Starting /dee2/code/volunteer_pipeline.sh ERR3317422 current disk space = 1525513134080 free memory = 1530130200 ERR3317422 SRAfilesize 4fceedceacd6f91c92fd053bb3c24a61 ERR3317422.sra ERR3317422.sra file validated ERR3317422 is paired end ERR3317422 is conventional basespace ERR3317422 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317422_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.10525 33.0 31.0 34.0 30.0 34.0 2 32.4295 34.0 31.0 34.0 30.0 34.0 3 32.54825 34.0 31.0 34.0 31.0 34.0 4 36.105 37.0 35.0 37.0 35.0 37.0 5 35.5815 37.0 35.0 37.0 35.0 37.0 6 35.728 37.0 35.0 37.0 33.0 37.0 7 35.819 37.0 35.0 37.0 33.0 37.0 8 35.8105 37.0 35.0 37.0 35.0 37.0 9 37.42175 39.0 37.0 39.0 34.0 39.0 10-11 37.523375 39.0 37.0 39.0 35.0 39.0 12-13 37.525625 39.0 37.0 39.0 34.5 39.0 14-15 38.764125 40.0 38.0 41.0 34.5 41.0 16-17 38.7265 40.0 38.0 41.0 34.5 41.0 18-19 38.67775 40.0 38.0 41.0 34.0 41.0 20-21 38.6505 40.0 38.0 41.0 34.0 41.0 22-23 38.657875 40.0 38.0 41.0 34.0 41.0 24-25 38.582499999999996 40.0 38.0 41.0 34.0 41.0 26-27 38.45725 40.0 38.0 41.0 34.0 41.0 28-29 38.1525 40.0 37.5 41.0 33.5 41.0 30-31 38.12125 40.0 38.0 41.0 33.0 41.0 32-33 38.0985 40.0 38.0 41.0 33.5 41.0 34-35 37.832 40.0 37.0 41.0 33.0 41.0 36-37 37.722875 40.0 37.0 41.0 32.5 41.0 38-39 37.726124999999996 40.0 37.0 41.0 32.5 41.0 40-41 37.594875 40.0 36.5 41.0 32.5 41.0 42-43 37.4935 40.0 36.0 41.0 32.0 41.0 44-45 36.997375 39.0 35.5 41.0 30.5 41.0 46-47 37.185 39.0 35.5 41.0 31.5 41.0 48-49 37.22325 39.0 35.5 41.0 31.5 41.0 50-51 37.094750000000005 39.0 35.0 41.0 31.5 41.0 52-53 36.8845 39.0 35.0 41.0 31.0 41.0 54-55 36.543125 38.5 35.0 40.5 31.0 41.0 56-57 36.129125 38.0 35.0 40.0 30.0 41.0 58-59 36.063125 37.0 35.0 40.0 30.0 41.0 60-61 35.72925 37.0 34.0 40.0 30.0 41.0 62-63 35.413375 36.5 34.0 39.5 29.5 41.0 64-65 35.080625 36.0 34.0 39.0 29.0 41.0 66-67 34.798 35.5 34.0 39.0 29.0 41.0 68-69 34.536500000000004 35.0 34.0 38.0 29.0 40.0 70-71 34.216875 35.0 33.0 37.0 29.0 39.5 72-73 33.822500000000005 35.0 33.0 37.0 28.5 39.0 74-75 33.472750000000005 35.0 33.0 36.0 27.5 39.0 76-77 31.808500000000002 33.5 30.5 35.0 25.5 36.5 78-79 33.042125 35.0 33.0 35.0 28.0 37.0 80-81 33.0965 35.0 33.0 35.0 29.0 37.0 82-83 32.92375 35.0 33.0 35.0 28.5 36.0 84-85 32.649875 35.0 33.0 35.0 27.0 36.0 86-87 32.489000000000004 35.0 33.0 35.0 27.0 36.0 88-89 32.35175 35.0 33.0 35.0 27.0 35.5 90-91 32.22225 35.0 33.0 35.0 27.0 35.0 92-93 32.140125 35.0 33.0 35.0 27.0 35.0 94-95 31.903624999999998 35.0 33.0 35.0 27.0 35.0 96-97 31.72325 35.0 33.0 35.0 25.5 35.0 98-99 31.40425 35.0 32.0 35.0 25.0 35.0 100 30.22975 34.0 31.0 35.0 20.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 3.0 11 3.0 12 6.0 13 5.0 14 5.0 15 4.0 16 3.0 17 7.0 18 3.0 19 6.0 20 4.0 21 6.0 22 17.0 23 15.0 24 15.0 25 15.0 26 34.0 27 50.0 28 57.0 29 65.0 30 77.0 31 114.0 32 160.0 33 177.0 34 225.0 35 330.0 36 652.0 37 971.0 38 847.0 39 121.