Starting /dee2/code/volunteer_pipeline.sh ERR3317424 current disk space = 1525352681472 free memory = 1534801884 ERR3317424 SRAfilesize 09db511464f580fa49fcdac32fa234e0 ERR3317424.sra ERR3317424.sra file validated ERR3317424 is paired end ERR3317424 is conventional basespace ERR3317424 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317424_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.05625 34.0 31.0 34.0 26.0 34.0 2 31.51975 34.0 31.0 34.0 26.0 34.0 3 32.55975 34.0 31.0 34.0 28.0 34.0 4 36.25275 37.0 35.0 37.0 35.0 37.0 5 36.27975 37.0 37.0 37.0 35.0 37.0 6 36.355 37.0 37.0 37.0 35.0 37.0 7 36.3195 37.0 37.0 37.0 35.0 37.0 8 36.3235 37.0 37.0 37.0 35.0 37.0 9 38.08275 39.0 39.0 39.0 37.0 39.0 10-11 38.155874999999995 39.0 39.0 39.0 37.0 39.0 12-13 38.069874999999996 39.0 39.0 39.0 36.0 39.0 14-15 39.619875 41.0 40.0 41.0 37.0 41.0 16-17 39.547875000000005 41.0 40.0 41.0 37.0 41.0 18-19 39.571875 41.0 40.0 41.0 37.0 41.0 20-21 39.417375 41.0 39.0 41.0 36.0 41.0 22-23 39.35850000000001 41.0 39.0 41.0 36.0 41.0 24-25 39.339124999999996 41.0 39.0 41.0 36.0 41.0 26-27 39.16674999999999 41.0 39.0 41.0 36.0 41.0 28-29 39.07 41.0 39.0 41.0 35.5 41.0 30-31 38.907250000000005 40.0 38.5 41.0 35.0 41.0 32-33 38.712625 40.0 38.0 41.0 35.0 41.0 34-35 38.545249999999996 40.0 38.0 41.0 34.0 41.0 36-37 38.4215 40.0 38.0 41.0 34.0 41.0 38-39 38.173125 40.0 38.0 41.0 33.5 41.0 40-41 37.997749999999996 40.0 37.5 41.0 33.0 41.0 42-43 37.858625 40.0 37.0 41.0 33.0 41.0 44-45 37.635999999999996 40.0 37.0 41.0 33.0 41.0 46-47 37.439375 40.0 36.0 41.0 32.5 41.0 48-49 37.351375000000004 40.0 36.0 41.0 32.5 41.0 50-51 37.067750000000004 39.0 35.5 41.0 31.5 41.0 52-53 37.257 39.0 35.0 41.0 32.5 41.0 54-55 37.156125 39.0 35.0 41.0 33.0 41.0 56-57 36.837500000000006 39.0 35.0 41.0 32.0 41.0 58-59 36.618125 38.5 35.0 41.0 32.0 41.0 60-61 36.275375 37.5 35.0 40.5 31.5 41.0 62-63 35.982625 37.0 35.0 40.0 31.0 41.0 64-65 35.570499999999996 36.5 35.0 39.5 31.0 41.0 66-67 35.200125 36.0 35.0 39.0 31.0 41.0 68-69 34.929 35.5 35.0 39.0 30.0 41.0 70-71 34.469 35.0 34.0 37.5 30.0 40.0 72-73 34.171499999999995 35.0 34.0 37.0 30.0 39.0 74-75 33.642125 35.0 34.0 37.0 29.0 39.0 76-77 32.784875 34.5 32.5 36.0 28.0 37.5 78-79 33.05625 35.0 33.5 36.0 29.0 37.0 80-81 32.908625 35.0 34.0 35.5 29.0 37.0 82-83 32.640375 35.0 34.0 35.0 28.0 36.5 84-85 32.207375 35.0 33.0 35.0 26.5 36.0 86-87 32.106 35.0 33.0 35.0 26.5 36.0 88-89 31.9395 35.0 33.0 35.0 27.0 36.0 90-91 31.724625 35.0 33.0 35.0 25.5 35.0 92-93 31.441499999999998 35.0 33.0 35.0 24.5 35.0 94-95 31.244374999999998 35.0 33.0 35.0 24.0 35.0 96-97 31.017125 35.0 33.0 35.0 23.0 35.0 98-99 30.634625 35.0 32.0 35.0 19.0 35.0 100-101 28.3205 33.0 28.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 3.0 9 2.0 10 3.0 11 4.0 12 2.0 13 4.0 14 7.0 15 9.0 16 7.0 17 6.0 18 17.0 19 7.0 20 16.0 21 12.0 22 7.0 23 15.0 24 22.0 25 27.0 26 34.0 27 31.0 28 29.0 29 49.0 30 63.0 31 71.0 32 91.0 33 122.0 34 212.0 35 355.0 36 606.0 37 1037.0 38 1001.0 39 125.