17 9.0 18 7.0 19 11.0 20 8.0 21 11.0 22 4.0 23 16.0 24 15.0 25 24.0 26 30.0 27 33.0 28 38.0 29 78.0 30 84.0 31 123.0 32 145.0 33 180.0 34 260.0 35 372.0 36 616.0 37 977.0 38 816.0 39 102.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 26.389584376564844 25.338007010515774 18.352528793189784 29.919879819729594 2 25.374999999999996 24.075 18.3 32.25 3 24.7 26.55 18.4 30.349999999999998 4 26.075 27.0 16.6 30.325000000000003 5 29.161388396250317 24.82898403851026 15.530782873068153 30.47884469217127 6 29.375 26.400000000000002 18.3 25.924999999999997 7 30.06503251625813 24.062031015507753 21.585792896448226 24.287143571785894 8 31.1 25.6 24.4 18.9 9 32.05 26.674999999999997 23.825 17.45 10-11 32.550000000000004 26.650000000000002 21.462500000000002 19.3375 12-13 29.9625 26.4625 24.15 19.425 14-15 28.0625 25.7125 24.925 21.3 16-17 26.5875 25.637500000000003 25.5625 22.2125 18-19 25.7375 26.5375 25.374999999999996 22.35 20-21 25.387500000000003 26.2125 26.1625 22.237499999999997 22-23 25.137500000000003 25.937500000000004 25.75 23.175 24-25 24.85 25.7875 26.400000000000002 22.9625 26-27 25.174999999999997 25.775 25.5 23.549999999999997 28-29 25.8 25.912499999999998 24.6625 23.625 30-31 25.85 26.2875 24.9 22.9625 32-33 25.0375 26.3125 25.6125 23.0375 34-35 25.9875 25.662499999999998 24.212500000000002 24.1375 36-37 24.962500000000002 27.0625 25.7625 22.2125 38-39 26.224999999999998 25.887500000000003 25.2625 22.625 40-41 25.724999999999998 25.637500000000003 24.9375 23.7 42-43 25.887500000000003 25.937500000000004 25.324999999999996 22.85 44-45 25.2125 26.224999999999998 25.3125 23.25 46-47 26.150000000000002 25.587500000000002 24.125 24.1375 48-49 25.55 26.200000000000003 25.687500000000004 22.5625 50-51 24.212500000000002 26.700000000000003 26.3125 22.775000000000002 52-53 26.1125 26.125 24.8 22.9625 54-55 25.275 26.5125 25.2875 22.925 56-57 25.724999999999998 26.2125 24.625 23.4375 58-59 25.974999999999998 25.825 25.25 22.95 60-61 24.6 27.05 25.137500000000003 23.2125 62-63 25.5625 25.9625 25.412499999999998 23.0625 64-65 25.912499999999998 26.525 25.0625 22.5 66-67 25.5 25.5375 25.624999999999996 23.3375 68-69 25.5 26.687499999999996 24.712500000000002 23.1 70-71 25.6 26.75 24.575 23.075000000000003 72-73 25.974999999999998 25.912499999999998 25.124999999999996 22.9875 74-75 25.5625 26.387500000000003 25.25 22.8 76-77 26.2625 26.0625 24.712500000000002 22.9625 78-79 25.837500000000002 27.3875 24.9 21.875 80-81 24.45 27.175 25.662499999999998 22.7125 82-83 26.237500000000004 27.150000000000002 23.6875 22.925 84-85 25.637500000000003 27.700000000000003 24.375 22.287499999999998 86-87 25.4625 27.5875 25.2 21.75 88-89 26.325 26.787499999999998 23.6625 23.225 90-91 25.587500000000002 27.0625 24.5375 22.8125 92-93 25.624999999999996 27.187499999999996 24.4125 22.775000000000002 94-95 26.4125 26.5375 24.05 23.0 96-97 24.887500000000003 28.3125 23.7 23.1 98-99 25.25 27.537499999999998 24.099999999999998 23.1125 100 24.95 27.450000000000003 24.275 23.325000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 1.0 7 1.5 8 1.0 9 2.0 10 2.5 11 0.5 12 1.0 13 1.5 14 2.5 15 3.0 16 2.0 17 2.0 18 1.5 19 0.5 20 2.0 21 