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.64838467317806 24.9686952166291 19.434009516654143 27.948910593538695 2 24.8 25.25 19.525000000000002 30.425 3 25.025 24.925 20.075000000000003 29.975 4 25.7 26.125 17.424999999999997 30.75 5 27.89167299417869 24.702606934953174 18.096684383700328 29.309035687167807 6 27.6 27.675 20.0 24.725 7 28.749999999999996 23.375 23.425 24.45 8 30.55 25.35 25.724999999999998 18.375 9 30.625000000000004 28.499999999999996 24.175 16.7 10-11 31.825 26.55 22.912499999999998 18.712500000000002 12-13 29.275000000000002 27.037499999999998 23.925 19.7625 14-15 27.6375 26.5 23.974999999999998 21.8875 16-17 26.8125 25.05 25.412499999999998 22.725 18-19 25.6 26.487500000000004 25.825 22.0875 20-21 24.8125 26.400000000000002 25.5125 23.275000000000002 22-23 25.4 25.1875 25.587500000000002 23.825 24-25 24.8125 25.7125 26.2125 23.2625 26-27 24.8 26.887499999999996 25.7875 22.525000000000002 28-29 26.187500000000004 26.2625 24.275 23.275000000000002 30-31 25.2875 26.375 25.5375 22.8 32-33 25.55 26.400000000000002 24.95 23.1 34-35 25.162499999999998 26.3125 24.962500000000002 23.5625 36-37 25.275 26.5875 25.4375 22.7 38-39 24.9375 26.7625 25.15 23.150000000000002 40-41 26.187500000000004 26.325 24.637500000000003 22.85 42-43 25.7625 26.487500000000004 25.337500000000002 22.412499999999998 44-45 24.975 27.462500000000002 24.925 22.6375 46-47 26.187500000000004 26.0125 24.762500000000003 23.0375 48-49 25.45 27.1 25.2625 22.1875 50-51 25.4 26.487500000000004 24.8625 23.25 52-53 26.137500000000003 25.7625 24.587500000000002 23.5125 54-55 25.15 27.462500000000002 25.2375 22.15 56-57 25.662499999999998 26.1125 24.875 23.35 58-59 25.5125 26.950000000000003 24.65 22.8875 60-61 25.45 26.337500000000002 25.887500000000003 22.325 62-63 24.4125 27.4125 24.9 23.275000000000002 64-65 25.6 26.275 25.8625 22.2625 66-67 26.200000000000003 26.0125 25.2875 22.5 68-69 24.7 27.6625 24.6 23.0375 70-71 25.587500000000002 27.025 24.425 22.9625 72-73 25.474999999999998 26.5 25.337500000000002 22.6875 74-75 25.362499999999997 26.55 24.25 23.8375 76-77 26.0 26.2625 24.337500000000002 23.400000000000002 78-79 24.9 27.2625 25.337500000000002 22.5 80-81 25.25 27.0875 24.525 23.1375 82-83 24.762500000000003 26.8 24.3875 24.05 84-85 25.6125 27.712500000000002 24.075 22.6 86-87 26.087500000000002 27.35 24.65 21.912499999999998 88-89 26.075 26.3125 24.462500000000002 23.150000000000002 90-91 25.2375 26.9125 25.0375 22.8125 92-93 25.1875 27.0625 24.85 22.900000000000002 94-95 24.887500000000003 27.6 23.9125 23.599999999999998 96-97 25.2125 26.775 24.962500000000002 23.05 98-99 24.9 27.3625 24.837500000000002 22.900000000000002 100 25.575 26.974999999999998 24.425 23.025000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 2.5 6 2.0 7 0.0 8 0.0 9 0.0 10 1.5 11 2.0 12 1.5 13 2.0 14 1.5 15 1.0 16 0.5 17 1.5 18 2.0 19 1.0 20 1.5 21 2.0 22 2.0 23 2.0 24 2.5 25 3.5 26 4.0 27 4.5 28 6.0 29 10.0 30 14.0 31 18.0 32 19.5 33 18.0 34 22.0 35 37.5 36 54.0 37 60.5 38 78.0 39 90.5 40 101.0 41 133.0 42 160.5 43 186.5 44 218.5 45 221.0 46 193.5 47 193.0 48 197.0 49 183.5 50 170.5 51 155.0 52 133.0 53 121.0 54 119.0 55 107.0 56 91.0 57 85.0 58 77.5 59 68.0 60 71.0 61 60.0 62 51.5 63 47.0 64 38.5 65 41.0 66 41.5 67 41.0 68 40.5 69 30.5 70 26.5 71 29.0 72 27.5 73 20.0 74 13.0 75 8.5 76 7.0 77 7.0 78 4.5 79 3.5 80 1.5 81 1.0 82 1.5 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 1.225 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.275 #Duplication Level