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 24.662441443923946 28.1620281069165 21.162854780931387 26.012675668228162 2 25.424999999999997 25.624999999999996 20.825 28.125 3 27.0 26.6 18.725 27.675 4 28.375 25.1 17.075000000000003 29.45 5 28.825 23.45 17.549999999999997 30.175 6 29.875 24.875 20.549999999999997 24.7 7 29.725 24.55 21.55 24.175 8 31.6 25.674999999999997 24.575 18.15 9 31.0 28.050000000000004 24.925 16.025 10-11 31.8625 26.437500000000004 22.8 18.9 12-13 30.1375 25.5375 24.3875 19.9375 14-15 28.1625 26.187500000000004 24.587500000000002 21.0625 16-17 27.1375 26.4625 25.5 20.9 18-19 26.4625 26.5 25.387500000000003 21.65 20-21 25.0125 27.8875 25.687500000000004 21.4125 22-23 25.8625 27.175 25.0375 21.925 24-25 24.9 28.012500000000003 25.674999999999997 21.4125 26-27 25.15 27.875 25.9625 21.0125 28-29 26.1125 26.4125 25.674999999999997 21.8 30-31 25.687500000000004 26.150000000000002 26.137500000000003 22.025 32-33 25.837500000000002 26.987499999999997 25.7625 21.4125 34-35 26.5875 27.474999999999998 24.025 21.912499999999998 36-37 25.650000000000002 26.5875 25.85 21.912499999999998 38-39 25.5125 27.6875 25.337500000000002 21.462500000000002 40-41 25.1875 28.1125 24.5 22.2 42-43 25.05 28.599999999999998 25.424999999999997 20.925 44-45 24.625 28.275 25.3125 21.7875 46-47 25.624999999999996 27.175 25.174999999999997 22.025 48-49 25.4875 27.5625 25.0625 21.8875 50-51 25.6 26.787499999999998 25.575 22.037499999999998 52-53 26.275 27.675 24.7375 21.3125 54-55 24.825 27.8375 25.05 22.287499999999998 56-57 24.224999999999998 28.050000000000004 25.162499999999998 22.5625 58-59 24.7 28.212500000000002 24.575 22.5125 60-61 24.762500000000003 27.675 25.7625 21.8 62-63 24.337500000000002 28.3125 25.95 21.4 64-65 25.362499999999997 28.125 24.9125 21.6 66-67 25.087500000000002 27.9375 25.7875 21.1875 68-69 24.3875 28.9875 24.975 21.65 70-71 25.1875 28.925 24.4375 21.45 72-73 24.6625 29.2 24.55 21.587500000000002 74-75 24.3625 29.037499999999998 24.2875 22.3125 76-77 25.025 29.599999999999998 23.3125 22.0625 78-79 24.3875 28.6375 24.9375 22.037499999999998 80-81 24.55 29.9625 24.5125 20.974999999999998 82-83 25.4375 28.575 24.637500000000003 21.349999999999998 84-85 25.0375 28.9 24.65 21.4125 86-87 25.0625 28.825 24.224999999999998 21.8875 88-89 25.0625 29.475 23.95 21.512500000000003 90-91 24.7 29.225 24.2875 21.7875 92-93 24.5 29.362500000000004 24.075 22.0625 94-95 25.1875 29.299999999999997 23.549999999999997 21.9625 96-97 25.162499999999998 29.062500000000004 23.7625 22.0125 98-99 24.762500000000003 28.9875 23.875 22.375 100-101 25.6362040867494 28.958254983076344 22.79052275291463 22.61501817725962 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 2.0 2 2.5 3 3.5 4 3.0 5 3.0 6 3.5 7 5.0 8 3.0 9 2.0 10 2.5 11 3.0 12 4.0 13 3.5 14 4.0 15 3.5 16 3.5 17 2.5 18 4.5 19 7.5 20 6.5 21 4.5 22 4.5 23 6.5 24 8.0 25 8.5 26 7.0 27 10.0 28 14.5 29 13.0 30 10.0 31 14.5 32 18.5 33 24.5 34 33.0 35 40.0 36 51.0 37 64.0 38 84.5 39 110.5 40 135.0 41 155.5 42 163.0 43 177.0 44 198.5 45 203.5 46 187.5 47 180.0 48 189.0 49 187.5 50 179.0 51 157.0 52 127.5 53 107.0 54 101.5 55 92.5 56 78.5 57 79.0 58 82.0 59 74.5 60 60.5 61 55.0 62 49.5 63 41.0 64 38.0 65 38.5 66 39.5 67 32.5 68 24.0 69 25.0 70 25.0 71 22.5 72 20.5 73 15.0 74 13.0 75 11.0 76 10.5 77 6.5 78 1.0 79 2.5 80 2.0 81 1.5 82 1.5 83 0.5 84 1.0 85 2.5 86 2.