Starting /dee2/code/volunteer_pipeline.sh ERR3317423 current disk space = 1525351727104 free memory = 1417883164 ERR3317423 SRAfilesize dd212431b74b08fa9401c8200c5322cc ERR3317423.sra ERR3317423.sra file validated ERR3317423 is paired end ERR3317423 is conventional basespace ERR3317423 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317423_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.089 33.0 31.0 34.0 30.0 34.0 2 32.373 34.0 31.0 34.0 30.0 34.0 3 32.44525 34.0 31.0 34.0 30.0 34.0 4 36.00675 37.0 35.0 37.0 35.0 37.0 5 35.66625 37.0 35.0 37.0 35.0 37.0 6 35.6995 37.0 35.0 37.0 33.0 37.0 7 35.78825 37.0 35.0 37.0 33.0 37.0 8 35.82075 37.0 35.0 37.0 33.0 37.0 9 37.50225 39.0 37.0 39.0 34.0 39.0 10-11 37.400000000000006 39.0 37.0 39.0 34.0 39.0 12-13 37.439875 39.0 37.0 39.0 34.0 39.0 14-15 38.63075 40.0 38.0 41.0 34.0 41.0 16-17 38.606125000000006 40.0 38.0 41.0 34.0 41.0 18-19 38.547 40.0 38.0 41.0 33.5 41.0 20-21 38.484750000000005 40.0 38.0 41.0 33.5 41.0 22-23 38.468625 40.0 38.0 41.0 34.0 41.0 24-25 38.3985 40.0 38.0 41.0 34.0 41.0 26-27 38.24125 40.0 38.0 41.0 33.0 41.0 28-29 37.965375 40.0 37.5 41.0 33.0 41.0 30-31 37.902125 40.0 37.0 41.0 32.5 41.0 32-33 37.922 40.0 37.0 41.0 33.0 41.0 34-35 37.580375000000004 40.0 37.0 41.0 31.5 41.0 36-37 37.618125 40.0 37.0 41.0 32.0 41.0 38-39 37.49825 40.0 36.5 41.0 32.0 41.0 40-41 37.396 39.5 36.0 41.0 31.5 41.0 42-43 37.23825 39.0 36.0 41.0 31.5 41.0 44-45 36.79925 39.0 35.0 41.0 30.5 41.0 46-47 36.8585 39.0 35.0 41.0 30.5 41.0 48-49 37.013125 39.0 35.0 41.0 31.0 41.0 50-51 36.68825 39.0 35.0 41.0 31.0 41.0 52-53 36.62875 38.5 35.0 41.0 31.0 41.0 54-55 36.1335 38.0 34.5 40.0 30.0 41.0 56-57 35.791125 37.5 34.0 40.0 29.5 41.0 58-59 35.777375 37.0 34.0 40.0 30.0 41.0 60-61 35.422375 36.5 34.0 40.0 29.5 41.0 62-63 35.0785 36.0 34.0 39.5 28.5 41.0 64-65 34.781625 36.0 34.0 39.0 28.0 41.0 66-67 34.509 35.0 34.0 39.0 28.0 40.5 68-69 34.33075 35.0 33.5 37.5 29.0 40.0 70-71 33.88975 35.0 33.0 37.0 28.0 39.5 72-73 33.4105 35.0 33.0 37.0 27.0 39.0 74-75 33.079 35.0 33.0 36.0 26.5 39.0 76-77 31.576875 33.5 30.5 35.0 25.0 37.0 78-79 32.733125 35.0 32.5 35.0 27.5 37.0 80-81 32.809375 35.0 33.0 35.0 28.0 37.0 82-83 32.537625000000006 35.0 33.0 35.0 27.0 36.0 84-85 32.2785 35.0 33.0 35.0 26.5 36.0 86-87 32.13225 35.0 33.0 35.0 27.0 36.0 88-89 32.053625 35.0 33.0 35.0 27.0 35.5 90-91 31.878999999999998 35.0 33.0 35.0 26.5 35.0 92-93 31.74575 35.0 33.0 35.0 26.0 35.0 94-95 31.507875 35.0 32.5 35.0 25.0 35.0 96-97 31.35025 35.0 32.0 35.0 25.0 35.0 98-99 30.957124999999998 34.5 32.0 35.0 24.0 35.0 100 29.83525 34.0 30.0 35.0 18.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 3.0 9 1.0 10 4.0 11 4.0 12 7.0 13 3.0 14 7.0 15 8.0 16 5.0 17 8.0 18 9.0 19 10.0 20 14.0 21 11.0 22 16.0 23 16.0 24 16.0 25 34.0 26 34.0 27 35.0 28 52.0 29 71.0 30 102.0 31 105.0 32 135.0 33 183.0 34 237.0 35 387.0 36 625.0 37 919.0 38 838.0 39 100.