Percentage of deduplicated Percentage of total 1 98.65174255914525 96.95 2 1.0684304248282879 2.1 3 0.2035105571101501 0.6 4 0.02543881963876876 0.1 5 0.05087763927753752 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATGCCAGCTCTGACCGAAATCTTTGGGGATGATTCTGTATTACAATTTGG 5 0.125 No Hit TGCTCGTGAAGGTAATGAAATTATCCGAGCAGCTTGCAAATGGAGTCCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.037500000000000006 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.0625 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1375 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.1875 0.0 0.0 0.0 0.0 36-37 0.225 0.0 0.0 0.0 0.0 38-39 0.275 0.0 0.0 0.0 0.0 40-41 0.38749999999999996 0.0 0.0 0.0 0.0 42-43 0.5125 0.0 0.0 0.0 0.0 44-45 0.6125 0.0 0.0 0.0 0.0 46-47 0.7749999999999999 0.0 0.0 0.0 0.0 48-49 0.9375 0.0 0.0 0.0 0.0 50-51 1.1375 0.0 0.0 0.0 0.0 52-53 1.2999999999999998 0.0 0.0 0.0 0.0 54-55 1.425 0.0 0.0 0.0 0.0 56-57 1.65 0.0 0.0 0.0 0.0 58-59 1.8250000000000002 0.0 0.0 0.0 0.0 60-61 2.0250000000000004 0.0 0.0 0.0 0.0 62-63 2.3499999999999996 0.0 0.0 0.0 0.0 64-65 2.7375 0.0 0.0 0.0 0.0 66-67 3.0375 0.0 0.0 0.0 0.0 68-69 3.4625000000000004 0.0 0.0 0.0 0.0 70-71 3.85 0.0 0.0 0.0 0.0 72-73 4.1875 0.0 0.0 0.0 0.0 74-75 4.525 0.0 0.0 0.0 0.0 76-77 5.0375 0.0 0.0 0.0 0.0 78-79 5.550000000000001 0.0 0.0 0.0 0.0 80-81 6.025 0.0 0.0 0.0 0.0 82-83 6.375 0.0 0.0 0.0 0.0 84-85 6.725 0.0 0.0 0.0 0.0 86-87 7.225 0.0 0.0 0.0 0.0 88 7.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317422 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317422_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.25375 33.0 31.0 34.0 30.0 34.0 2 31.125 33.0 31.0 34.0 27.0 34.0 3 30.89925 31.0 31.0 34.0 27.0 34.0 4 34.61875 37.0 35.0 37.0 32.0 37.0 5 34.82675 37.0 35.0 37.0 32.0 37.0 6 34.781 37.0 35.0 37.0 32.0 37.0 7 34.87225 37.0 35.0 37.0 32.0 37.0 8 34.97125 37.0 35.0 37.0 32.0 37.0 9 36.55125 39.0 37.0 39.0 32.0 39.0 10-11 36.652375000000006 39.0 37.0 39.0 32.5 39.0 12-13 36.50375 39.0 37.0 39.0 32.0 39.0 14-15 37.713875 40.0 38.0 41.0 32.5 41.0 16-17 37.586124999999996 40.0 37.5 41.0 32.0 41.0 18-19 37.56425 40.0 37.5 41.0 32.5 41.0 20-21 37.46525 40.0 37.5 41.0 32.0 41.0 22-23 37.375625 40.0 37.0 41.0 32.0 41.0 24-25 37.236625000000004 40.0 37.0 41.0 31.5 41.0 26-27 37.128875 40.0 37.0 41.0 31.5 41.0 28-29 36.988375 40.0 37.0 41.0 31.0 41.0 30-31 36.79375 40.0 36.0 41.0 30.5 41.0 32-33 36.55875 40.0 36.0 41.0 30.0 41.0 34-35 36.6625 40.0 36.0 41.0 30.0 41.0 36-37 36.43925 40.0 36.0 41.0 30.0 41.0 38-39 36.305625 39.5 35.5 41.0 29.5 41.0 40-41 36.300125 39.0 36.0 41.0 30.0 41.0 42-43 36.176875 39.0 35.5 41.0 29.0 41.0 44-45 36.13675 39.5 35.5 41.0 29.0 41.0 46-47 36.039 39.5 35.0 41.0 28.0 41.0 48-49 35.995374999999996 39.0 35.0 41.0 29.0 41.0 50-51 34.65075 38.0 33.5 40.0 26.5 40.5 52-53 34.8855 38.0 34.0 39.5 27.0 40.5 54-55 35.583875 39.0 35.0 40.5 28.0 41.0 56-57 35.367375 38.5 35.0 41.0 27.0 41.0 58-59 35.204499999999996 38.0 35.0 41.0 27.0 41.0 60-61 34.873000000000005 38.0 34.0 40.0 26.5 41.0 62-63 34.522125 37.0 34.0 40.0 26.0 41.0 64-65 33.93675 36.5 34.0 40.0 24.0 41.0 66-67 33.4405 36.0 34.0 39.0 22.5 41.0 68-69 32.613375 35.5 33.0 39.0 16.0 41.0 70-71 