Starting /dee2/code/volunteer_pipeline.sh ERR3317425 current disk space = 1525388533760 free memory = 1535978520 ERR3317425 SRAfilesize f6b2357949b5bf12bc43decdf7ec3881 ERR3317425.sra ERR3317425.sra file validated ERR3317425 is paired end ERR3317425 is conventional basespace ERR3317425 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317425_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.011 34.0 31.0 34.0 23.0 34.0 2 31.53075 34.0 31.0 34.0 25.0 34.0 3 32.58675 34.0 31.0 34.0 28.0 34.0 4 36.2975 37.0 37.0 37.0 35.0 37.0 5 36.333 37.0 37.0 37.0 35.0 37.0 6 36.41375 37.0 37.0 37.0 35.0 37.0 7 36.39175 37.0 37.0 37.0 35.0 37.0 8 36.393 37.0 37.0 37.0 35.0 37.0 9 38.145 39.0 39.0 39.0 37.0 39.0 10-11 38.1935 39.0 39.0 39.0 37.0 39.0 12-13 38.11175 39.0 39.0 39.0 37.0 39.0 14-15 39.692499999999995 41.0 40.0 41.0 37.0 41.0 16-17 39.628375 41.0 40.0 41.0 37.0 41.0 18-19 39.658500000000004 41.0 40.0 41.0 37.0 41.0 20-21 39.605125 41.0 40.0 41.0 37.0 41.0 22-23 39.4865 41.0 40.0 41.0 37.0 41.0 24-25 39.450625 41.0 39.5 41.0 37.0 41.0 26-27 39.35425 41.0 39.0 41.0 36.0 41.0 28-29 39.197625 41.0 39.0 41.0 36.0 41.0 30-31 39.039125 40.5 39.0 41.0 35.5 41.0 32-33 38.886624999999995 40.0 39.0 41.0 35.0 41.0 34-35 38.75625 40.0 38.0 41.0 35.0 41.0 36-37 38.474625 40.0 38.0 41.0 34.5 41.0 38-39 38.27125 40.0 38.0 41.0 33.5 41.0 40-41 38.080625 40.0 38.0 41.0 33.0 41.0 42-43 37.848875 40.0 37.0 41.0 33.0 41.0 44-45 37.5685 40.0 37.0 41.0 32.5 41.0 46-47 37.453 40.0 36.0 41.0 32.0 41.0 48-49 37.474125 40.0 36.0 41.0 32.5 41.0 50-51 37.172875000000005 39.0 35.5 41.0 32.0 41.0 52-53 37.352625 40.0 35.0 41.0 33.0 41.0 54-55 37.225 39.0 35.0 41.0 33.0 41.0 56-57 36.963625 39.0 35.0 41.0 32.0 41.0 58-59 36.685125 39.0 35.0 41.0 32.0 41.0 60-61 36.344750000000005 38.0 35.0 41.0 31.5 41.0 62-63 35.99875 37.0 35.0 40.0 31.0 41.0 64-65 35.674625000000006 37.0 35.0 40.0 31.0 41.0 66-67 35.442750000000004 36.0 35.0 39.0 31.0 41.0 68-69 35.061 36.0 35.0 39.0 31.0 41.0 70-71 34.65075 35.0 35.0 38.5 30.0 40.5 72-73 34.299875 35.0 34.0 37.0 30.0 39.0 74-75 33.824 35.0 34.0 37.0 29.0 39.0 76-77 32.909499999999994 34.5 32.5 36.0 28.0 38.0 78-79 33.07875 35.0 34.0 36.0 29.0 37.0 80-81 32.97425 35.0 34.0 35.5 29.0 37.0 82-83 32.697375 35.0 33.5 35.0 28.0 36.5 84-85 32.484625 35.0 33.0 35.0 27.5 36.0 86-87 32.292249999999996 35.0 33.0 35.0 27.0 36.0 88-89 32.131125 35.0 33.0 35.0 27.0 35.5 90-91 31.875375 35.0 33.0 35.0 26.0 35.0 92-93 31.661375 35.0 33.0 35.0 25.0 35.0 94-95 31.511625 35.0 33.0 35.0 25.0 35.0 96-97 31.2685 35.0 33.0 35.0 24.0 35.0 98-99 30.879875 35.0 32.5 35.0 22.5 35.0 100-101 28.495874999999998 33.0 28.0 34.5 7.5 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 2.0 9 4.0 10 5.0 11 5.0 12 5.0 13 5.0 14 6.0 15 7.0 16 7.0 17 7.0 18 10.0 19 8.0 20 7.0 21 11.0 22 15.0 23 15.0 24 13.0 25 14.0 26 21.0 27 40.0 28 27.0 29 51.0 30 60.0 31 69.0 32 108.0 33 135.0 34 193.0 35 304.0 36 610.0 37 1011.0 38 1073.0 39 148.