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 26.23279098873592 27.108886107634543 18.498122653316646 28.16020025031289 2 24.175 24.25 19.225 32.35 3 24.375 26.775 19.025 29.825000000000003 4 24.75 25.025 18.275 31.95 5 27.81841109709962 24.237074401008826 16.69609079445145 31.248423707440097 6 28.425 26.075 19.525000000000002 25.974999999999998 7 27.325 24.55 21.925 26.200000000000003 8 30.5 25.2 25.1 19.2 9 31.75 26.575 24.474999999999998 17.2 10-11 31.587500000000002 26.924999999999997 22.05 19.4375 12-13 28.0875 26.700000000000003 24.3 20.9125 14-15 28.1 25.224999999999998 24.725 21.95 16-17 25.874999999999996 25.362499999999997 24.9375 23.825 18-19 26.3625 26.174999999999997 25.4375 22.025 20-21 25.387500000000003 26.325 24.837500000000002 23.45 22-23 24.887500000000003 26.575 24.8 23.7375 24-25 24.587500000000002 25.637500000000003 26.35 23.425 26-27 25.2875 26.5375 25.337500000000002 22.8375 28-29 25.7625 26.650000000000002 23.549999999999997 24.0375 30-31 25.7375 26.687499999999996 24.6625 22.912499999999998 32-33 26.075 25.674999999999997 25.85 22.400000000000002 34-35 24.9125 25.624999999999996 24.25 25.2125 36-37 24.9125 26.387500000000003 25.2 23.5 38-39 24.875 27.3125 25.0 22.8125 40-41 25.45 25.912499999999998 25.087500000000002 23.549999999999997 42-43 26.5 25.874999999999996 24.4375 23.1875 44-45 25.75 26.4625 25.0125 22.775000000000002 46-47 25.374999999999996 25.4625 24.887500000000003 24.275 48-49 25.337500000000002 26.35 25.4 22.912499999999998 50-51 25.1875 26.75 25.025 23.0375 52-53 25.650000000000002 25.624999999999996 25.087500000000002 23.6375 54-55 24.9375 27.437499999999996 24.5375 23.0875 56-57 25.087500000000002 26.0125 25.4875 23.4125 58-59 25.5125 26.337500000000002 24.2 23.95 60-61 24.075 26.6625 26.025 23.2375 62-63 26.0 26.325 25.174999999999997 22.5 64-65 25.525 26.674999999999997 23.7125 24.087500000000002 66-67 24.775 26.187500000000004 25.575 23.4625 68-69 25.5125 27.200000000000003 23.875 23.4125 70-71 25.362499999999997 28.1625 22.9625 23.5125 72-73 25.637500000000003 27.1125 24.0 23.25 74-75 25.5 27.075 24.1875 23.2375 76-77 26.0375 26.2625 24.15 23.549999999999997 78-79 25.424999999999997 26.950000000000003 24.375 23.25 80-81 25.55 27.3375 24.3875 22.725 82-83 26.200000000000003 26.2625 24.3875 23.150000000000002 84-85 25.2125 27.4125 24.925 22.45 86-87 24.962500000000002 27.0625 24.525 23.45 88-89 26.3625 26.437500000000004 23.95 23.25 90-91 26.1 27.200000000000003 24.0125 22.6875 92-93 26.174999999999997 27.224999999999998 23.5375 23.0625 94-95 25.650000000000002 28.15 22.925 23.275000000000002 96-97 25.2125 26.825 24.3 23.6625 98-99 24.6875 27.187499999999996 25.0 23.125 100 25.95 26.875 24.45 22.725 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 1.0 7 1.0 8 1.0 9 1.0 10 0.0 11 0.0 12 1.0 13 2.0 14 1.5 15 1.0 16 0.5 17 2.5 18 4.5 19 4.0 20 5.0 21 4.0 22 2.5 23 3.0 24 4.0 25 5.5 26 5.5 27 5.0 28 5.0 29 7.0 30 9.0 31 13.5 32 20.0 33 24.5 34 28.0 35 29.0 36 40.5 37 58.0 38 72.0 39 89.0 40 107.0 41 138.5 42 167.0 43 171.5 44 182.0 45 191.0 46 189.5 47 194.5 48 204.0 49 201.0 50 166.5 51 147.0 52 142.5 53 120.0 54 111.5 55 104.5 56 88.5 57 82.0 58 88.0 59 84.5 60 66.5 61 64.0 62 59.0 63 53.5 64 52.0 65 42.0 66 37.5 67 42.5 68 38.5 69 30.5 70 29.0 71 26.0 72 25.5 73 22.0 74 18.5 75 12.5 76 8.5 77 9.0 78 7.5 79 5.0 80 3.0 81 4.0 82 4.5 83 3.0 84 1.