32.371875 35.0 33.0 38.5 17.5 40.5 72-73 31.988125000000004 35.0 32.0 37.5 11.0 40.0 74-75 32.0125 35.0 32.0 37.0 17.5 39.0 76-77 31.965249999999997 35.0 32.0 36.5 23.0 39.0 78-79 31.711375 35.0 32.0 36.0 20.5 38.5 80-81 31.28725 35.0 31.5 35.5 20.0 37.0 82-83 30.848125 35.0 31.5 35.0 18.0 37.0 84-85 30.739 35.0 31.0 35.0 18.0 36.5 86-87 30.4405 35.0 31.0 35.0 18.0 36.0 88-89 30.325875 35.0 31.0 35.0 16.5 36.0 90-91 29.9385 34.0 31.0 35.0 8.5 35.0 92-93 29.774 34.0 31.0 35.0 2.0 35.0 94-95 29.489125 34.0 31.0 35.0 2.0 35.0 96-97 29.210875 34.0 30.5 35.0 2.0 35.0 98-99 28.7545 34.0 30.0 35.0 2.0 35.0 100 27.52575 33.0 27.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 54.0 3 6.0 4 2.0 5 7.0 6 2.0 7 6.0 8 10.0 9 12.0 10 11.0 11 8.0 12 11.0 13 14.0 14 13.0 15 8.0 16 13.0 17 9.0 18 13.0 19 15.0 20 27.0 21 17.0 22 17.0 23 25.0 24 26.0 25 33.0 26 41.0 27 59.0 28 56.0 29 69.0 30 84.0 31 105.0 32 132.0 33 190.0 34 243.0 35 354.0 36 507.0 37 789.0 38 830.0 39 182.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.310684516291992 11.467542308663804 29.982318767365495 28.239454407678704 2 26.958059626073776 11.47043961596766 27.337038908539668 34.23446184941889 3 23.5918161151806 12.5536751704976 28.744632482950237 35.10987623137156 4 23.844405152816368 11.821166961353876 27.986865370042942 36.34756251578681 5 24.551654458196516 14.725940894165193 25.612528416266734 35.10987623137156 6 25.704934541792547 17.72406847935549 29.783484390735147 26.78751258811682 7 19.169811320754718 25.257861635220124 37.735849056603776 17.836477987421382 8 17.12345989439276 25.39602715614785 37.037968317827506 20.442544631631883 9 18.71698113207547 28.553459119496853 34.16352201257862 18.566037735849054 10-11 19.77856064418722 26.86210367388022 32.73779567186714 20.621540010065427 12-13 19.3735061013964 27.48773430620204 32.04176625990691 21.096993332494655 14-15 19.959728165114523 26.16410772715832 31.890259249937074 21.985904857790082 16-17 21.477101157523908 26.333668847508807 28.610971313538 23.57825868142929 18-19 19.984898061917946 27.384847722124338 29.813742763654673 22.816511452303047 20-21 20.440528634361232 26.557583385777217 29.50283196979232 23.499056010069225 22-23 21.193804306762374 24.959073164588844 29.291021281954414 24.55610124669437 24-25 21.510383889238515 25.953429830081813 29.263687853996224 23.27249842668345 26-27 20.988430583501007 25.691649899396378 28.848088531187123 24.471830985915492 28-29 21.623662680931403 24.75770925110132 28.52108244178729 25.09754562617999 30-31 20.89364380113279 25.94084329767149 29.578351164254247 23.58716173694147 32-33 22.078248836331614 26.091332243049443 27.764498679079132 24.065920241539818 34-35 22.0309161744376 25.373884629885634 26.856855598843786 25.73834359683298 36-37 21.706887883358473 26.432880844645553 27.966314731020613 23.893916540975365 38-39 21.713998492083437 25.345564212113597 27.85875848203066 25.081678813772307 40-41 21.655570908177367 25.637482728300466 27.38349453586233 25.32345182765984 42-43 21.02686417273412 26.67587245794627 27.95631433592769 24.340949033391915 44-45 21.577550246492226 26.58323852863102 26.709644798381998 25.129566426494755 46-47 21.887979861548143 26.154814348646948 26.70862177470107 