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.2875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.3 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85554425228891 97.175 2 0.8138351983723295 1.6 3 0.2288911495422177 0.675 4 0.050864699898270596 0.2 5 0.0 0.0 6 0.0 0.0 7 0.050864699898270596 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGCAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGAT 7 0.17500000000000002 No Hit AGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCGAGTTCGCGCCGG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.15 0.0 0.0 0.0 0.0 6 0.2 0.0 0.0 0.0 0.0 7 0.25 0.0 0.0 0.0 0.0 8 0.3 0.0 0.0 0.0 0.0 9 0.35 0.0 0.0 0.0 0.0 10-11 0.35 0.0 0.0 0.0 0.0 12-13 0.35 0.0 0.0 0.0 0.0 14-15 0.375 0.0 0.0 0.0 0.0 16-17 0.375 0.0 0.0 0.0 0.0 18-19 0.375 0.0 0.0 0.0 0.0 20-21 0.375 0.0 0.0 0.0 0.0 22-23 0.375 0.0 0.0 0.0 0.0 24-25 0.375 0.0 0.0 0.0 0.0 26-27 0.375 0.0 0.0 0.0 0.0 28-29 0.4 0.0 0.0 0.0 0.0 30-31 0.4 0.0 0.0 0.0 0.0 32-33 0.4125 0.0 0.0 0.0 0.0 34-35 0.525 0.0 0.0 0.0 0.0 36-37 0.65 0.0 0.0 0.0 0.0 38-39 0.7375 0.0 0.0 0.0 0.0 40-41 0.8125 0.0 0.0 0.0 0.0 42-43 0.875 0.0 0.0 0.0 0.0 44-45 0.9375 0.0 0.0 0.0 0.0 46-47 1.15 0.0 0.0 0.0 0.0 48-49 1.375 0.0 0.0 0.0 0.0 50-51 1.5875 0.0 0.0 0.0 0.0 52-53 1.7875 0.0 0.0 0.0 0.0 54-55 1.9874999999999998 0.0 0.0 0.0 0.0 56-57 2.2125 0.0 0.0 0.0 0.0 58-59 2.5375 0.0 0.0 0.0 0.0 60-61 2.85 0.0 0.0 0.0 0.0 62-63 3.0625 0.0 0.0 0.0 0.0 64-65 3.4000000000000004 0.0 0.0 0.0 0.0 66-67 3.8125 0.0 0.0 0.0 0.0 68-69 4.275 0.0 0.0 0.0 0.0 70-71 4.725 0.0 0.0 0.0 0.0 72-73 5.25 0.0 0.0 0.0 0.0 74-75 5.7125 0.0 0.0 0.0 0.0 76-77 6.2 0.0 0.0 0.0 0.0 78-79 6.762499999999999 0.0 0.0 0.0 0.0 80-81 7.6 0.0 0.0 0.0 0.0 82-83 8.2875 0.0 0.0 0.0 0.0 84-85 9.024999999999999 0.0 0.0 0.0 0.0 86-87 9.9 0.0 0.0 0.0 0.0 88-89 10.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317424 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317424_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0585 34.0 31.0 34.0 30.0 34.0 2 31.8985 34.0 31.0 34.0 30.0 34.0 3 32.18025 34.0 31.0 34.0 30.0 34.0 4 35.08075 37.0 35.0 37.0 33.0 37.0 5 35.6235 37.0 35.0 37.0 35.0 37.0 6 35.62125 37.0 36.0 37.0 35.0 37.0 7 35.6135 37.0 36.0 37.0 35.0 37.0 8 35.6075 37.0 37.0 37.0 35.0 37.0 9 37.408 39.0 38.0 39.0 35.0 39.0 10-11 37.437875 39.0 38.5 39.0 35.0 39.0 12-13 37.418625 39.0 38.0 39.0 35.0 39.0 14-15 38.929125 41.0 40.0 41.0 36.0 41.0 16-17 38.718999999999994 41.0 39.5 41.0 36.0 41.0 18-19 38.471125 41.0 38.5 41.0 35.0 41.0 20-21 38.459375 41.0 38.5 41.0 35.0 41.0 22-23 38.30500000000001 41.0 38.0 41.0 35.0 41.0 24-25 38.255875 41.0 38.0 41.0 35.0 41.0 26-27 38.107124999999996 40.5 38.0 41.0 34.5 41.0 28-29 37.961625 40.0 38.0 