3.0 22 2.0 23 1.0 24 1.0 25 4.0 26 6.5 27 5.5 28 6.5 29 9.5 30 8.5 31 8.5 32 14.0 33 16.5 34 17.0 35 28.5 36 45.5 37 61.5 38 82.0 39 114.5 40 134.0 41 140.0 42 156.5 43 189.5 44 194.0 45 196.5 46 202.5 47 189.0 48 193.5 49 186.5 50 158.5 51 146.5 52 138.5 53 120.0 54 104.0 55 94.0 56 90.5 57 80.0 58 64.0 59 64.0 60 70.0 61 65.0 62 61.0 63 58.0 64 54.5 65 44.5 66 41.5 67 49.0 68 47.0 69 39.0 70 35.0 71 26.5 72 23.0 73 23.0 74 19.0 75 13.0 76 7.0 77 2.5 78 3.0 79 4.5 80 2.0 81 2.0 82 1.5 83 0.5 84 0.5 85 1.5 86 2.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 1.325 6 0.0 7 0.05 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.75666074600356 97.3 2 1.0403450900786604 2.0500000000000003 3 0.1522456229383405 0.44999999999999996 4 0.050748540979446845 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.0625 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.15 0.0 0.0 0.0 0.0 44-45 0.1875 0.0 0.0 0.0 0.0 46-47 0.225 0.0 0.0 0.0 0.0 48-49 0.275 0.0 0.0 0.0 0.0 50-51 0.3375 0.0 0.0 0.0 0.0 52-53 0.475 0.0 0.0 0.0 0.0 54-55 0.55 0.0 0.0 0.0 0.0 56-57 0.7250000000000001 0.0 0.0 0.0 0.0 58-59 0.8999999999999999 0.0 0.0 0.0 0.0 60-61 1.1 0.0 0.0 0.0 0.0 62-63 1.2875 0.0 0.0 0.0 0.0 64-65 1.5375 0.0 0.0 0.0 0.0 66-67 1.8375 0.0 0.0 0.0 0.0 68-69 2.2 0.0 0.0 0.0 0.0 70-71 2.4625000000000004 0.0 0.0 0.0 0.0 72-73 2.7249999999999996 0.0 0.0 0.0 0.0 74-75 2.9375 0.0 0.0 0.0 0.0 76-77 3.4124999999999996 0.0 0.0 0.0 0.0 78-79 3.8 0.0 0.0 0.0 0.0 80-81 4.275 0.0 0.0 0.0 0.0 82-83 4.8 0.0 0.0 0.0 0.0 84-85 5.275 0.0 0.0 0.0 0.0 86-87 5.949999999999999 0.0 0.0 0.0 0.0 88 6.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAGAG 35 0.008357955 26.839287 80-81 >>END_MODULE ERR3317420 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317420_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.2515 33.0 31.0 34.0 30.0 34.0 2 31.0575 33.0 31.0 34.0 27.0 34.0 3 30.90525 31.0 31.0 34.0 27.0 34.0 4 34.703 37.0 35.0 37.0 32.0 37.0 5 34.8595 37.0 35.0 37.0 32.0 37.0 6 34.82225 37.0 35.0 37.0 32.0 37.0 7 34.88925 37.0 35.0 37.0 32.0 37.0 8 34.90975 37.0 35.0 37.0 32.0 37.0 9 36.40925 39.0 37.0 39.0 32.0 39.0 10-11 36.525 39.0 37.0 39.0 32.5 39.0 12-13 36.429125 39.0 37.0 39.0 32.0 39.0 14-15 37.569 40.0 38.0 41.0 32.0 41.0 16-17 37.447375 40.0 37.5 41.0 32.0 41.0 18-19 37.382625000000004 40.0 37.5 41.0 31.5 41.0 20-21 37.36475 40.0 37.5 41.0 32.0 41.0 22-23 37.296 40.0 37.0 41.0 32.0 41.0 24-25 37.076375 40.0 36.5 41.0 31.5 41.0 26-27 37.09575 40.0 37.0 41.0 31.5 41.0 28-29 36.854124999999996 40.0 36.5 41.0 30.5 41.0 30-31 36.67175 40.0 36.0 41.0 30.0 41.0 32-33 36.480625 39.5 36.0 41.0 30.0 41.0 34-35 36.441375 39.5 36.0 41.0 30.0 41.0 36-37 36.331625 39.0 35.5 41.0 30.0 41.0 38-39 36.14975 39.0 35.0 41.0 29.0 41.0 40-41 36.21125 39.0 35.0 41.0 29.5 41.0 42-43 36.062375 39.0 35.0 41.0 29.5 41.0 44-45 35.964625 39.0 35.0 41.0 28.5 41.0 46-47 35.716375 39.0 35.0 41.0 27.0 41.0 48-49 35.726375 39.0 35.0 41.0 27.0 41.0 50-51 34.461875 38.0 33.5 40.0 25.5 40.5 52-53 34.613 38.0 33.5 39.5 26.0 40.5 54-55 35.30625 39.0 35.0 40.5 27.5 41.0 56-57 35.09825 38.0 35.0 41.0 26.0 41.0 58-59 34.932874999999996 38.0 34.5 41.0 26.0 