25.248584015103837 48-49 22.314361100640784 26.18419399422038 26.85010679733635 24.651338107802488 50-51 21.969315895372233 26.647384305835008 26.798289738430586 24.585010060362173 52-53 22.528301886792455 25.270440251572328 26.993710691823896 25.207547169811324 54-55 21.20105753493642 26.979730580385247 28.742288807755255 23.076923076923077 56-57 21.72327044025157 26.0125786163522 27.119496855345908 25.144654088050316 58-59 22.28506787330317 25.553041729512316 27.300150829562593 24.86173956762192 60-61 21.98768689533861 25.631360723709008 27.93064455333585 24.450307827616534 62-63 22.917451941198642 26.51086819952255 26.334966704359847 24.23671315491896 64-65 21.796666242524495 26.072019340883063 27.369894388599057 24.761420027993385 66-67 21.890992835209826 27.162231320368473 27.085465711361312 23.86131013306039 68-69 22.810880829015545 26.308290155440417 26.61917098445596 24.261658031088082 70-71 21.591203104786548 26.028460543337644 27.102199223803364 25.278137128072448 72-73 23.241786447638603 25.474845995893226 27.258726899383984 24.02464065708419 74-75 23.247927656367747 25.68450138156242 26.02361215774931 25.04395880432052 76-77 24.246231155778894 25.025125628140703 25.917085427135678 24.811557788944725 78-79 22.564038171772978 25.95429432446007 26.65745856353591 24.824208940231042 80-81 22.953289804118533 26.3184329482672 26.87091913611251 23.85735811150176 82-83 22.825812956894378 25.270985631459542 26.607007814469373 25.296193597176707 84-85 24.4410952022105 25.62170308967596 25.68450138156242 24.252700326551118 86-87 24.208940231039676 25.791059768960324 25.288799598191865 24.711200401808135 88-89 24.205900816070308 24.97175141242938 26.779661016949152 24.042686754551163 90-91 23.819688598694125 26.079859367152185 26.45655449522853 23.643897538925163 92-93 24.183827222501257 25.3264691109995 27.109492717227525 23.380210949271724 94-95 23.84180790960452 25.649717514124294 26.239799121155055 24.268675455116135 96-97 25.069043434597038 25.94777805674115 25.94777805674115 23.035400451920662 98-99 23.69412355600201 26.10497237569061 26.49422400803616 23.70668006027122 100 24.686087393269716 24.937217478653942 26.167754897036666 24.208940231039676 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 44.0 1 28.5 2 10.0 3 4.5 4 3.0 5 4.5 6 4.0 7 2.5 8 2.0 9 1.5 10 1.0 11 1.5 12 2.5 13 1.5 14 2.0 15 3.0 16 1.5 17 1.0 18 2.0 19 1.5 20 2.5 21 4.0 22 1.5 23 2.0 24 5.0 25 8.5 26 8.0 27 6.5 28 10.0 29 14.0 30 17.5 31 19.5 32 25.5 33 35.0 34 38.0 35 44.0 36 61.0 37 76.0 38 91.0 39 124.0 40 147.5 41 161.0 42 189.5 43 213.5 44 213.0 45 195.5 46 193.5 47 188.0 48 171.0 49 161.5 50 144.5 51 147.0 52 147.0 53 113.5 54 88.0 55 85.0 56 80.0 57 75.0 58 73.5 59 57.0 60 50.5 61 48.5 62 43.0 63 41.0 64 32.0 65 30.0 66 33.5 67 33.0 68 27.5 69 17.0 70 16.0 71 17.0 72 10.0 73 10.0 74 14.5 75 9.5 76 4.5 77 3.5 78 3.5 79 3.5 80 3.0 81 3.0 82 2.0 83 1.5 84 0.5 85 0.0 86 0.5 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0250000000000001 2 1.05 3 1.0250000000000001 4 1.0250000000000001 5 1.0250000000000001 6 0.7000000000000001 7 0.625 8 0.575 9 0.625 10-11 0.65 12-13 0.6375 14-15 0.675 16-17 0.65 18-19 0.675 20-21 0.6875 22-23 0.7374999999999999 24-25 0.6875 26-27 