41.0 34.0 41.0 30-31 37.81925 40.0 38.0 41.0 33.5 41.0 32-33 37.699875 40.0 38.0 41.0 33.5 41.0 34-35 37.584 40.0 38.0 41.0 33.0 41.0 36-37 37.448375 40.0 37.0 41.0 33.0 41.0 38-39 37.2445 40.0 37.0 41.0 33.0 41.0 40-41 37.135374999999996 40.0 37.0 41.0 33.0 41.0 42-43 36.956125 40.0 36.5 41.0 31.5 41.0 44-45 36.71825 40.0 36.0 41.0 31.5 41.0 46-47 36.450125 40.0 35.0 41.0 31.0 41.0 48-49 36.40175 40.0 35.0 41.0 31.0 41.0 50-51 35.745374999999996 39.0 35.5 40.0 30.0 40.5 52-53 35.698499999999996 39.0 35.0 40.0 29.5 41.0 54-55 35.76625 39.0 35.0 41.0 30.0 41.0 56-57 35.579875 39.0 35.0 41.0 29.0 41.0 58-59 35.240375 38.5 35.0 41.0 28.0 41.0 60-61 34.933375 38.0 35.0 40.5 27.0 41.0 62-63 34.747875 37.0 35.0 40.0 28.0 41.0 64-65 34.29275 37.0 34.5 40.0 26.0 41.0 66-67 33.927875 36.0 34.0 39.5 26.0 41.0 68-69 33.346999999999994 35.5 33.5 39.0 24.5 41.0 70-71 33.0005 35.0 33.5 38.5 23.5 40.5 72-73 32.742875 35.0 33.5 37.5 23.5 40.0 74-75 32.715374999999995 35.0 34.0 37.0 24.0 39.0 76-77 32.3905 35.0 34.0 37.0 24.0 39.0 78-79 32.002125 35.0 33.5 36.0 23.0 39.0 80-81 31.621875 35.0 33.0 36.0 20.5 37.0 82-83 31.328249999999997 35.0 33.0 35.0 20.0 37.0 84-85 31.12425 35.0 33.0 35.0 18.5 36.5 86-87 30.83725 35.0 33.0 35.0 16.0 36.0 88-89 30.667125 35.0 33.0 35.0 13.0 36.0 90-91 30.4205 35.0 32.5 35.0 2.0 35.5 92-93 30.08425 35.0 32.0 35.0 2.0 35.0 94-95 29.884375 35.0 31.5 35.0 2.0 35.0 96-97 29.595625 35.0 31.0 35.0 2.0 35.0 98-99 29.20275 35.0 31.0 35.0 2.0 35.0 100-101 27.4065 33.0 27.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 47.0 3 6.0 4 11.0 5 4.0 6 5.0 7 8.0 8 7.0 9 7.0 10 12.0 11 13.0 12 12.0 13 11.0 14 16.0 15 13.0 16 21.0 17 15.0 18 25.0 19 14.0 20 15.0 21 10.0 22 12.0 23 15.0 24 23.0 25 25.0 26 29.0 27 33.0 28 34.0 29 34.0 30 67.0 31 63.0 32 82.0 33 128.0 34 174.0 35 343.0 36 480.0 37 895.0 38 1102.0 39 189.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.65 11.4 33.4 26.55 2 25.15 9.8 31.225 33.825 3 21.6 11.450000000000001 33.650000000000006 33.300000000000004 4 22.55 10.174999999999999 33.025 34.25 5 23.35 13.375 29.325000000000003 33.95 6 23.9 16.7 33.925 25.474999999999998 7 18.075 22.5 43.55 15.875 8 16.725 24.325 40.550000000000004 18.4 9 16.650000000000002 26.525 38.925 17.9 10-11 17.575 25.3 37.4125 19.7125 12-13 17.775 26.224999999999998 36.2875 19.7125 14-15 18.862499999999997 24.2 36.5875 20.349999999999998 16-17 19.35 25.2125 33.675 21.762500000000003 18-19 17.7 26.775 34.0125 21.512500000000003 20-21 19.400000000000002 24.7375 33.074999999999996 22.787499999999998 22-23 19.400000000000002 23.9 33.2375 23.4625 24-25 18.8875 25.5375 33.5125 22.0625 26-27 19.7125 25.112499999999997 32.237500000000004 22.9375 28-29 19.925 24.325 31.6 24.15 30-31 19.35 24.4125 33.4875 22.75 32-33 19.6875 25.45 32.05 22.8125 34-35 19.725 24.9125 32.125 23.2375 36-37 20.1375 24.2375 31.775 23.849999999999998 38-39 19.475 24.25 32.65 23.625 40-41 20.424999999999997 23.125 31.474999999999998 24.975 42-43 20.9 24.1625 31.724999999999998 23.2125 44-45 21.1375 25.162499999999998 