41.0 60-61 34.759875 37.5 34.5 40.0 26.5 41.0 62-63 34.25425 37.0 34.0 40.0 25.5 41.0 64-65 33.6745 36.5 34.0 40.0 22.5 41.0 66-67 33.1405 36.0 33.5 39.0 21.0 41.0 68-69 32.39675 35.0 33.0 39.0 12.0 41.0 70-71 32.09875 35.0 33.0 38.5 10.5 40.5 72-73 31.714125 35.0 32.0 37.0 6.5 39.5 74-75 31.756999999999998 35.0 32.0 37.0 15.5 39.0 76-77 31.665875 35.0 32.0 36.5 20.0 39.0 78-79 31.468874999999997 35.0 32.0 36.0 20.5 37.5 80-81 31.18675 35.0 31.5 35.5 20.0 37.0 82-83 30.647750000000002 35.0 31.0 35.0 15.5 37.0 84-85 30.611875 35.0 31.0 35.0 17.5 36.0 86-87 30.286875000000002 35.0 31.0 35.0 13.0 36.0 88-89 30.11675 34.5 31.0 35.0 7.0 35.5 90-91 29.677374999999998 34.0 30.5 35.0 2.0 35.0 92-93 29.529625000000003 34.0 30.5 35.0 2.0 35.0 94-95 29.23375 34.0 30.0 35.0 2.0 35.0 96-97 28.883625000000002 34.0 30.0 35.0 2.0 35.0 98-99 28.500375 34.0 29.5 35.0 2.0 35.0 100 27.3015 33.0 27.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 54.0 3 9.0 4 7.0 5 2.0 6 6.0 7 8.0 8 5.0 9 15.0 10 9.0 11 11.0 12 19.0 13 11.0 14 12.0 15 14.0 16 11.0 17 10.0 18 16.0 19 18.0 20 19.0 21 14.0 22 32.0 23 36.0 24 35.0 25 25.0 26 34.0 27 50.0 28 56.0 29 69.0 30 76.0 31 117.0 32 148.0 33 168.0 34 243.0 35 350.0 36 512.0 37 802.0 38 820.0 39 157.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.871439374842453 10.688177464078649 30.72851020922612 28.711872951852786 2 26.059535822401614 11.60443995963673 26.538849646821394 35.79717457114026 3 23.588709677419356 11.340725806451612 30.090725806451612 34.979838709677416 4 23.92235946559113 11.520040332745147 27.880010083186285 36.67759011847744 5 25.10713385429796 14.015628938744642 25.964204688681626 34.91303251827578 6 25.723634533098416 19.078781776994713 28.618172665492068 26.5794110244148 7 19.582179713063177 24.31412031210672 38.937830354895546 17.16586961993456 8 17.861635220125784 24.251572327044023 36.80503144654088 21.081761006289305 9 18.97810218978102 27.81273596778253 34.33173923986912 18.87742260256733 10-11 19.393405487037505 27.284168134910647 32.31814749559527 21.004278882456582 12-13 19.859048577900833 26.843694940850742 31.814749559526806 21.48250692172162 14-15 20.601560533601813 25.24540649383338 30.78278379058646 23.37024918197835 16-17 20.145967031584245 25.305146596199823 30.43915943123191 24.109726940984018 18-19 20.035237855524795 26.554241127611377 30.44299018374025 22.967530833123583 20-21 20.843297671491502 25.235997482693517 30.25802391441158 23.662680931403397 22-23 21.790030211480364 24.10624370594159 29.506545820745217 24.59718026183283 24-25 20.40276903713027 25.97860289490245 29.1881686595343 24.430459408432977 26-27 20.78510317060896 25.880724710619024 28.77453447408153 24.559637644690486 28-29 20.69225928256765 26.079295154185022 28.042794210195094 25.185651353052236 30-31 20.981749528005032 26.14222781623663 29.200755191944623 23.67526746381372 32-33 21.643387441801938 25.44356360890902 28.601988171637093 24.311060777651942 34-35 21.345911949685533 24.742138364779876 28.188679245283023 25.72327044025157 36-37 21.0188679245283 25.559748427672957 28.440251572327046 24.9811320754717 38-39 21.101609657947687 25.490442655935613 27.804325955734406 