0.6 28-29 0.6875 30-31 0.6875 32-33 0.6375 34-35 0.5375 36-37 0.5499999999999999 38-39 0.525 40-41 0.4875 42-43 0.42500000000000004 44-45 1.1125 46-47 0.6875 48-49 0.5125000000000001 50-51 0.6 52-53 0.625 54-55 0.7125 56-57 0.625 58-59 0.5499999999999999 60-61 0.5125000000000001 62-63 0.5125000000000001 64-65 1.7624999999999997 66-67 2.3 68-69 3.5000000000000004 70-71 3.375 72-73 2.6 74-75 0.475 76-77 0.5 78-79 0.44999999999999996 80-81 0.44999999999999996 82-83 0.8250000000000001 84-85 0.475 86-87 0.44999999999999996 88-89 0.43750000000000006 90-91 0.44999999999999996 92-93 0.44999999999999996 94-95 0.43750000000000006 96-97 0.42500000000000004 98-99 0.44999999999999996 100 0.44999999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36045024302891 97.1 2 0.38372985418265537 0.75 3 0.12790995139421849 0.375 4 0.051163980557687394 0.2 5 0.025581990278843697 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.051163980557687394 1.4500000000000002 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 42 1.05 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 16 0.4 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.037500000000000006 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.0625 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1375 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.1875 0.0 0.0 0.0 0.0 36-37 0.225 0.0 0.0 0.0 0.0 38-39 0.275 0.0 0.0 0.0 0.0 40-41 0.38749999999999996 0.0 0.0 0.0 0.0 42-43 0.5125 0.0 0.0 0.0 0.0 44-45 0.6125 0.0 0.0 0.0 0.0 46-47 0.7375 0.0 0.0 0.0 0.0 48-49 0.8875 0.0 0.0 0.0 0.0 50-51 1.0875 0.0 0.0 0.0 0.0 52-53 1.275 0.0 0.0 0.0 0.0 54-55 1.375 0.0 0.0 0.0 0.0 56-57 1.5875 0.0 0.0 0.0 0.0 58-59 1.75 0.0 0.0 0.0 0.0 60-61 1.9249999999999998 0.0 0.0 0.0 0.0 62-63 2.2375 0.0 0.0 0.0 0.0 64-65 2.6125 0.0 0.0 0.0 0.0 66-67 2.9125 0.0 0.0 0.0 0.0 68-69 3.325 0.0 0.0 0.0 0.0 70-71 3.7125000000000004 0.0 0.0 0.0 0.0 72-73 3.9875 0.0 0.0 0.0 0.0 74-75 4.325 0.0 0.0 0.0 0.0 76-77 4.8375 0.0 0.0 0.0 0.0 78-79 5.3 0.0 0.0 0.0 0.0 80-81 5.7375 0.0 0.0 0.0 0.0 82-83 6.012499999999999 0.0 0.0 0.0 0.0 84-85 6.35 0.0 0.0 0.0 0.0 86-87 6.85 0.0 0.0 0.0 0.0 88 7.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1838918 spots for ERR3317422.sra Written 1838918 spots for ERR3317422.sra Read 1838918 spots for ERR3317422.sra Written 1838918 spots for ERR3317422.sra Read 1838918 spots for ERR3317422.sra Written 1838918 spots for ERR3317422.sra Read 1838918 spots for ERR3317422.sra Written 1838918 spots for ERR3317422.sra Read 1838918 spots for ERR3317422.sra Written 1838918 spots for ERR3317422.sra Read 1838918 spots for ERR3317422.sra Written 1838918 spots for ERR3317422.sra Read 1838918 spots for ERR3317422.sra Written 1838918 spots for ERR3317422.sra Read 1838918 spots for ERR3317422.sra Written 1838918 spots for ERR3317422.sra Read 1838918 spots for ERR3317422.sra Written 1838918 spots for ERR3317422.sra Read 1838918 spots for ERR3317422.sra Written 1838918 spots for ERR3317422.sra Read 1838921 spots for ERR3317422.sra Written 1838921 spots for ERR3317422.sra Read 1838918 spots for ERR3317422.sra Written 1838918 spots for ERR3317422.sra Read 1838918 spots for ERR3317422.sra Written 1838918 spots for ERR3317422.sra