29.975 23.724999999999998 46-47 20.0625 25.6125 29.362500000000004 24.962500000000002 48-49 19.575 27.0625 30.612499999999997 22.75 50-51 20.4875 25.2125 30.049999999999997 24.25 52-53 21.45 24.975 28.825 24.75 54-55 20.2625 26.3125 31.225 22.2 56-57 20.175 25.474999999999998 31.125000000000004 23.225 58-59 20.3625 25.5625 30.15 23.925 60-61 19.662499999999998 26.375 30.562499999999996 23.400000000000002 62-63 20.6125 25.7625 30.0375 23.5875 64-65 20.7125 25.85 29.549999999999997 23.8875 66-67 21.5625 26.224999999999998 29.912499999999998 22.3 68-69 20.9 26.687499999999996 28.9875 23.425 70-71 21.099999999999998 26.5375 28.199999999999996 24.1625 72-73 20.7 27.025 28.512500000000003 23.7625 74-75 21.6875 25.650000000000002 29.375 23.2875 76-77 22.3 25.1875 28.7375 23.775 78-79 21.7375 26.625 28.525 23.1125 80-81 22.85 26.375 28.199999999999996 22.575 82-83 22.1875 25.887500000000003 27.6125 24.3125 84-85 23.599999999999998 25.137500000000003 28.4375 22.825 86-87 24.025 25.412499999999998 27.5875 22.975 88-89 22.287499999999998 25.650000000000002 28.8875 23.175 90-91 23.3625 26.5875 27.5875 22.4625 92-93 23.0375 25.624999999999996 28.199999999999996 23.1375 94-95 23.7875 25.45 27.487499999999997 23.275000000000002 96-97 25.15 25.0 26.887499999999996 22.9625 98-99 23.200000000000003 26.887499999999996 27.287499999999998 22.625 100-101 25.4103495802531 24.946748527753414 26.901390803157497 22.741511088835985 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 81.0 1 65.0 2 30.5 3 12.0 4 9.5 5 8.5 6 10.0 7 8.5 8 6.0 9 6.0 10 4.5 11 4.0 12 5.5 13 3.5 14 6.5 15 8.5 16 6.5 17 7.0 18 7.0 19 4.5 20 3.5 21 4.0 22 4.5 23 6.0 24 7.0 25 7.5 26 9.5 27 13.5 28 14.5 29 12.0 30 14.0 31 18.5 32 25.0 33 36.5 34 46.5 35 50.5 36 62.0 37 80.0 38 92.0 39 113.5 40 159.5 41 181.5 42 180.5 43 183.0 44 190.5 45 192.0 46 188.0 47 178.0 48 159.0 49 159.5 50 147.5 51 136.5 52 124.5 53 99.0 54 96.0 55 90.0 56 71.5 57 62.0 58 60.5 59 57.5 60 45.0 61 43.0 62 41.0 63 28.5 64 31.0 65 32.5 66 29.0 67 26.0 68 17.5 69 17.0 70 20.5 71 21.0 72 15.0 73 8.5 74 7.0 75 7.0 76 5.5 77 3.0 78 1.5 79 2.0 80 2.0 81 1.0 82 1.0 83 0.5 84 0.0 85 1.0 86 1.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.2375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.66666666666667 92.5 2 0.8 1.5 3 0.16 0.44999999999999996 4 0.08 0.3 5 0.05333333333333334 0.25 6 0.02666666666666667 0.15 7 0.02666666666666667 0.17500000000000002 8 0.05333333333333334 0.4 9 0.05333333333333334 0.44999999999999996 >10 0.05333333333333334 0.5499999999999999 >50 0.0 0.0 >100 0.02666666666666667 3.2750000000000004 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 131 3.2750000000000004 No Hit CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 12 0.3 No Hit GTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 10 0.25 No Hit TTTTTCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 9 0.22499999999999998 No Hit TCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 9 0.22499999999999998 No Hit TGGGGGTGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 