Starting /dee2/code/volunteer_pipeline.sh ERR3317421 current disk space = 1525478404096 free memory = 1602364196 ERR3317421 SRAfilesize 15923cacccf08e9af5839b6c6da9227d ERR3317421.sra ERR3317421.sra file validated ERR3317421 is paired end ERR3317421 is conventional basespace ERR3317421 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317421_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1265 33.0 31.0 34.0 30.0 34.0 2 32.4015 34.0 31.0 34.0 30.0 34.0 3 32.516 34.0 31.0 34.0 31.0 34.0 4 36.10775 37.0 35.0 37.0 35.0 37.0 5 35.6475 37.0 35.0 37.0 35.0 37.0 6 35.80775 37.0 35.0 37.0 35.0 37.0 7 35.8135 37.0 35.0 37.0 33.0 37.0 8 35.8795 37.0 35.0 37.0 35.0 37.0 9 37.488 39.0 37.0 39.0 35.0 39.0 10-11 37.51925 39.0 37.0 39.0 34.5 39.0 12-13 37.5 39.0 37.0 39.0 35.0 39.0 14-15 38.699125 40.0 38.0 41.0 34.0 41.0 16-17 38.65175 40.0 38.0 41.0 34.0 41.0 18-19 38.653375 40.0 38.0 41.0 34.0 41.0 20-21 38.623625000000004 40.0 38.0 41.0 34.0 41.0 22-23 38.673249999999996 40.0 38.0 41.0 34.0 41.0 24-25 38.5265 40.0 38.0 41.0 34.0 41.0 26-27 38.406499999999994 40.0 38.0 41.0 34.0 41.0 28-29 38.151125 40.0 37.5 41.0 33.5 41.0 30-31 38.03125 40.0 37.0 41.0 33.0 41.0 32-33 38.057625 40.0 37.5 41.0 33.0 41.0 34-35 37.6995 40.0 37.0 41.0 32.0 41.0 36-37 37.712625 40.0 37.0 41.0 32.5 41.0 38-39 37.6635 40.0 37.0 41.0 32.5 41.0 40-41 37.58725 40.0 37.0 41.0 32.0 41.0 42-43 37.53175 39.5 36.5 41.0 32.5 41.0 44-45 37.052125000000004 39.0 35.5 41.0 31.0 41.0 46-47 37.09075 39.0 35.5 41.0 31.0 41.0 48-49 37.19625 39.0 35.0 41.0 31.5 41.0 50-51 36.932375 39.0 35.0 41.0 31.0 41.0 52-53 36.779624999999996 39.0 35.0 41.0 31.0 41.0 54-55 36.25975 38.5 35.0 40.5 30.0 41.0 56-57 35.998625000000004 38.0 35.0 40.0 29.5 41.0 58-59 36.023624999999996 37.5 35.0 40.0 30.0 41.0 60-61 35.628375000000005 37.0 34.5 40.0 29.5 41.0 62-63 35.282125 36.5 34.0 39.5 29.0 41.0 64-65 35.04375 36.0 34.0 39.0 29.5 41.0 66-67 34.6775 35.0 34.0 39.0 29.0 40.5 68-69 34.531875 35.0 34.0 38.5 29.0 40.0 70-71 34.11575 35.0 33.0 37.0 29.0 39.5 72-73 33.719375 35.0 33.0 37.0 28.5 39.0 74-75 33.45762499999999 35.0 33.0 36.0 28.0 39.0 76-77 31.823124999999997 33.5 30.5 35.0 25.5 36.5 78-79 32.9755 35.0 33.0 35.0 28.5 37.0 80-81 33.01025 35.0 33.0 35.0 29.0 37.0 82-83 32.813625 35.0 33.0 35.0 28.0 36.0 84-85 32.559 35.0 33.0 35.0 27.0 36.0 86-87 32.40675 35.0 33.0 35.0 27.0 36.0 88-89 32.416125 35.0 33.0 35.0 29.0 35.5 90-91 32.283625 35.0 33.0 35.0 27.5 35.0 92-93 32.08525 35.0 33.0 35.0 27.0 35.0 94-95 31.750375 35.0 33.0 35.0 25.0 35.0 96-97 31.555 35.0 32.5 35.0 25.5 35.0 98-99 31.200625000000002 35.0 32.0 35.0 24.5 35.0 100 30.09575 34.0 30.0 35.0 20.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 3.0 10 1.0 11 2.0 12 6.0 13 6.0 14 5.0 15 6.0 16 8.0 17 6.0 18 6.0 19 8.0 20 13.0 21 11.0 22 9.0 23 17.0 24 21.0 25 21.0 26 25.0 27 38.0 28 56.0 29 68.0 30 86.0 31 110.0 32 119.0 33 154.0 34 268.0 35 380.0 36 618.0 37 994.0 38 817.0 39 117.