25.603621730382294 40-41 21.945701357466064 24.59778783308195 28.12971342383107 25.326797385620914 42-43 20.6074297188755 26.229919678714857 28.614457831325304 24.548192771084338 44-45 21.97218710493047 26.548672566371685 26.67509481668774 24.804045512010113 46-47 22.66363980325388 25.98057762643461 26.913860512044398 24.44192205826712 48-49 21.287564441091412 26.706903055450777 27.08411920030177 24.921413303156044 50-51 22.49339539564725 24.88363316140395 27.399672914832053 25.223298528116743 52-53 21.356657437704506 25.98791844953436 26.378051849987415 26.277372262773724 54-55 20.64191315292637 26.884833228445565 28.986784140969164 23.486469477658904 56-57 22.650056625141563 24.927645652447463 27.35623505725431 25.066062665156664 58-59 21.974842767295595 24.955974842767294 27.119496855345908 25.949685534591193 60-61 21.681749622926095 25.163398692810457 28.418803418803417 24.73604826546003 62-63 21.910747957259584 25.681961030798238 26.700188560653675 25.7071024512885 64-65 22.342733188720175 25.20096975883629 27.497767002679595 24.95853004976394 66-67 22.17235188509874 25.737368556040007 28.032828930494997 24.057450628366247 68-69 22.48474620277814 25.10710112943009 27.32701544852655 25.08113721926522 70-71 22.220784262973986 25.766791769121262 26.50446486346577 25.50795910443898 72-73 21.701634702020854 26.515639078388464 26.850302484232202 24.932423735358476 74-75 23.137796759201105 26.303228237658587 26.41627936188921 24.1426956412511 76-77 23.30316742081448 25.36450477626948 25.85470085470086 25.477626948215182 78-79 22.477698203291872 26.10880763915065 26.86267118984797 24.55082296770951 80-81 22.685592262278607 26.06456475317171 26.99409621906796 24.255746765481724 82-83 22.711778815806085 25.287211210705717 25.931069309430626 26.06994066405757 84-85 23.875345564212115 25.622015581804476 26.639859261120886 23.86277959286253 86-87 24.35929648241206 25.590452261306535 25.22613065326633 24.824120603015075 88-89 23.51833249623305 25.35158211953792 25.728277247614262 25.40180813661477 90-91 23.49616978525681 26.08313449704885 26.35941228180334 24.061283435890996 92-93 24.284279256654948 25.16323455549975 26.017076845806127 24.535409342039177 94-95 23.188951663527934 25.98870056497175 26.390458254865035 24.43188951663528 96-97 25.282308657465496 25.219573400250937 26.12296110414053 23.375156838143035 98-99 24.817793415431012 24.491078160341793 26.212616235234982 24.47851218899221 100 23.146519225936167 24.47851218899221 27.142498115104296 25.23247046996733 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 34.0 1 24.5 2 12.0 3 6.0 4 5.0 5 6.5 6 5.0 7 3.5 8 2.5 9 1.5 10 2.0 11 2.5 12 3.0 13 3.0 14 2.5 15 2.5 16 1.5 17 3.0 18 4.5 19 4.0 20 2.5 21 2.5 22 4.5 23 7.5 24 5.5 25 3.5 26 7.0 27 8.0 28 8.0 29 11.5 30 14.0 31 14.0 32 17.0 33 22.5 34 34.0 35 48.5 36 60.0 37 77.0 38 90.0 39 120.5 40 162.0 41 170.5 42 181.0 43 193.0 44 203.5 45 198.5 46 186.0 47 186.5 48 187.5 49 170.0 50 141.0 51 135.0 52 134.5 53 123.0 54 98.0 55 87.0 56 73.5 57 64.0 58 70.5 59 66.5 60 53.0 61 47.5 62 50.0 63 45.0 64 38.5 65 32.5 66 33.5 67 36.5 68 29.0 69 20.5 70 16.5 71 15.0 72 15.0 73 13.0 74 15.0 75 11.5 76 6.0 77 6.0 78 4.0 79 2.0 80 1.0 81 2.0 82 2.5 83 1.0 84 0.0 85 1.