Read 1838918 spots for ERR3317422.sra Written 1838918 spots for ERR3317422.sra Read 1838918 spots for ERR3317422.sra Written 1838918 spots for ERR3317422.sra Read 1838918 spots for ERR3317422.sra Written 1838918 spots for ERR3317422.sra Read 1838918 spots for ERR3317422.sra Written 1838918 spots for ERR3317422.sra Read 1838918 spots for ERR3317422.sra Written 1838918 spots for ERR3317422.sra Read 1838918 spots for ERR3317422.sra Written 1838918 spots for ERR3317422.sra Read 1838918 spots for ERR3317422.sra Written 1838918 spots for ERR3317422.sra SRR ids: ['ERR3317422.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w1dfsxu8 ERR3317422.sra spots: 36778363 blocks: [[1, 1838918], [1838919, 3677836], [3677837, 5516754], [5516755, 7355672], [7355673, 9194590], [9194591, 11033508], [11033509, 12872426], [12872427, 14711344], [14711345, 16550262], [16550263, 18389180], [18389181, 20228098], [20228099, 22067016], [22067017, 23905934], [23905935, 25744852], [25744853, 27583770], [27583771, 29422688], [29422689, 31261606], [31261607, 33100524], [33100525, 34939442], [34939443, 36778363]] ERR3317422 file size 9596612 ERR3317422 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317422 ERR3317422_1.fastq ERR3317422_2.fastq Input file: ERR3317422_1.fastq Paired file: ERR3317422_2.fastq trimmed: ERR3317422-trimmed-pair1.fastq, ERR3317422-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 08:58:55 2024 >> started Tue Dec 10 08:59:33 2024 >> done (38.062s) 36778363 read pairs processed; of these: 286781 ( 0.78%) short read pairs filtered out after trimming by size control 438004 ( 1.19%) empty read pairs filtered out after trimming by size control 36053578 (98.03%) read pairs available; of these: 11942971 (33.13%) trimmed read pairs available after processing 24110607 (66.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 554 0.00% 19 714 0.00% 20 973 0.00% 21 1244 0.00% 22 1688 0.00% 23 2471 0.01% 24 2981 0.01% 25 3627 0.01% 26 4235 0.01% 27 5035 0.01% 28 5694 0.02% 29 6675 0.02% 30 7735 0.02% 31 10056 0.03% 32 10421 0.03% 33 11506 0.03% 34 13936 0.04% 35 14427 0.04% 36 15998 0.04% 37 16714 0.05% 38 19411 0.05% 39 21235 0.06% 40 21914 0.06% 41 23810 0.07% 42 25615 0.07% 43 27534 0.08% 44 29324 0.08% 45 30999 0.09% 46 32739 0.09% 47 37082 0.10% 48 38028 0.11% 49 39512 0.11% 50 43660 0.12% 51 44410 0.12% 52 46226 0.13% 53 50115 0.14% 54 52916 0.15% 55 56557 0.16% 56 59543 0.17% 57 63147 0.18% 58 66626 0.18% 59 94989 0.26% 60 102264 0.28% 61 106227 0.29% 62 110879 0.31% 63 114802 0.32% 64 120901 0.34% 65 126791 0.35% 66 136299 0.38% 67 138458 0.38% 68 141532 0.39% 69 144533 0.40% 70 149651 0.42% 71 156329 0.43% 72 157954 0.44% 73 168172 0.47% 74 173052 0.48% 75 164521 0.46% 76 164383 0.46% 77 174067 0.48% 78 183303 0.51% 79 189466 0.53% 80 197880 0.55% 81 202920 0.56% 82 208439 0.58% 83 217130 0.60% 84 226128 0.63% 85 238872 0.66% 86 248591 0.69% 87 253492 0.70% 88 251962 0.70% 89 277076 0.77% 90 285349 0.79% 91 306288 0.85% 92 336871 0.93% 93 367880 1.02% 94 420942 1.17% 95 496858 1.38% 96 589279 1.63% 97 735311 2.04% 98 930772 2.58% 99 1165271 3.23% 100 24110607 66.87% 36053578 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=22 prefix-density=0.56 