8 0.2 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 8 0.2 No Hit TTTTCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit TCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit TCTTTATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 5 0.125 No Hit TCTTCGTATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.15 0.0 0.0 0.0 0.0 7 0.2 0.0 0.0 0.0 0.0 8 0.25 0.0 0.0 0.0 0.0 9 0.25 0.0 0.0 0.0 0.0 10-11 0.25 0.0 0.0 0.0 0.0 12-13 0.25 0.0 0.0 0.0 0.0 14-15 0.275 0.0 0.0 0.0 0.0 16-17 0.275 0.0 0.0 0.0 0.0 18-19 0.275 0.0 0.0 0.0 0.0 20-21 0.275 0.0 0.0 0.0 0.0 22-23 0.275 0.0 0.0 0.0 0.0 24-25 0.275 0.0 0.0 0.0 0.0 26-27 0.275 0.0 0.0 0.0 0.0 28-29 0.3 0.0 0.0 0.0 0.0 30-31 0.3 0.0 0.0 0.0 0.0 32-33 0.3125 0.0 0.0 0.0 0.0 34-35 0.42500000000000004 0.0 0.0 0.0 0.0 36-37 0.55 0.0 0.0 0.0 0.0 38-39 0.625 0.0 0.0 0.0 0.0 40-41 0.6875 0.0 0.0 0.0 0.0 42-43 0.75 0.0 0.0 0.0 0.0 44-45 0.8125 0.0 0.0 0.0 0.0 46-47 1.0125 0.0 0.0 0.0 0.0 48-49 1.2125 0.0 0.0 0.0 0.0 50-51 1.4125 0.0 0.0 0.0 0.0 52-53 1.5625 0.0 0.0 0.0 0.0 54-55 1.7625000000000002 0.0 0.0 0.0 0.0 56-57 1.9875 0.0 0.0 0.0 0.0 58-59 2.3125 0.0 0.0 0.0 0.0 60-61 2.625 0.0 0.0 0.0 0.0 62-63 2.8375 0.0 0.0 0.0 0.0 64-65 3.2125 0.0 0.0 0.0 0.0 66-67 3.6125 0.0 0.0 0.0 0.0 68-69 4.0625 0.0 0.0 0.0 0.0 70-71 4.5125 0.0 0.0 0.0 0.0 72-73 5.025 0.0 0.0 0.0 0.0 74-75 5.5125 0.0 0.0 0.0 0.0 76-77 6.012499999999999 0.0 0.0 0.0 0.0 78-79 6.612500000000001 0.0 0.0 0.0 0.0 80-81 7.4125 0.0 0.0 0.0 0.0 82-83 8.1 0.0 0.0 0.0 0.0 84-85 8.825 0.0 0.0 0.0 0.0 86-87 9.712499999999999 0.0 0.0 0.0 0.0 88-89 10.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2080369 spots for ERR3317424.sra Written 2080369 spots for ERR3317424.sra Read 2080369 spots for ERR3317424.sra Written 2080369 spots for ERR3317424.sra Read 2080369 spots for ERR3317424.sra Written 2080369 spots for ERR3317424.sra Read 2080369 spots for ERR3317424.sra Written 2080369 spots for ERR3317424.sra Read 2080369 spots for ERR3317424.sra Written 2080369 spots for ERR3317424.sra Read 2080369 spots for ERR3317424.sra Written 2080369 spots for ERR3317424.sra Read 2080369 spots for ERR3317424.sra Written 2080369 spots for ERR3317424.sra Read 2080369 spots for ERR3317424.sra Written 2080369 spots for ERR3317424.sra Read 2080381 spots for ERR3317424.sra Written 2080381 spots for ERR3317424.sra Read 2080369 spots for ERR3317424.sra Written 2080369 spots for ERR3317424.sra Read 2080369 spots for ERR3317424.sra Written 2080369 spots for ERR3317424.sra Read 2080369 spots for ERR3317424.sra Written 2080369 spots for ERR3317424.sra Read 2080369 spots for ERR3317424.sra Written 2080369 spots for ERR3317424.sra Read 2080369 spots for ERR3317424.sra Written 2080369 spots for ERR3317424.sra Read 2080369 spots for ERR3317424.sra Written 2080369 spots for ERR3317424.sra Read 2080369 spots for ERR3317424.sra Written 2080369 spots for ERR3317424.sra Read 2080369 spots for ERR3317424.sra Written 2080369 spots for ERR3317424.sra Read 2080369 spots for ERR3317424.sra Written 2080369 spots for ERR3317424.sra Read 2080369 spots for ERR3317424.sra Written 2080369 spots for ERR3317424.sra Read 2080369 spots for ERR3317424.sra Written 2080369 spots for ERR3317424.sra SRR ids: ['ERR3317424.