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8250000000000001 2 0.8999999999999999 3 0.8 4 0.8250000000000001 5 0.8250000000000001 6 0.675 7 0.675 8 0.625 9 0.675 10-11 0.675 12-13 0.675 14-15 0.675 16-17 0.6625 18-19 0.675 20-21 0.6875 22-23 0.7000000000000001 24-25 0.6875 26-27 0.65 28-29 0.6875 30-31 0.6875 32-33 0.6625 34-35 0.625 36-37 0.625 38-39 0.6 40-41 0.5499999999999999 42-43 0.4 44-45 1.125 46-47 0.8875 48-49 0.5875 50-51 0.6375 52-53 0.675 54-55 0.6875 56-57 0.6625 58-59 0.625 60-61 0.5499999999999999 62-63 0.5625 64-65 2.0375 66-67 2.5250000000000004 68-69 3.7125 70-71 3.4125 72-73 2.8875 74-75 0.4875 76-77 0.5499999999999999 78-79 0.5125000000000001 80-81 0.4875 82-83 0.9875 84-85 0.525 86-87 0.5 88-89 0.44999999999999996 90-91 0.46249999999999997 92-93 0.44999999999999996 94-95 0.43750000000000006 96-97 0.375 98-99 0.525 100 0.525 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.46373850868233 97.375 2 0.3830439223697651 0.75 3 0.07660878447395301 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.02553626149131767 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.05107252298263534 1.4749999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 44 1.0999999999999999 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 15 0.375 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.0625 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1375 0.0 0.0 0.0 0.0 46-47 0.175 0.0 0.0 0.0 0.0 48-49 0.225 0.0 0.0 0.0 0.0 50-51 0.2875 0.0 0.0 0.0 0.0 52-53 0.375 0.0 0.0 0.0 0.0 54-55 0.45 0.0 0.0 0.0 0.0 56-57 0.6125 0.0 0.0 0.0 0.0 58-59 0.7749999999999999 0.0 0.0 0.0 0.0 60-61 0.95 0.0 0.0 0.0 0.0 62-63 1.1375 0.0 0.0 0.0 0.0 64-65 1.4 0.0 0.0 0.0 0.0 66-67 1.6875 0.0 0.0 0.0 0.0 68-69 1.9749999999999999 0.0 0.0 0.0 0.0 70-71 2.225 0.0 0.0 0.0 0.0 72-73 2.4125 0.0 0.0 0.0 0.0 74-75 2.5999999999999996 0.0 0.0 0.0 0.0 76-77 3.0374999999999996 0.0 0.0 0.0 0.0 78-79 3.4 0.0 0.0 0.0 0.0 80-81 3.8625000000000003 0.0 0.0 0.0 0.0 82-83 4.375 0.0 0.0 0.0 0.0 84-85 4.85 0.0 0.0 0.0 0.0 86-87 5.550000000000001 0.0 0.0 0.0 0.0 88 5.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 100 0.0053342255 13.976583 76-77 >>END_MODULE Read 1695710 spots for ERR3317420.sra Written 1695710 spots for ERR3317420.sra Read 1695710 spots for ERR3317420.sra Written 1695710 spots for ERR3317420.sra Read 1695710 spots for ERR3317420.sra Written 1695710 spots for ERR3317420.sra Read 1695710 spots for ERR3317420.sra Written 1695710 spots for ERR3317420.sra Read 1695710 spots for ERR3317420.sra Written 1695710 spots for ERR3317420.sra Read 1695710 spots for ERR3317420.sra Written 1695710 spots for ERR3317420.sra Read 1695710 spots for ERR3317420.sra Written 1695710 spots for ERR3317420.sra Read 1695710 spots for ERR3317420.sra Written 1695710 spots for ERR3317420.sra Read 1695710 spots for ERR3317420.sra Written 1695710 spots for ERR3317420.sra Read 1695710 spots for ERR3317420.sra Written 1695710 spots for ERR3317420.sra Read 1695710 spots for ERR3317420.sra Written 1695710 spots for ERR3317420.sra Read 1695710 spots for ERR3317420.sra Written 1695710 spots