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.8750000000000001 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.95 #Duplication Level Percentage of deduplicated Percentage of total 1 98.36651352730985 96.35000000000001 2 1.3527309851965288 2.65 3 0.20418580908626852 0.6 4 0.025523226135783564 0.1 5 0.025523226135783564 0.125 6 0.0 0.0 7 0.025523226135783564 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTTAACTGGGGGATTCACCGCAAATACTACTTTGGCTCATTATTGCCGC 7 0.17500000000000002 No Hit ATGCCAGCTCTGACCGAAATCTTTGGGGATGATTCTGTATTACAATTTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.0625 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.16249999999999998 0.0 0.0 0.0 0.0 36-37 0.175 0.0 0.0 0.0 0.0 38-39 0.175 0.0 0.0 0.0 0.0 40-41 0.25 0.0 0.0 0.0 0.0 42-43 0.325 0.0 0.0 0.0 0.0 44-45 0.45 0.0 0.0 0.0 0.0 46-47 0.6375 0.0 0.0 0.0 0.0 48-49 0.775 0.0 0.0 0.0 0.0 50-51 0.8374999999999999 0.0 0.0 0.0 0.0 52-53 0.9624999999999999 0.0 0.0 0.0 0.0 54-55 1.175 0.0 0.0 0.0 0.0 56-57 1.3375 0.0 0.0 0.0 0.0 58-59 1.5375 0.0 0.0 0.0 0.0 60-61 1.7875 0.0 0.0 0.0 0.0 62-63 1.9625 0.0 0.0 0.0 0.0 64-65 2.125 0.0 0.0 0.0 0.0 66-67 2.3375 0.0 0.0 0.0 0.0 68-69 2.6125 0.0 0.0 0.0 0.0 70-71 2.9375 0.0 0.0 0.0 0.0 72-73 3.275 0.0 0.0 0.0 0.0 74-75 3.575 0.0 0.0 0.0 0.0 76-77 3.9375 0.0 0.0 0.0 0.0 78-79 4.2875 0.0 0.0 0.0 0.0 80-81 4.7375 0.0 0.0 0.0 0.0 82-83 5.1625 0.0 0.0 0.0 0.0 84-85 5.6 0.0 0.0 0.0 0.0 86-87 6.137499999999999 0.0 0.0 0.0 0.0 88 6.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317423 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317423_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.15875 31.0 31.0 34.0 28.0 34.0 2 31.09525 33.0 31.0 34.0 27.0 34.0 3 30.78825 31.0 31.0 34.0 27.0 34.0 4 34.62 37.0 35.0 37.0 32.0 37.0 5 34.83475 37.0 35.0 37.0 32.0 37.0 6 34.7185 37.0 35.0 37.0 32.0 37.0 7 34.881 37.0 35.0 37.0 32.0 37.0 8 34.90025 37.0 35.0 37.0 32.0 37.0 9 36.5125 39.0 37.0 39.0 32.0 39.0 10-11 36.576875 39.0 37.0 39.0 32.5 39.0 12-13 36.434 39.0 37.0 39.0 32.0 39.0 14-15 37.5035 40.0 37.5 41.0 32.0 41.0 16-17 37.429875 40.0 37.5 41.0 32.0 41.0 18-19 37.361625000000004 40.0 37.0 41.0 31.5 41.0 20-21 37.351375000000004 40.0 37.0 41.0 32.0 41.0 22-23 37.185125 40.0 37.0 41.0 31.0 41.0 24-25 37.00675 40.0 36.5 41.0 30.5 41.0 26-27 36.939875 40.0 36.5 41.0 31.0 41.0 28-29 36.792874999999995 40.0 36.0 41.0 30.0 41.0 30-31 36.667625 40.0 36.0 41.0 30.0 41.0 32-33 36.486000000000004 39.0 36.0 41.0 30.0 41.0 34-35 36.35525 39.0 36.0 41.0 30.0 41.0 36-37 36.168125 39.0 35.0 41.0 29.0 41.0 38-39 35.956500000000005 39.0 35.0 41.0 28.0 41.0 40-41 35.948375 39.0 35.0 41.0 28.5 41.0 42-43 35.97125 39.0 35.0 41.0 28.5 41.0 44-45 35.893375 39.0 35.0 41.0 28.0 41.0 46-47 35.615125 39.0 35.0 41.0 26.5 41.0 48-49 35.625125 39.0 35.0 41.0 27.0 41.0 50-51 34.256125 37.5 33.5 40.0 25.0 40.5 52-53 34.476625 37.5 33.5 39.5 26.0 40.5 54-55 35.114375 38.0 35.0 40.5 26.5 41.0 56-57 34.980375 38.0 34.0 41.0 26.0 41.0 58-59 34.84 38.0 34.0 40.0 26.0 41.0 60-61 34.5505 37.5 34.0 40.0 26.0 41.0 62-63 34.15425 37.0 34.0 40.0 25.5 41.0 64-65 33.708875000000006 36.5 34.0 40.0 23.5 41.0 66-67 33.309375 36.0 33.0 39.0 22.0 41.0 68-69 32.478 35.0 33.0 39.0 16.5 41.0 70-71 