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7otqgeef ERR3317424.sra spots: 41607392 blocks: [[1, 2080369], [2080370, 4160738], [4160739, 6241107], [6241108, 8321476], [8321477, 10401845], [10401846, 12482214], [12482215, 14562583], [14562584, 16642952], [16642953, 18723321], [18723322, 20803690], [20803691, 22884059], [22884060, 24964428], [24964429, 27044797], [27044798, 29125166], [29125167, 31205535], [31205536, 33285904], [33285905, 35366273], [35366274, 37446642], [37446643, 39527011], [39527012, 41607392]] ERR3317424 file size 10014457 ERR3317424 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317424 ERR3317424_1.fastq ERR3317424_2.fastq Input file: ERR3317424_1.fastq Paired file: ERR3317424_2.fastq trimmed: ERR3317424-trimmed-pair1.fastq, ERR3317424-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:01:13 2024 >> started Tue Dec 10 09:01:54 2024 >> done (40.818s) 41607392 read pairs processed; of these: 410022 ( 0.99%) short read pairs filtered out after trimming by size control 688796 ( 1.66%) empty read pairs filtered out after trimming by size control 40508574 (97.36%) read pairs available; of these: 15546169 (38.38%) trimmed read pairs available after processing 24962405 (61.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1446 0.00% 19 1641 0.00% 20 2673 0.01% 21 2792 0.01% 22 3440 0.01% 23 4288 0.01% 24 5178 0.01% 25 6620 0.02% 26 8221 0.02% 27 8872 0.02% 28 9010 0.02% 29 11138 0.03% 30 11568 0.03% 31 15354 0.04% 32 14738 0.04% 33 16482 0.04% 34 20372 0.05% 35 20967 0.05% 36 23010 0.06% 37 24442 0.06% 38 27274 0.07% 39 29100 0.07% 40 32068 0.08% 41 34555 0.09% 42 37444 0.09% 43 39634 0.10% 44 43611 0.11% 45 45446 0.11% 46 47749 0.12% 47 54774 0.14% 48 56199 0.14% 49 58153 0.14% 50 64114 0.16% 51 65845 0.16% 52 67063 0.17% 53 72562 0.18% 54 76610 0.19% 55 83098 0.21% 56 87263 0.22% 57 93315 0.23% 58 97141 0.24% 59 126169 0.31% 60 139082 0.34% 61 148986 0.37% 62 156031 0.39% 63 167111 0.41% 64 175101 0.43% 65 183960 0.45% 66 196600 0.49% 67 199653 0.49% 68 207811 0.51% 69 214155 0.53% 70 220393 0.54% 71 225001 0.56% 72 229764 0.57% 73 238740 0.59% 74 238779 0.59% 75 241244 0.60% 76 239276 0.59% 77 253951 0.63% 78 270386 0.67% 79 282871 0.70% 80 283216 0.70% 81 280624 0.69% 82 281504 0.69% 83 288198 0.71% 84 297015 0.73% 85 316523 0.78% 86 315471 0.78% 87 316860 0.78% 88 324516 0.80% 89 376615 0.93% 90 338175 0.83% 91 346328 0.85% 92 361336 0.89% 93 381556 0.94% 94 418347 1.03% 95 446138 1.10% 96 487152 1.20% 97 556348 1.37% 98 654472 1.62% 99 851345 2.10% 100 1844096 4.55% 101 24962405 61.62% 40508574 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=23 prefix-density=0.61 prefix-fanout=2.5 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=137.14 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=19.1 sequence=GAAGAAGAAGAAA criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.92 fanout-score-rank=24 prefix-density=0.29 prefix-fanout=2.5 sequence=CTAGCAGCAGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=168.23 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=9.1 sequence=TTTTCCTTTTTGTTTGTTTCGAGAAAGATATCGTCCGATTCTCCTTCTATTGATTCTTTTCCGATCGAGATGTATGGATCCATGTGTCTACATACCTAGATTCTGTTCATGGATTAACGAAAATGTGCAAGAGCTCTATTTGCCTCTGCCATTCTATGAGTCGCTTCCTTTTTGCGTATGGCACCCCCACTCCCTTTGGCAGCATCTACTAATTCGGAACTTAATTTGAAAGCCATATTTCGACCCGGACGCTTTTGGGATGCTTCTAATAACCAACGAATGGCAAGTGCTCTTCCTTGTTTAGATCCTATTTCAATCGGAACTTTCCGCGTCGATCCTTTTTTATTACGTCTTGTTTTTACTCCTATATTGGGAGTTACTCTACGTATTGCTTGACGTAAAACCAATAGTGGATTTGTTTCTGTC ERR3317424 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:02:44 Started mapping on | Dec 10 09:02:46 Finished on | Dec 10 09:08:08 Mapping speed, Million of reads per hour | 452.89 Number of input reads | 40508574 Average input read length | 187 UNIQUE READS: Uniquely mapped reads number | 34320341 Uniquely mapped reads % | 84.72% Average mapped length | 186.24 Number of splices: Total | 17247916 Number of splices: Annotated (sjdb) | 16355255 Number of splices: GT/AG | 16994703 Number of splices: GC/AG | 220421 Number of splices: AT/AC | 10533 Number of splices: Non-canonical | 22259 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.00% Deletion average length | 1.22 Insertion rate per base | 0.00% Insertion average length | 1.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2766807 % of reads mapped to multiple loci | 6.83% Number of reads mapped to too many loci | 119402 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.47% % of reads unmapped: other | 1.68% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3915525 3915525 3915525 N_multimapping 2766807 2766807 2766807 N_noFeature 1130064 3962848 30593440 N_ambiguous 1192895 373358 25553 UnstrandedReadsAssigned:31997382 PositiveStrandReadsAssigned:29984135 NegativeStrandReadsAssigned:3701348 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=95 echo kmer=91 ERR3317424 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317424-trimmed-pair1.fastq ERR3317424-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,508,574 reads, 32,040,420 reads pseudoaligned [quant] estimated average fragment length: 172.009 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52973 ERR3317424.ke.tsv 35125 ERR3317424.se.tsv 88098 total ==> ERR3317424.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 765.1 0 0 PNS24247 1044 872.991 10.9457 0.578138 PNS24249 1928 1756.99 115.022 3.01862 PNS24246 1044 872.991 10.9457 0.578138 PNS24248 1044 872.991 10.9457 0.578138 PNS24244 1471 1299.99 414.141 14.6895 PNS24243 293 145.467 2 0.633964 KQK14069 1603 1431.99 4926.74 158.642 KQK14071 474 309.34 29.152 4.34542 ==> ERR3317424.se.tsv <== BRADI_1g14170v3 6201 BRADI_1g53295v3 23 BRADI_1g59795v3 185 BRADI_1g07683v3 0 BRADI_1g00485v3 58 BRADI_1g20270v3 1956 BRADI_1g74790v3 572 BRADI_1g09890v3 13 BRADI_1g77505v3 352 BRADI_1g48960v3 0 ERR3317424 completed mapping pipeline successfully