for ERR3317420.sra Read 1695710 spots for ERR3317420.sra Written 1695710 spots for ERR3317420.sra Read 1695710 spots for ERR3317420.sra Written 1695710 spots for ERR3317420.sra Read 1695710 spots for ERR3317420.sra Written 1695710 spots for ERR3317420.sra Read 1695710 spots for ERR3317420.sra Written 1695710 spots for ERR3317420.sra Read 1695710 spots for ERR3317420.sra Written 1695710 spots for ERR3317420.sra Read 1695724 spots for ERR3317420.sra Written 1695724 spots for ERR3317420.sra Read 1695710 spots for ERR3317420.sra Written 1695710 spots for ERR3317420.sra Read 1695710 spots for ERR3317420.sra Written 1695710 spots for ERR3317420.sra SRR ids: ['ERR3317420.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nka2c045 ERR3317420.sra spots: 33914214 blocks: [[1, 1695710], [1695711, 3391420], [3391421, 5087130], [5087131, 6782840], [6782841, 8478550], [8478551, 10174260], [10174261, 11869970], [11869971, 13565680], [13565681, 15261390], [15261391, 16957100], [16957101, 18652810], [18652811, 20348520], [20348521, 22044230], [22044231, 23739940], [23739941, 25435650], [25435651, 27131360], [27131361, 28827070], [28827071, 30522780], [30522781, 32218490], [32218491, 33914214]] ERR3317420 file size 8848429 ERR3317420 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317420 ERR3317420_1.fastq ERR3317420_2.fastq Input file: ERR3317420_1.fastq Paired file: ERR3317420_2.fastq trimmed: ERR3317420-trimmed-pair1.fastq, ERR3317420-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 08:58:16 2024 >> started Tue Dec 10 08:58:52 2024 >> done (36.372s) 33914214 read pairs processed; of these: 258975 ( 0.76%) short read pairs filtered out after trimming by size control 389657 ( 1.15%) empty read pairs filtered out after trimming by size control 33265582 (98.09%) read pairs available; of these: 10981086 (33.01%) trimmed read pairs available after processing 22284496 (66.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 458 0.00% 19 465 0.00% 20 753 0.00% 21 1035 0.00% 22 1381 0.00% 23 1875 0.01% 24 2303 0.01% 25 2862 0.01% 26 3400 0.01% 27 4223 0.01% 28 4413 0.01% 29 5373 0.02% 30 6269 0.02% 31 7908 0.02% 32 8256 0.02% 33 8714 0.03% 34 10106 0.03% 35 10638 0.03% 36 11651 0.04% 37 12768 0.04% 38 15030 0.05% 39 16206 0.05% 40 16385 0.05% 41 18076 0.05% 42 19070 0.06% 43 20653 0.06% 44 21933 0.07% 45 23108 0.07% 46 24633 0.07% 47 27904 0.08% 48 29125 0.09% 49 30511 0.09% 50 34096 0.10% 51 34597 0.10% 52 36025 0.11% 53 39195 0.12% 54 41720 0.13% 55 45013 0.14% 56 48143 0.14% 57 51842 0.16% 58 58204 0.17% 59 82694 0.25% 60 89489 0.27% 61 93467 0.28% 62 97333 0.29% 63 100820 0.30% 64 108159 0.33% 65 113889 0.34% 66 125663 0.38% 67 124867 0.38% 68 127381 0.38% 69 132042 0.40% 70 136568 0.41% 71 142183 0.43% 72 144464 0.43% 73 151854 0.46% 74 158326 0.48% 75 149805 0.45% 76 150405 0.45% 77 158675 0.48% 78 167572 0.50% 79 175387 0.53% 80 182569 0.55% 81 189579 0.57% 82 193312 0.58% 83 203755 0.61% 84 211591 0.64% 85 222933 0.67% 86 233017 0.70% 87 237676 0.71% 88 237661 0.71% 89 261477 0.79% 90 268059 0.81% 91 290487 0.87% 92 319150 0.96% 93 350618 1.05% 94 403391 1.21% 95 470154 1.41% 96 554969 1.67% 97 693763 2.09% 98 