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 25.794345759319487 25.969477107830873 20.190142606955217 28.04603452589442 2 24.474999999999998 25.8 18.725 31.0 3 23.45 26.325 19.950000000000003 30.275000000000002 4 25.15 26.400000000000002 18.025 30.425 5 27.3806516797171 24.57691336196009 18.388481939883807 29.653953018439 6 29.275000000000002 26.275 19.400000000000002 25.05 7 28.249999999999996 23.925 22.25 25.575 8 29.099999999999998 25.95 24.7 20.25 9 31.525 28.575 22.400000000000002 17.5 10-11 31.55 26.6 23.275000000000002 18.575 12-13 30.662499999999998 24.975 24.0125 20.349999999999998 14-15 28.299999999999997 25.9625 24.1625 21.575 16-17 27.287499999999998 25.924999999999997 24.4 22.3875 18-19 25.937500000000004 25.6 25.5 22.9625 20-21 24.325 26.437500000000004 25.525 23.7125 22-23 25.837500000000002 26.787499999999998 24.462500000000002 22.912499999999998 24-25 24.85 26.924999999999997 25.624999999999996 22.6 26-27 25.137500000000003 26.650000000000002 24.837500000000002 23.375 28-29 25.137500000000003 24.9 25.25 24.712500000000002 30-31 25.1 25.775 25.75 23.375 32-33 25.087500000000002 26.35 25.6125 22.95 34-35 25.4625 25.525 25.6 23.4125 36-37 24.925 26.787499999999998 25.0625 23.225 38-39 25.5125 25.974999999999998 25.587500000000002 22.925 40-41 25.8125 26.1625 24.5 23.525 42-43 25.0 26.937499999999996 25.75 22.3125 44-45 25.1875 26.525 24.6125 23.674999999999997 46-47 26.487500000000004 25.7625 24.587500000000002 23.1625 48-49 25.6125 26.0625 25.362499999999997 22.9625 50-51 25.074999999999996 26.0625 25.224999999999998 23.6375 52-53 25.637500000000003 26.1 25.4375 22.825 54-55 25.587500000000002 25.4375 26.450000000000003 22.525000000000002 56-57 25.724999999999998 25.587500000000002 25.2 23.4875 58-59 25.937500000000004 25.8 24.712500000000002 23.549999999999997 60-61 25.3 26.424999999999997 24.775 23.5 62-63 25.1875 27.1 24.837500000000002 22.875 64-65 25.887500000000003 25.174999999999997 25.074999999999996 23.8625 66-67 25.7375 26.35 24.6625 23.25 68-69 24.7375 27.025 25.137500000000003 23.1 70-71 25.2 26.724999999999998 25.025 23.05 72-73 25.474999999999998 27.287499999999998 24.025 23.2125 74-75 24.95 26.387500000000003 25.45 23.2125 76-77 25.650000000000002 26.5125 24.837500000000002 23.0 78-79 25.724999999999998 26.375 24.5625 23.3375 80-81 26.3125 25.974999999999998 24.65 23.0625 82-83 25.900000000000002 26.85 24.1875 23.0625 84-85 25.374999999999996 27.437499999999996 24.15 23.0375 86-87 24.925 27.05 25.662499999999998 22.3625 88-89 25.2125 26.674999999999997 24.5125 23.599999999999998 90-91 24.8125 27.487499999999997 25.0125 22.6875 92-93 25.474999999999998 27.525 23.7875 23.2125 94-95 26.075 26.875 24.474999999999998 22.575 96-97 25.5375 26.575 24.925 22.9625 98-99 25.337500000000002 26.8125 25.0 22.85 100 26.5 26.674999999999997 23.35 23.474999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 2.0 6 2.0 7 1.0 8 0.0 9 0.5 10 0.5 11 1.5 12 2.0 13 2.5 14 2.5 15 0.5 16 0.5 17 1.0 18 1.0 19 1.0 20 2.0 21 1.5 22 0.5 23 1.5 24 1.5 25 1.5 26 2.5 27 3.0 28 5.5 29 8.0 30 10.0 31 12.5 32 15.5 33 23.0 34 27.5 35 30.0 36 43.0 37 53.0 38 62.5 39 81.0 40 114.5 41 159.0 42 177.0 43 187.0 44 206.0 45 206.0 46 203.5 47 202.0 48 192.0 49 187.5 50 168.0 51 151.5 52 141.5 53 123.0 54 109.0 55 99.5 56 96.0 57 87.5 58 77.0 59 67.0 