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 26.749654218533887 27.3582295988935 20.221300138312586 25.670816044260025 2 25.974999999999998 26.200000000000003 19.875 27.950000000000003 3 26.674999999999997 27.6 18.099999999999998 27.625 4 27.675 25.724999999999998 17.125 29.475 5 27.800000000000004 25.124999999999996 17.5 29.575000000000003 6 28.1 27.6 18.725 25.575 7 30.75 23.724999999999998 22.5 23.025000000000002 8 32.324999999999996 24.825 24.075 18.775 9 31.85 27.05 24.375 16.725 10-11 33.137499999999996 27.037499999999998 21.025 18.8 12-13 30.112499999999997 26.400000000000002 23.0 20.4875 14-15 29.175 25.8 24.3125 20.7125 16-17 26.937499999999996 26.1125 25.0375 21.912499999999998 18-19 25.575 26.775 25.162499999999998 22.4875 20-21 25.424999999999997 26.237500000000004 25.5375 22.8 22-23 24.8625 27.05 25.587500000000002 22.5 24-25 26.0625 25.7375 25.8 22.400000000000002 26-27 25.55 27.325 24.1625 22.9625 28-29 26.150000000000002 26.0 24.9 22.95 30-31 25.7375 26.8625 25.05 22.35 32-33 24.962500000000002 26.5 25.387500000000003 23.150000000000002 34-35 26.0625 26.575 24.2375 23.125 36-37 25.2375 26.900000000000002 25.4875 22.375 38-39 24.8625 26.825 24.8 23.5125 40-41 26.1125 25.8625 24.9125 23.1125 42-43 25.837500000000002 26.450000000000003 24.4375 23.275000000000002 44-45 25.7125 26.85 25.4875 21.95 46-47 27.037499999999998 26.3 24.425 22.237499999999997 48-49 26.5125 26.224999999999998 25.162499999999998 22.1 50-51 25.775 26.200000000000003 25.0375 22.9875 52-53 25.575 27.187499999999996 24.775 22.4625 54-55 26.224999999999998 26.75 24.8 22.225 56-57 26.0125 26.85 24.6 22.537499999999998 58-59 25.674999999999997 27.450000000000003 23.6375 23.2375 60-61 25.6 26.55 25.412499999999998 22.4375 62-63 24.9875 26.8375 25.5375 22.6375 64-65 25.7625 26.5 24.7375 23.0 66-67 25.887500000000003 26.8 25.5375 21.775 68-69 25.275 27.275 24.3 23.150000000000002 70-71 25.7375 27.325 23.9875 22.95 72-73 26.787499999999998 27.0625 23.5625 22.5875 74-75 25.25 27.737499999999997 24.462500000000002 22.55 76-77 24.962500000000002 27.425 23.724999999999998 23.8875 78-79 25.7625 26.8125 24.2375 23.1875 80-81 24.675 27.6 24.8125 22.912499999999998 82-83 25.315664458057256 27.65345668208526 24.353044130516317 22.677834729341168 84-85 25.374999999999996 27.5625 24.5 22.5625 86-87 25.5375 27.3125 24.2375 22.912499999999998 88-89 25.4625 26.7625 23.775 24.0 90-91 25.4625 27.224999999999998 24.212500000000002 23.1 92-93 25.374999999999996 27.6625 23.7375 23.225 94-95 