32.220875 35.0 32.5 38.5 16.5 40.5 72-73 31.775125000000003 35.0 32.0 37.0 10.0 39.5 74-75 31.669625 35.0 32.0 37.0 17.0 39.0 76-77 31.499125 35.0 31.0 36.0 20.0 39.0 78-79 31.319625000000002 35.0 32.0 36.0 19.0 37.5 80-81 30.85875 35.0 31.0 35.5 16.5 37.0 82-83 30.43675 35.0 31.0 35.0 11.5 37.0 84-85 30.3245 35.0 31.0 35.0 12.0 36.0 86-87 30.065125000000002 34.5 31.0 35.0 7.0 36.0 88-89 29.822499999999998 34.5 30.5 35.0 3.5 36.0 90-91 29.453125 34.0 30.0 35.0 2.0 35.0 92-93 29.2945 34.0 30.0 35.0 2.0 35.0 94-95 29.065375 34.0 30.0 35.0 2.0 35.0 96-97 28.766375 34.0 30.0 35.0 2.0 35.0 98-99 28.299875 34.0 29.0 35.0 2.0 35.0 100 26.89725 33.0 25.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 47.0 3 6.0 4 2.0 5 3.0 6 7.0 7 8.0 8 4.0 9 12.0 10 14.0 11 17.0 12 15.0 13 10.0 14 12.0 15 21.0 16 24.0 17 18.0 18 16.0 19 17.0 20 20.0 21 18.0 22 27.0 23 30.0 24 17.0 25 43.0 26 58.0 27 42.0 28 54.0 29 69.0 30 84.0 31 122.0 32 147.0 33 194.0 34 263.0 35 353.0 36 463.0 37 740.0 38 860.0 39 143.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.457755359394707 11.551071878940732 30.390920554854983 28.600252206809586 2 27.529649255614437 11.758768609639162 25.359576078728235 35.35200605601817 3 23.2476046394352 12.632375189107414 30.358043368633385 33.76197680282401 4 24.363177805800756 11.273644388398486 27.994955863808325 36.36822194199244 5 26.759142496847417 14.300126103404793 23.581336696090794 35.359394703656996 6 25.289089994972347 18.275515334338863 30.46757164404223 25.96782302664656 7 18.828557063851182 23.981900452488688 39.3413775766717 17.848164906988437 8 19.85423473234481 23.950741392309627 36.69263634078914 19.50238753455642 9 18.85369532428356 28.104575163398692 33.4841628959276 19.557566616390147 10-11 20.336852689793865 26.31975867269985 32.64203117144294 20.701357466063346 12-13 19.77124183006536 26.747109100050277 31.988436400201103 21.49321266968326 14-15 21.09100050276521 25.314228255404725 30.266465560583207 23.328305681246857 16-17 21.20412267471091 25.62845651080945 29.675716440422324 23.491704374057313 18-19 20.915032679738562 26.508295625942687 28.934137757667173 23.64253393665158 20-21 20.81971335177269 25.119436761377923 30.274075936635654 23.78677395021373 22-23 21.625361680714555 23.801736067429864 29.727009686753053 24.845892565102528 24-25 21.599195373397034 26.288659793814436 29.25572039225547 22.856424440533065 26-27 22.360482654600304 25.804424333836103 26.759678230266466 25.075414781297134 28-29 21.62162162162162 25.45568824638592 27.0144563167819 25.908233815210558 30-31 21.697045883092393 25.279698302954117 28.598365807668134 24.424890006285356 32-33 22.29763700351936 25.716440422322773 27.727501256913023 24.258421317244846 34-35 21.72110552763819 24.912060301507537 27.70100502512563 25.66582914572864 36-37 21.809045226130653 26.394472361809047 27.66331658291457 24.133165829145728 38-39 22.416174808489263 25.367323872912216 27.514755745322116 24.701745573276405 40-41 22.867536377320622 24.03411941796287 27.822378324134473 25.275965880582035 42-43 22.624717974429682 25.908749059914765 27.325144146402607 24.141388819252946 44-45 23.727959697733 25.52896725440806 26.54911838790932 