60 61.0 61 59.5 62 52.5 63 51.5 64 50.0 65 46.0 66 42.0 67 46.5 68 43.5 69 31.5 70 30.5 71 23.0 72 21.5 73 24.0 74 18.5 75 14.0 76 10.5 77 6.0 78 3.0 79 1.0 80 1.0 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 1.0250000000000001 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.80831643002028 97.425 2 0.9888438133874239 1.95 3 0.17748478701825557 0.525 4 0.02535496957403651 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.175 0.0 0.0 0.0 0.0 26-27 0.2 0.0 0.0 0.0 0.0 28-29 0.225 0.0 0.0 0.0 0.0 30-31 0.2375 0.0 0.0 0.0 0.0 32-33 0.2875 0.0 0.0 0.0 0.0 34-35 0.3375 0.0 0.0 0.0 0.0 36-37 0.375 0.0 0.0 0.0 0.0 38-39 0.45 0.0 0.0 0.0 0.0 40-41 0.4625 0.0 0.0 0.0 0.0 42-43 0.5875 0.0 0.0 0.0 0.0 44-45 0.7875 0.0 0.0 0.0 0.0 46-47 0.9375 0.0 0.0 0.0 0.0 48-49 1.05 0.0 0.0 0.0 0.0 50-51 1.1625 0.0 0.0 0.0 0.0 52-53 1.2625 0.0 0.0 0.0 0.0 54-55 1.35 0.0 0.0 0.0 0.0 56-57 1.5375 0.0 0.0 0.0 0.0 58-59 1.6625 0.0 0.0 0.0 0.0 60-61 1.8375 0.0 0.0 0.0 0.0 62-63 2.0375 0.0 0.0 0.0 0.0 64-65 2.1875 0.0 0.0 0.0 0.0 66-67 2.375 0.0 0.0 0.0 0.0 68-69 2.6 0.0 0.0 0.0 0.0 70-71 2.9125 0.0 0.0 0.0 0.0 72-73 3.175 0.0 0.0 0.0 0.0 74-75 3.4875 0.0 0.0 0.0 0.0 76-77 3.725 0.0 0.0 0.0 0.0 78-79 4.050000000000001 0.0 0.0 0.0 0.0 80-81 4.4 0.0 0.0 0.0 0.0 82-83 4.725 0.0 0.0 0.0 0.0 84-85 5.3 0.0 0.0 0.0 0.0 86-87 5.9625 0.0 0.0 0.0 0.0 88 6.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317421 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317421_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.19425 33.0 31.0 34.0 30.0 34.0 2 31.102 33.0 31.0 34.0 27.0 34.0 3 30.89375 31.0 31.0 34.0 27.0 34.0 4 34.677 37.0 35.0 37.0 32.0 37.0 5 34.867 37.0 35.0 37.0 33.0 37.0 6 34.8645 37.0 35.0 37.0 32.0 37.0 7 34.91525 37.0 35.0 37.0 32.0 37.0 8 35.0495 37.0 35.0 37.0 32.0 37.0 9 36.578 39.0 37.0 39.0 32.0 39.0 10-11 36.612 39.0 37.0 39.0 32.0 39.0 12-13 36.523375 39.0 37.0 39.0 32.0 39.0 14-15 37.701375 40.0 38.0 41.0 32.5 41.0 16-17 37.636250000000004 40.0 38.0 41.0 32.5 41.0 18-19 37.51575 40.0 37.5 41.0 32.0 41.0 20-21 37.439375 40.0 37.0 41.0 32.0 41.0 22-23 37.3135 40.0 37.0 41.0 32.0 41.0 24-25 37.1335 40.0 37.0 41.0 31.0 41.0 26-27 37.141625000000005 40.0 37.0 41.0 31.0 41.0 28-29 36.889 40.0 36.5 41.0 30.5 41.0 30-31 36.773875000000004 40.0 36.5 41.0 30.0 41.0 32-33 36.593 39.5 36.0 41.0 30.0 41.0 34-35 36.60525 40.0 36.0 41.0 30.0 41.0 36-37 36.360375000000005 39.5 36.0 41.0 30.0 41.0 38-39 36.213 39.0 35.5 41.0 29.5 41.0 40-41 36.238625 39.0 35.0 41.0 30.0 41.0 42-43 36.068625 39.0 35.0 41.0 28.5 41.0 44-45 36.015249999999995 39.0 35.0 41.0 29.0 41.0 46-47 35.84325 39.0 35.0 41.0 28.0 41.0 48-49 35.869875 39.0 35.0 41.0 28.5 41.0 50-51 34.543625000000006 38.0 33.5 40.0 25.5 40.5 52-53 34.654875000000004 38.0 34.0 39.5 26.5 40.5 54-55 35.372625 39.0 35.0 40.5 27.5 41.0 56-57 35.174875 38.5 35.0 41.0 26.5 41.0 58-59 35.074625 38.0 35.0 41.0 26.0 41.0 60-61 34.901624999999996 38.0 34.0 40.0 26.5 41.0 62-63 34.372 37.0 34.0 40.0 26.0 41.0 64-65 34.003125 37.0 34.0 40.0 25.5 41.0 66-67 33.449875000000006 36.0 33.0 39.5 22.5 41.0 68-69 32.8235 35.5 33.0 39.0 19.5 41.0 