875295 2.63% 99 1094267 3.29% 100 22284496 66.99% 33265582 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.54 fanout-score-rank=18 prefix-density=0.56 prefix-fanout=3.0 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=95.91 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=3.0 sequence=ACAACACCAGCCACCAGCTCATCTCTCACTGACCTTACCACTTGAATTGGGATCGAAATGGCCGCGTCGGCGCTGCACCAGACCACCAGCTTCCTCGGCACCGCCCCACGCCGCGATGACCTCGTCCGCAGCGTCGGCGACTTCGG criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=1.91 fanout-score-rank=37 prefix-density=0.31 prefix-fanout=1.0 sequence=GTCCAGTACCTGCC criterion=fanout-score sequence-density=0.06 sequence-density-rank=21 fanout-score=75.38 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=10.6 sequence=CTTCTTCTCCGGGTCC ERR3317420 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:01:07 Started mapping on | Dec 10 09:01:07 Finished on | Dec 10 09:03:21 Mapping speed, Million of reads per hour | 893.70 Number of input reads | 33265582 Average input read length | 189 UNIQUE READS: Uniquely mapped reads number | 30298288 Uniquely mapped reads % | 91.08% Average mapped length | 188.28 Number of splices: Total | 18566975 Number of splices: Annotated (sjdb) | 17671547 Number of splices: GT/AG | 18300325 Number of splices: GC/AG | 237472 Number of splices: AT/AC | 14391 Number of splices: Non-canonical | 14787 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.00% Deletion average length | 1.23 Insertion rate per base | 0.00% Insertion average length | 1.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1763663 % of reads mapped to multiple loci | 5.30% Number of reads mapped to too many loci | 64116 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.35% % of reads unmapped: other | 1.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1489523 1489523 1489523 N_multimapping 1763663 1763663 1763663 N_noFeature 1044636 2667464 28076425 N_ambiguous 856572 289787 17503 UnstrandedReadsAssigned:28397080 PositiveStrandReadsAssigned:27341037 NegativeStrandReadsAssigned:2204360 Dataset is classified positive stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 ERR3317420 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317420-trimmed-pair1.fastq ERR3317420-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,265,582 reads, 28,699,580 reads pseudoaligned [quant] estimated average fragment length: 187.607 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,159 rounds 52973 ERR3317420.ke.tsv 35125 ERR3317420.se.tsv 88098 total ==> ERR3317420.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 749.611 0 0 PNS24247 1044 857.393 28.9799 1.78379 PNS24249 1928 1741.39 101.758 3.08389 PNS24246 1044 857.393 28.9799 1.78379 PNS24248 1044 857.393 28.9799 1.78379 PNS24244 1471 1284.39 269.302 11.0654 PNS24243 293 132.816 2 0.794705 KQK14069 1603 1416.39 12154 452.856 KQK14071 474 293.882 72.1105 12.9495 ==> ERR3317420.se.tsv <== BRADI_1g14170v3 15028 BRADI_1g53295v3 61 BRADI_1g59795v3 864 BRADI_1g07683v3 0 BRADI_1g00485v3 76 BRADI_1g20270v3 2811 BRADI_1g74790v3 201 BRADI_1g09890v3 14 BRADI_1g77505v3 410 BRADI_1g48960v3 0 ERR3317420 completed mapping pipeline successfully