24.193954659949622 46-47 22.07987942727958 25.709620698317003 27.279577995478522 24.930921878924895 48-49 22.31705786368771 26.371281536337392 27.312664742061 23.998995857913894 50-51 23.479135243841124 25.703871292106584 26.684263448969332 24.132730015082956 52-53 22.76269482151835 24.849170437405732 26.82252388134741 25.565610859728505 54-55 21.382778126964176 26.046511627906977 28.812067881835326 23.758642363293525 56-57 22.511312217194572 24.899446958270488 28.456510809451984 24.132730015082956 58-59 22.701005025125628 24.673366834170853 27.298994974874375 25.326633165829143 60-61 22.240341194179628 25.15052684395384 27.92272955343703 24.686402408429505 62-63 23.186951066499372 25.62107904642409 27.340025094102888 23.85194479297365 64-65 23.29113924050633 23.87341772151899 26.987341772151897 25.848101265822788 66-67 22.515883100381195 26.11181702668361 26.67090216010165 24.701397712833543 68-69 22.923886535746373 26.33808240277243 26.466435630856118 24.27159543062508 70-71 23.01678841471229 25.0160194796873 26.24631551967192 25.720876585928487 72-73 22.559652928416483 25.890008931989282 26.96184764578283 24.588490493811406 74-75 23.367180644352516 25.347875141030464 26.914880280807317 24.370063933809703 76-77 23.707977922729555 25.062719518314097 26.317109884596086 24.912192674360263 78-79 23.166603986461077 25.2099786887301 26.96502444528018 24.658392879528645 80-81 24.15695123480005 25.59859596339476 26.23793406042372 24.006518741381473 82-83 24.09502262443439 24.258421317244846 26.09351432880845 25.553041729512316 84-85 23.510971786833856 26.144200626959247 26.294670846394986 24.05015673981191 86-87 24.934185784129372 24.583176632819356 26.012285320295852 24.47035226275542 88-89 24.219631440391122 25.272658894321175 25.7991726212862 24.708537044001506 90-91 24.116319879669092 26.72348959639007 25.36976685886187 23.790423665078965 92-93 24.555026322386563 25.745800952619703 25.532714966156934 24.166457758836803 94-95 24.918525946352467 25.18174981198295 25.444973677613437 24.454750564051142 96-97 24.066182000501378 26.034093757834043 26.34745550263224 23.55226873903234 98-99 25.288365095285858 26.015546639919755 24.536108324974926 24.159979939819458 100 24.523570712136408 25.877632898696092 25.67703109327984 23.921765295887663 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 29.0 1 21.0 2 10.0 3 5.5 4 5.0 5 5.0 6 3.5 7 4.5 8 4.5 9 3.0 10 2.0 11 1.0 12 1.0 13 1.0 14 3.0 15 4.0 16 3.5 17 3.0 18 1.0 19 2.0 20 3.5 21 2.0 22 1.5 23 3.0 24 6.5 25 8.0 26 6.5 27 8.5 28 10.5 29 11.0 30 11.5 31 18.5 32 29.0 33 33.0 34 35.0 35 46.0 36 62.0 37 73.5 38 87.5 39 104.0 40 125.0 41 157.0 42 179.5 43 194.5 44 213.0 45 204.5 46 187.5 47 189.0 48 169.5 49 147.5 50 141.5 51 146.0 52 135.5 53 105.5 54 101.0 55 104.5 56 91.0 57 72.0 58 66.0 59 61.0 60 52.5 61 51.5 62 54.0 63 48.0 64 44.5 65 38.0 66 31.5 67 29.5 68 28.0 69 25.5 70 23.0 71 21.0 72 16.0 73 13.5 74 11.0 75 10.0 76 11.0 77 9.5 78 7.0 79 6.5 80 3.0 81 2.0 82 3.0 83 2.5 84 1.5 85 0.5 86 0.5 87 0.5 88 0.5 89 1.0 90 0.5 91 0.0 92 0.0 93 0.5 94 0.5 95 0.5 96 0.5 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8750000000000001 2 0.9249999999999999 3 0.8500000000000001 