70-71 32.58862499999999 35.0 33.0 39.0 20.0 40.0 72-73 32.1205 35.0 33.0 37.5 14.0 39.5 74-75 32.0395 35.0 32.5 37.0 19.0 39.0 76-77 31.866875 35.0 32.0 36.5 20.5 39.0 78-79 31.694625000000002 35.0 32.0 36.0 22.0 38.0 80-81 31.297874999999998 35.0 32.0 36.0 20.0 37.0 82-83 30.893250000000002 35.0 31.5 35.0 18.5 37.0 84-85 30.691375 35.0 31.0 35.0 18.0 36.0 86-87 30.345125 35.0 31.0 35.0 16.0 36.0 88-89 30.17925 35.0 31.0 35.0 9.5 36.0 90-91 29.849125 34.5 31.0 35.0 6.5 35.0 92-93 29.585625 34.0 30.5 35.0 2.0 35.0 94-95 29.4055 34.0 30.5 35.0 2.0 35.0 96-97 29.157625 34.0 30.0 35.0 2.0 35.0 98-99 28.87575 34.0 30.0 35.0 2.0 35.0 100 27.5985 33.0 27.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 58.0 3 4.0 4 5.0 5 2.0 6 3.0 7 9.0 8 10.0 9 15.0 10 12.0 11 14.0 12 10.0 13 14.0 14 14.0 15 16.0 16 9.0 17 5.0 18 12.0 19 17.0 20 13.0 21 15.0 22 25.0 23 21.0 24 32.0 25 21.0 26 41.0 27 50.0 28 65.0 29 85.0 30 91.0 31 127.0 32 125.0 33 177.0 34 204.0 35 335.0 36 482.0 37 819.0 38 889.0 39 154.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.313824419778 11.301715438950556 29.717457114026235 29.667003027245208 2 26.407472860388793 10.855844483716233 26.407472860388793 36.32920979550619 3 23.228247162673394 12.585119798234553 30.56746532156368 33.61916771752838 4 24.470232088799193 11.579212916246217 27.547931382441977 36.40262361251261 5 25.61191016906384 13.474640423921272 24.35023971738582 36.56320968962907 6 24.609964771011576 18.24358329139406 30.674383492702567 26.472068444891793 7 19.577252138902868 24.257674886763965 38.70156014091595 17.463512833417212 8 18.04927099044746 26.168929110105584 35.947712418300654 19.834087481146305 9 18.042274786109715 29.089079013588325 33.99597382989431 18.87267237040765 10-11 20.08052340211374 26.119778560644185 32.27226975339708 21.527428283844994 12-13 20.21892299949673 25.905888273779563 32.90135883241067 20.973829894313035 14-15 20.64670357322597 25.641670860593862 30.598892803220934 23.112732762959233 16-17 20.75732796578186 25.525223298528115 29.789910680588754 23.927538055101273 18-19 20.485717880961367 26.450232792248645 30.36365924248144 22.700390084308545 20-21 21.53826787512588 24.72306143001007 29.83383685800604 23.904833836858007 22-23 21.45106436578914 24.197002141327623 29.84003023050762 24.511903262375615 24-25 21.424974823766366 25.27693856998993 29.279959718026184 24.018126888217523 26-27 21.038732394366196 25.163480885311873 28.345070422535212 25.452716297786722 28-29 20.506042296072508 25.541289023162133 28.298086606243704 25.654582074521652 30-31 21.487915407854985 24.660120845921448 29.154078549848943 24.69788519637462 32-33 21.72327044025157 25.522012578616355 27.333333333333332 25.42138364779874 34-35 21.229260935143287 25.201106083459024 28.11714429361488 25.452488687782804 36-37 21.86046511627907 26.147077309868006 27.517284726587054 24.47517284726587 38-39 21.34238310708899 26.143790849673206 26.97335344394168 25.540472599296127 40-41 22.202687429360793 24.6891874921512 27.338942609569255 25.76918246891875 42-43 22.10381143430291 25.890170511534606 26.629889669007024 25.376128385155468 44-45 