prefix-fanout=2.7 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.07 sequence-density-rank=25 fanout-score=181.21 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=22.5 sequence=GAAGAAGAAGAAA criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=23 prefix-density=0.20 prefix-fanout=2.1 sequence=CTCCGATCCCGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=130.35 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=5.5 sequence=CCTCCTTGTTGTACATCCCAGGGAGCTGCACGTTGGTGGGGGCATCCGCGATGTTCATCAGGGTGGCGTTAACCATCTGGTTGTTGACAGTGTACTGGGTGGTCCCGCCCATCCGACCCGCACCAGCGTCGAGATCGTTGATGAAGAGGCAGCACATCTTACCCTTCTTGATCAAGTCTGCGGCCTCACGGTACCGCTGCCTGATCAGCTTGGCTGGCTCTCCGGCGTTTCCGCTCTCCAGCTCTCCGGCACTCATCATGATTGGGTTGATGCCCATCTTGGCGAAGACAAGCTCACATTGGAAGGATTTTCCTTGACCCTTGCCTCCCCAGATACCCAAGATGAGTGGCACCTTGATGTTGG ERR3317422 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:00:07 Started mapping on | Dec 10 09:00:07 Finished on | Dec 10 09:02:07 Mapping speed, Million of reads per hour | 1081.61 Number of input reads | 36053578 Average input read length | 189 UNIQUE READS: Uniquely mapped reads number | 32628039 Uniquely mapped reads % | 90.50% Average mapped length | 187.70 Number of splices: Total | 20189161 Number of splices: Annotated (sjdb) | 19198938 Number of splices: GT/AG | 19904536 Number of splices: GC/AG | 255396 Number of splices: AT/AC | 13383 Number of splices: Non-canonical | 15846 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.00% Deletion average length | 1.21 Insertion rate per base | 0.00% Insertion average length | 1.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2127338 % of reads mapped to multiple loci | 5.90% Number of reads mapped to too many loci | 57516 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.47% % of reads unmapped: other | 0.98% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1606648 1606648 1606648 N_multimapping 2127338 2127338 2127338 N_noFeature 1203085 2818200 30353614 N_ambiguous 927921 303184 18217 UnstrandedReadsAssigned:30497033 PositiveStrandReadsAssigned:29506655 NegativeStrandReadsAssigned:2256208 Dataset is classified positive stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 ERR3317422 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317422-trimmed-pair1.fastq ERR3317422-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,053,578 reads, 31,210,971 reads pseudoaligned [quant] estimated average fragment length: 185.008 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,188 rounds 52973 ERR3317422.ke.tsv 35125 ERR3317422.se.tsv 88098 total ==> ERR3317422.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 752.188 0 0 PNS24247 1044 859.992 67.3425 3.88645 PNS24249 1928 1743.99 112.943 3.2142 PNS24246 1044 859.992 67.3425 3.88645 PNS24248 1044 859.992 67.3425 3.88645 PNS24244 1471 1286.99 286.029 11.0304 PNS24243 293 133.042 2 0.746102 KQK14069 1603 1418.99 9844.45 344.326 KQK14071 474 295.933 91.8871 15.4106 ==> ERR3317422.se.tsv <== BRADI_1g14170v3 12232 BRADI_1g53295v3 48 BRADI_1g59795v3 326 BRADI_1g07683v3 0 BRADI_1g00485v3 85 BRADI_1g20270v3 2604 BRADI_1g74790v3 744 BRADI_1g09890v3 4 BRADI_1g77505v3 345 BRADI_1g48960v3 0 ERR3317422 completed mapping pipeline successfully