4 0.8750000000000001 5 0.8750000000000001 6 0.5499999999999999 7 0.5499999999999999 8 0.525 9 0.5499999999999999 10-11 0.5499999999999999 12-13 0.5499999999999999 14-15 0.5499999999999999 16-17 0.5499999999999999 18-19 0.5499999999999999 20-21 0.575 22-23 0.6375 24-25 0.575 26-27 0.5499999999999999 28-29 0.5625 30-31 0.5625 32-33 0.5499999999999999 34-35 0.5 36-37 0.5 38-39 0.46249999999999997 40-41 0.35000000000000003 42-43 0.27499999999999997 44-45 0.75 46-47 0.475 48-49 0.41250000000000003 50-51 0.5499999999999999 52-53 0.5499999999999999 54-55 0.5625 56-57 0.5499999999999999 58-59 0.5 60-61 0.35000000000000003 62-63 0.375 64-65 1.25 66-67 1.625 68-69 2.6125 70-71 2.4625 72-73 2.0375 74-75 0.2875 76-77 0.35000000000000003 78-79 0.2875 80-81 0.2875 82-83 0.5499999999999999 84-85 0.3125 86-87 0.2875 88-89 0.2875 90-91 0.27499999999999997 92-93 0.27499999999999997 94-95 0.27499999999999997 96-97 0.27499999999999997 98-99 0.3 100 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.10485933503837 96.875 2 0.6649616368286445 1.3 3 0.1278772378516624 0.375 4 0.0 0.0 5 0.025575447570332477 0.125 6 0.0 0.0 7 0.025575447570332477 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.051150895140664954 1.15 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 35 0.8750000000000001 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 11 0.27499999999999997 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 7 0.17500000000000002 No Hit TTTTTCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.0625 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.16249999999999998 0.0 0.0 0.0 0.0 36-37 0.175 0.0 0.0 0.0 0.0 38-39 0.175 0.0 0.0 0.0 0.0 40-41 0.23750000000000002 0.0 0.0 0.0 0.0 42-43 0.3 0.0 0.0 0.0 0.0 44-45 0.425 0.0 0.0 0.0 0.0 46-47 0.575 0.0 0.0 0.0 0.0 48-49 0.7 0.0 0.0 0.0 0.0 50-51 0.7625 0.0 0.0 0.0 0.0 52-53 0.8625 0.0 0.0 0.0 0.0 54-55 1.05 0.0 0.0 0.0 0.0 56-57 1.1875 0.0 0.0 0.0 0.0 58-59 1.375 0.0 0.0 0.0 0.0 60-61 1.5875 0.0 0.0 0.0 0.0 62-63 1.7625000000000002 0.0 0.0 0.0 0.0 64-65 1.9375 0.0 0.0 0.0 0.0 66-67 2.1375 0.0 0.0 0.0 0.0 68-69 2.4125 0.0 0.0 0.0 0.0 70-71 2.725 0.0 0.0 0.0 0.0 72-73 3.0375 0.0 0.0 0.0 0.0 74-75 3.35 0.0 0.0 0.0 0.0 76-77 3.7125000000000004 0.0 0.0 0.0 0.0 78-79 4.05 0.0 0.0 0.0 0.0 80-81 4.4625 0.0 0.0 0.0 0.0 82-83 4.85 0.0 0.0 0.0 0.0 84-85 5.3125 0.0 0.0 0.0 0.0 86-87 5.862500000000001 0.0 0.0 0.0 0.0 88 6.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1695301 spots for ERR3317423.sra Written 1695301 spots for ERR3317423.sra Read 1695301 spots for ERR3317423.sra Written 1695301 spots for ERR3317423.sra Read 1695301 spots for ERR3317423.sra Written 1695301 spots for ERR3317423.sra Read 1695301 spots for ERR3317423.sra Written 1695301 spots for ERR3317423.sra Read 1695301 spots for ERR3317423.sra Written 1695301 spots for ERR3317423.sra Read 1695301 spots for ERR3317423.sra Written 1695301 spots for ERR3317423.sra Read 1695301 spots for ERR3317423.sra Written 1695301 spots for ERR3317423.sra Read 1695301 spots for ERR3317423.sra Written 1695301 spots for ERR3317423.sra Read 1695301 spots for ERR3317423.sra Written 1695301 spots for ERR3317423.sra Read 1695301 spots