21.52313705711764 26.516202244357583 26.629680998613036 25.330979699911737 46-47 22.22780990696505 25.986924817701784 26.037213980387225 25.748051294945938 48-49 21.331658291457288 26.758793969849247 27.474874371859297 24.43467336683417 50-51 22.90959386395071 25.185464604551743 27.26015340123224 24.644788130265308 52-53 22.34524408656266 25.905888273779563 25.817815802717664 25.93105183694011 54-55 20.999622308951277 25.85924713584288 29.082210751605185 24.058919803600652 56-57 21.87421383647799 25.735849056603772 27.056603773584904 25.333333333333336 58-59 22.966687617850408 24.739157762413576 26.98931489629164 25.304839723444374 60-61 21.4321608040201 25.628140703517587 28.693467336683415 24.246231155778894 62-63 22.456669178598343 24.868123587038433 27.38005526249686 25.295151971866364 64-65 23.115960416138037 25.00634356762243 26.960162395331132 24.9175336209084 66-67 22.50095504902585 25.531643957723166 28.040239398955812 23.927161594295175 68-69 22.140931844435887 26.107046592221796 27.06969580284944 24.682325760492876 70-71 22.737759548833633 25.74980774160472 26.198410663932325 25.314022045629326 72-73 21.89613372463953 25.44340946790864 28.161286206456555 24.499170600995278 74-75 23.74200025097252 25.31057849165516 26.113690550884677 24.83373070648764 76-77 23.756906077348066 24.91210447011552 25.791059768960324 25.53992968357609 78-79 22.49278272875612 25.84410694113217 27.551148487510986 24.111961842600728 80-81 22.87040521891858 25.85622882950696 26.62150294818718 24.651863003387277 82-83 23.43691030318279 24.92137375770537 26.34293621839225 25.298779720719587 84-85 23.239171374764595 26.516007532956685 26.1142498430634 24.130571249215315 86-87 24.08081315095997 26.43995482494667 25.887815284226377 23.591416739866986 88-89 23.31911690918214 25.363773206221772 25.92824887104867 25.388861013547416 90-91 23.871048670346212 25.589563472152534 26.593075765178124 23.94631209232313 92-93 24.419917220619592 25.473472971278067 26.163301141352065 23.943308666750283 94-95 24.0687319704001 24.520255863539443 26.376520757556754 25.0344914085037 96-97 25.04387064427175 25.256956630734518 26.49786914013537 23.20130358485836 98-99 23.93323293172691 26.01656626506024 26.64407630522088 23.406124497991968 100 26.330321285140563 23.744979919678716 25.376506024096386 24.548192771084338 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 44.0 1 26.0 2 5.5 3 3.0 4 3.0 5 2.5 6 3.0 7 2.5 8 2.0 9 1.5 10 2.0 11 3.5 12 4.0 13 3.0 14 0.5 15 1.5 16 1.5 17 2.0 18 3.0 19 3.0 20 3.0 21 1.5 22 2.0 23 2.5 24 2.0 25 5.0 26 7.5 27 7.0 28 9.0 29 14.5 30 17.0 31 19.0 32 24.5 33 26.5 34 31.5 35 44.0 36 55.5 37 66.0 38 94.5 39 133.5 40 144.5 41 157.5 42 182.5 43 189.0 44 208.5 45 207.5 46 183.5 47 189.5 48 188.5 49 162.5 50 149.0 51 145.0 52 133.0 53 119.0 54 103.0 55 99.0 56 89.5 57 71.5 58 60.0 59 51.0 60 49.5 61 48.0 62 50.0 63 51.0 64 40.0 65 34.0 66 31.5 67 32.0 68 29.5 69 21.5 70 20.0 71 13.5 72 16.0 73 15.5 74 8.5 75 9.5 76 5.0 77 2.5 78 5.0 79 6.0 80 4.0 81 4.0 82 4.0 83 1.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8999999999999999 2 0.975 3 0.8750000000000001 4 0.8999999999999999 5 0.9249999999999999 6 0.65 7 0.65 8 0.5499999999999999 9 0.65 10-11 0.65 12-13 0.65 14-15 0.65 16-17 0.6375 18-19 0.6625 20-21 0.7000000000000001 22-23 0.7625 24-25 0.7000000000000001 26-27 0.6 28-29 0.7000000000000001 30-31 0.7000000000000001 32-33 0.625 34-35 0.5499999999999999 36-37 0.5625 38-39 0.5499999999999999 40-41 0.46249999999999997 42-43 0.3 44-45 0.8625 46-47 0.575 48-49 0.5 50-51 0.5875 52-53 0.65 54-55 0.7125 56-57 0.625 58-59 0.5625 60-61 0.5 62-63 0.475 64-65 1.4749999999999999 66-67 1.8375 68-69 2.6125 70-71 2.475 72-73 2.0375 74-75 0.3875 76-77 0.44999999999999996 78-79 0.41250000000000003 80-81 0.36250000000000004 82-83 0.6375 84-85 0.43750000000000006 86-87 0.3875 88-89 0.35000000000000003 90-91 0.35000000000000003 92-93 0.3375 94-95 0.3375 96-97 0.27499999999999997 98-99 0.4 100 0.4 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.48979591836735 97.5 2 0.3826530612244898 0.75 3 0.05102040816326531 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025510204081632654 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05102040816326531 1.4500000000000002 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 47 1.175 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 11 0.27499999999999997 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.1375 0.0 0.0 0.0 0.0 32-33 0.1875 0.0 0.0 0.0 0.0 34-35 0.2375 0.0 0.0 0.0 0.0 36-37 0.275 0.0 0.0 0.0 0.0 38-39 0.35 0.0 0.0 0.0 0.0 40-41 0.3625 0.0 0.0 0.0 0.0 42-43 0.4625 0.0 0.0 0.0 0.0 44-45 0.6625 0.0 0.0 0.0 0.0 46-47 0.8125 0.0 0.0 0.0 0.0 48-49 0.925 0.0 0.0 0.0 0.0 50-51 1.0375 0.0 0.0 0.0 0.0 52-53 1.1625 0.0 0.0 0.0 0.0 54-55 1.25 0.0 0.0 0.0 0.0 56-57 1.4125 0.0 0.0 0.0 0.0 58-59 1.5375 0.0 0.0 0.0 0.0 60-61 1.7125 0.0 0.0 0.0 0.0 62-63 1.9125 0.0 0.0 0.0 0.0 64-65 2.0875 0.0 0.0 0.0 0.0 66-67 2.25 0.0 0.0 0.0 0.0 68-69 2.45 0.0 0.0 0.0 0.0 70-71 2.7375 0.0 0.0 0.0 0.0 72-73 3.0250000000000004 0.0 0.0 0.0 0.0 74-75 3.3 0.0 0.0 0.0 0.0 76-77 3.5625 0.0 0.0 0.0 0.0 78-79 3.875 0.0 0.0 0.0 0.0 80-81 4.199999999999999 0.0 0.0 0.0 0.0 82-83 4.5125 0.0 0.0 0.0 0.0 84-85 4.975 0.0 0.0 0.0 0.0 86-87 5.625 0.0 0.0 0.0 0.0 88 6.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1724484 spots for ERR3317421.sra Written 1724484 spots for ERR3317421.sra Read 1724484 spots for ERR3317421.sra Written 1724484 spots for ERR3317421.sra Read 1724484 spots for ERR3317421.sra Written 1724484 spots for ERR3317421.sra Read 1724484 spots for ERR3317421.sra Written 1724484 spots for ERR3317421.sra Read 1724484 spots for ERR3317421.sra Written 1724484 spots for ERR3317421.sra Read 1724484 spots for ERR3317421.sra Written 1724484 spots for ERR3317421.sra Read 1724486 spots for ERR3317421.sra Written 1724486 spots for ERR3317421.sra Read 1724484 spots for ERR3317421.sra Written 1724484 spots for ERR3317421.sra Read 1724484 spots for ERR3317421.sra Written 1724484 spots for ERR3317421.sra Read 1724484 spots for ERR3317421.sra Written 1724484 spots for ERR3317421.sra Read 1724484 spots for ERR3317421.sra Written 1724484 spots for ERR3317421.sra Read 1724484 spots for ERR3317421.sra Written 1724484 spots for