for ERR3317423.sra Written 1695301 spots for ERR3317423.sra Read 1695301 spots for ERR3317423.sra Written 1695301 spots for ERR3317423.sra Read 1695318 spots for ERR3317423.sra Written 1695318 spots for ERR3317423.sra Read 1695301 spots for ERR3317423.sra Written 1695301 spots for ERR3317423.sra Read 1695301 spots for ERR3317423.sra Written 1695301 spots for ERR3317423.sra Read 1695301 spots for ERR3317423.sra Written 1695301 spots for ERR3317423.sra Read 1695301 spots for ERR3317423.sra Written 1695301 spots for ERR3317423.sra Read 1695301 spots for ERR3317423.sra Written 1695301 spots for ERR3317423.sra Read 1695301 spots for ERR3317423.sra Written 1695301 spots for ERR3317423.sra Read 1695301 spots for ERR3317423.sra Written 1695301 spots for ERR3317423.sra Read 1695301 spots for ERR3317423.sra Written 1695301 spots for ERR3317423.sra SRR ids: ['ERR3317423.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_96724jrz ERR3317423.sra spots: 33906037 blocks: [[1, 1695301], [1695302, 3390602], [3390603, 5085903], [5085904, 6781204], [6781205, 8476505], [8476506, 10171806], [10171807, 11867107], [11867108, 13562408], [13562409, 15257709], [15257710, 16953010], [16953011, 18648311], [18648312, 20343612], [20343613, 22038913], [22038914, 23734214], [23734215, 25429515], [25429516, 27124816], [27124817, 28820117], [28820118, 30515418], [30515419, 32210719], [32210720, 33906037]] ERR3317423 file size 8846321 ERR3317423 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317423 ERR3317423_1.fastq ERR3317423_2.fastq Input file: ERR3317423_1.fastq Paired file: ERR3317423_2.fastq trimmed: ERR3317423-trimmed-pair1.fastq, ERR3317423-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:13:36 2024 >> started Tue Dec 10 09:14:57 2024 >> done (80.451s) 33906037 read pairs processed; of these: 268734 ( 0.79%) short read pairs filtered out after trimming by size control 406873 ( 1.20%) empty read pairs filtered out after trimming by size control 33230430 (98.01%) read pairs available; of these: 10782791 (32.45%) trimmed read pairs available after processing 22447639 (67.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 381 0.00% 19 468 0.00% 20 684 0.00% 21 851 0.00% 22 1210 0.00% 23 1786 0.01% 24 2074 0.01% 25 2677 0.01% 26 3117 0.01% 27 3524 0.01% 28 4242 0.01% 29 5091 0.02% 30 5937 0.02% 31 7884 0.02% 32 7603 0.02% 33 8703 0.03% 34 10834 0.03% 35 10611 0.03% 36 12071 0.04% 37 12882 0.04% 38 14787 0.04% 39 15433 0.05% 40 16827 0.05% 41 18530 0.06% 42 19456 0.06% 43 20933 0.06% 44 22893 0.07% 45 23885 0.07% 46 25558 0.08% 47 28411 0.09% 48 29828 0.09% 49 31023 0.09% 50 35080 0.11% 51 34606 0.10% 52 36549 0.11% 53 39363 0.12% 54 41298 0.12% 55 45443 0.14% 56 48261 0.15% 57 51894 0.16% 58 54075 0.16% 59 79495 0.24% 60 86488 0.26% 61 89952 0.27% 62 95366 0.29% 63 98004 0.29% 64 105075 0.32% 65 109994 0.33% 66 120059 0.36% 67 120449 0.36% 68 122926 0.37% 69 125862 0.38% 70 130353 0.39% 71 136696 0.41% 72 138545 0.42% 73 148214 0.45% 74 152786 0.46% 75 144821 0.44% 76 142938 0.43% 77 151746 0.46% 78 160681 0.48% 79 167789 0.50% 80 176267 0.53% 81 180905 0.54% 82 186239 0.56% 83 194817 0.59% 84 202996 0.61% 85 218208 0.66% 86 