ERR3317421.sra Read 1724484 spots for ERR3317421.sra Written 1724484 spots for ERR3317421.sra Read 1724484 spots for ERR3317421.sra Written 1724484 spots for ERR3317421.sra Read 1724484 spots for ERR3317421.sra Written 1724484 spots for ERR3317421.sra Read 1724484 spots for ERR3317421.sra Written 1724484 spots for ERR3317421.sra Read 1724484 spots for ERR3317421.sra Written 1724484 spots for ERR3317421.sra Read 1724484 spots for ERR3317421.sra Written 1724484 spots for ERR3317421.sra Read 1724484 spots for ERR3317421.sra Written 1724484 spots for ERR3317421.sra Read 1724484 spots for ERR3317421.sra Written 1724484 spots for ERR3317421.sra SRR ids: ['ERR3317421.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lur4j6s1 ERR3317421.sra spots: 34489682 blocks: [[1, 1724484], [1724485, 3448968], [3448969, 5173452], [5173453, 6897936], [6897937, 8622420], [8622421, 10346904], [10346905, 12071388], [12071389, 13795872], [13795873, 15520356], [15520357, 17244840], [17244841, 18969324], [18969325, 20693808], [20693809, 22418292], [22418293, 24142776], [24142777, 25867260], [25867261, 27591744], [27591745, 29316228], [29316229, 31040712], [31040713, 32765196], [32765197, 34489682]] ERR3317421 file size 8998758 ERR3317421 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317421 ERR3317421_1.fastq ERR3317421_2.fastq Input file: ERR3317421_1.fastq Paired file: ERR3317421_2.fastq trimmed: ERR3317421-trimmed-pair1.fastq, ERR3317421-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:09:34 2024 >> started Tue Dec 10 09:10:26 2024 >> done (52.697s) 34489682 read pairs processed; of these: 260373 ( 0.75%) short read pairs filtered out after trimming by size control 395991 ( 1.15%) empty read pairs filtered out after trimming by size control 33833318 (98.10%) read pairs available; of these: 10841188 (32.04%) trimmed read pairs available after processing 22992130 (67.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 448 0.00% 19 582 0.00% 20 836 0.00% 21 1113 0.00% 22 1479 0.00% 23 2143 0.01% 24 2631 0.01% 25 3029 0.01% 26 3844 0.01% 27 4530 0.01% 28 5226 0.02% 29 5879 0.02% 30 6806 0.02% 31 8515 0.03% 32 9539 0.03% 33 10135 0.03% 34 11859 0.04% 35 12451 0.04% 36 13847 0.04% 37 14773 0.04% 38 16984 0.05% 39 18705 0.06% 40 18916 0.06% 41 20528 0.06% 42 21687 0.06% 43 23347 0.07% 44 25024 0.07% 45 26858 0.08% 46 28313 0.08% 47 31120 0.09% 48 32326 0.10% 49 33494 0.10% 50 36772 0.11% 51 37486 0.11% 52 39470 0.12% 53 42743 0.13% 54 45081 0.13% 55 48509 0.14% 56 50964 0.15% 57 54125 0.16% 58 58324 0.17% 59 82987 0.25% 60 89487 0.26% 61 93260 0.28% 62 97449 0.29% 63 101655 0.30% 64 106416 0.31% 65 112030 0.33% 66 120628 0.36% 67 122780 0.36% 68 125060 0.37% 69 128790 0.38% 70 132658 0.39% 71 139768 0.41% 72 140394 0.41% 73 150178 0.44% 74 155014 0.46% 75 146686 0.43% 76 145997 0.43% 77 155159 0.46% 78 163687 0.48% 79 170137 0.50% 80 177566 0.52% 81 182809 0.54% 82 187849 0.56% 83 195851 0.58% 84 204347 0.60% 85 216341 0.64% 86 225733 0.67% 87 229337 0.68% 88 229054 0.68% 89 251062 0.74% 90 260827 0.77% 91 280695 0.83% 92 308063 0.91% 93 338695 1.00% 94 386962 1.14% 95 458636 1.36% 96 