227051 0.68% 87 229973 0.69% 88 229299 0.69% 89 252973 0.76% 90 259918 0.78% 91 281430 0.85% 92 311712 0.94% 93 342253 1.03% 94 392197 1.18% 95 469292 1.41% 96 556989 1.68% 97 695656 2.09% 98 884064 2.66% 99 1105550 3.33% 100 22447639 67.55% 33230430 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.87 fanout-score-rank=20 prefix-density=0.68 prefix-fanout=2.6 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=92.47 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=12.4 sequence=GCCGCCGCCGCCA criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=27 prefix-density=0.31 prefix-fanout=2.1 sequence=CTCCGATCCCGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=72.78 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.1 sequence=ATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGG ERR3317423 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:15:48 Started mapping on | Dec 10 09:15:49 Finished on | Dec 10 09:18:35 Mapping speed, Million of reads per hour | 720.66 Number of input reads | 33230430 Average input read length | 189 UNIQUE READS: Uniquely mapped reads number | 29497985 Uniquely mapped reads % | 88.77% Average mapped length | 188.50 Number of splices: Total | 18490466 Number of splices: Annotated (sjdb) | 17571675 Number of splices: GT/AG | 18226757 Number of splices: GC/AG | 237629 Number of splices: AT/AC | 11611 Number of splices: Non-canonical | 14469 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.00% Deletion average length | 1.22 Insertion rate per base | 0.00% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2236523 % of reads mapped to multiple loci | 6.73% Number of reads mapped to too many loci | 103091 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.15% % of reads unmapped: other | 2.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1746856 1746856 1746856 N_multimapping 2236523 2236523 2236523 N_noFeature 1072485 2950649 27010543 N_ambiguous 840011 254546 16660 UnstrandedReadsAssigned:27585489 PositiveStrandReadsAssigned:26292790 NegativeStrandReadsAssigned:2470782 Dataset is classified positive stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 ERR3317423 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317423-trimmed-pair1.fastq ERR3317423-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,230,430 reads, 27,922,342 reads pseudoaligned [quant] estimated average fragment length: 195.017 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,262 rounds 52973 ERR3317423.ke.tsv 35125 ERR3317423.se.tsv 88098 total ==> ERR3317423.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 742.269 0 0 PNS24247 1044 849.983 28.9227 1.85362 PNS24249 1928 1733.98 125.454 3.94121 PNS24246 1044 849.983 28.9227 1.85362 PNS24248 1044 849.983 28.9227 1.85362 PNS24244 1471 1276.98 206.778 8.82088 PNS24243 293 128.468 2 0.848058 KQK14069 1603 1408.98 4881.38 188.725 KQK14071 474 287.22 21.3232 4.04416 ==> ERR3317423.se.tsv <== BRADI_1g14170v3 5764 BRADI_1g53295v3 34 BRADI_1g59795v3 208 BRADI_1g07683v3 0 BRADI_1g00485v3 81 BRADI_1g20270v3 1557 BRADI_1g74790v3 710 BRADI_1g09890v3 19 BRADI_1g77505v3 323 BRADI_1g48960v3 0 ERR3317423 completed mapping pipeline successfully