545608 1.61% 97 687049 2.03% 98 871220 2.58% 99 1092823 3.23% 100 22992130 67.96% 33833318 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=4.09 fanout-score-rank=16 prefix-density=0.49 prefix-fanout=3.4 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.08 sequence-density-rank=20 fanout-score=274.93 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=27.8 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=33 prefix-density=0.18 prefix-fanout=2.1 sequence=CTCCGATCCCGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=353.95 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=13.5 sequence=TCTTCTTGAAGACTTCTTGCTCATCCGCTTCCAGCTTGGGAGTCAGGTTCTTGATGTAGCGCTTAATGTAGGCGACAAACTGCTTCTTGTCAAAAGCAGGTTGCTCCTGAAGACGGAAGGTGTCAACAATGT ERR3317421 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:11:04 Started mapping on | Dec 10 09:11:04 Finished on | Dec 10 09:12:59 Mapping speed, Million of reads per hour | 1059.13 Number of input reads | 33833318 Average input read length | 189 UNIQUE READS: Uniquely mapped reads number | 30954425 Uniquely mapped reads % | 91.49% Average mapped length | 188.40 Number of splices: Total | 19459869 Number of splices: Annotated (sjdb) | 18515383 Number of splices: GT/AG | 19181633 Number of splices: GC/AG | 248052 Number of splices: AT/AC | 15681 Number of splices: Non-canonical | 14503 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.00% Deletion average length | 1.21 Insertion rate per base | 0.00% Insertion average length | 1.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1715512 % of reads mapped to multiple loci | 5.07% Number of reads mapped to too many loci | 59423 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.29% % of reads unmapped: other | 0.97% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1443864 1443864 1443864 N_multimapping 1715512 1715512 1715512 N_noFeature 1098662 2525318 28924756 N_ambiguous 875331 310037 16904 UnstrandedReadsAssigned:28980432 PositiveStrandReadsAssigned:28119070 NegativeStrandReadsAssigned:2012765 Dataset is classified positive stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 ERR3317421 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317421-trimmed-pair1.fastq ERR3317421-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,833,318 reads, 29,530,992 reads pseudoaligned [quant] estimated average fragment length: 184.382 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52973 ERR3317421.ke.tsv 35125 ERR3317421.se.tsv 88098 total ==> ERR3317421.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 752.837 0 0 PNS24247 1044 860.618 36.5523 2.20179 PNS24249 1928 1744.62 161.105 4.78719 PNS24246 1044 860.618 36.5523 2.20179 PNS24248 1044 860.618 36.5523 2.20179 PNS24244 1471 1287.62 242.238 9.75277 PNS24243 293 132.769 0 0 KQK14069 1603 1419.62 5460.06 199.388 KQK14071 474 296.135 63.9453 11.1942 ==> ERR3317421.se.tsv <== BRADI_1g14170v3 6397 BRADI_1g53295v3 88 BRADI_1g59795v3 722 BRADI_1g07683v3 0 BRADI_1g00485v3 84 BRADI_1g20270v3 2616 BRADI_1g74790v3 343 BRADI_1g09890v3 16 BRADI_1g77505v3 432 BRADI_1g48960v3 2 ERR3317421 completed mapping pipeline successfully