25.056264066016503 27.79444861215304 24.031007751937985 23.118279569892472 96-97 25.35 27.125 23.6875 23.8375 98-99 24.381095273818453 27.68192048012003 23.980995248812203 23.95598899724931 100-101 25.577309236947794 27.37198795180723 22.6531124497992 24.397590361445783 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 2.0 7 1.5 8 0.0 9 0.5 10 1.0 11 1.0 12 0.5 13 0.0 14 0.5 15 1.0 16 1.0 17 1.5 18 1.5 19 2.5 20 3.0 21 2.0 22 2.5 23 2.0 24 1.0 25 2.5 26 3.5 27 5.5 28 6.0 29 7.0 30 10.5 31 11.0 32 14.5 33 19.0 34 25.0 35 31.0 36 40.0 37 62.0 38 88.5 39 103.5 40 109.0 41 129.5 42 156.0 43 174.0 44 189.5 45 210.5 46 221.0 47 213.5 48 212.5 49 191.5 50 167.5 51 169.0 52 151.5 53 125.5 54 105.0 55 88.5 56 91.5 57 90.0 58 76.0 59 64.0 60 65.0 61 69.0 62 62.0 63 50.0 64 43.5 65 41.5 66 34.0 67 33.5 68 31.5 69 25.0 70 23.5 71 20.0 72 21.0 73 19.0 74 13.0 75 13.5 76 11.0 77 7.0 78 5.5 79 4.0 80 2.5 81 1.5 82 2.0 83 2.0 84 2.0 85 1.5 86 1.0 87 0.5 88 0.0 89 0.5 90 0.5 91 0.5 92 0.5 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0125 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.025 96-97 0.0 98-99 0.025 100-101 0.4 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01165737455652 97.675 2 0.7856056766345666 1.55 3 0.12671059300557527 0.375 4 0.05068423720223011 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025342118601115054 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGGCACCCAGAGACGAGGAAGGGCGTAGCAAGCGACGAAATGCTTCGGGG 8 0.2 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.175 0.0 0.0 0.0 0.0 30-31 0.2375 0.0 0.0 0.0 0.0 32-33 0.2875 0.0 0.0 0.0 0.0 34-35 0.35 0.0 0.0 0.0 0.0 36-37 0.5125 0.0 0.0 0.0 0.0 38-39 0.6 0.0 0.0 0.0 0.0 40-41 0.65 0.0 0.0 0.0 0.0 42-43 0.7124999999999999 0.0 0.0 0.0 0.0 44-45 0.9249999999999999 0.0 0.0 0.0 0.0 46-47 1.15 0.0 0.0 0.0 0.0 48-49 1.3375 0.0 0.0 0.0 0.0 50-51 1.65 0.0 0.0 0.0 0.0 52-53 1.925 0.0 0.0 0.0 0.0 54-55 2.0875 0.0 0.0 0.0 0.0 56-57 2.375 0.0 0.0 0.0 0.0 58-59 2.5250000000000004 0.0 0.0 0.0 0.0 60-61 2.9625 0.0 0.0 0.0 0.0 62-63 3.275 0.0 0.0 0.0 0.0 64-65 3.775 0.0 0.0 0.0 0.0 66-67 4.1375 0.0 0.0 0.0 0.0 68-69 4.525 0.0 0.0 0.0 0.0 70-71 4.887499999999999 0.0 0.0 0.0 0.0 72-73 5.4 0.0 0.0 0.0 0.0 74-75 6.0 0.0 0.0 0.0 0.0 76-77 6.5875 0.0 0.0 0.0 0.0 78-79 7.300000000000001 0.0 0.0 0.0 0.0 80-81 7.9625 0.0 0.0 0.0 0.0 82-83 8.6375 0.0 0.0 0.0 0.0 84-85 9.625 0.0 0.0 0.0 0.0 86-87 10.35 0.0 0.0 0.0 0.0 88-89 11.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317425 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317425_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.07525 34.0 31.0 34.0 30.0 34.0 2 31.8025 34.0 31.0 34.0 30.0 34.0 3 32.16975 34.0 31.0 34.0 30.0 34.0 4 34.9735 37.0 35.0 37.0 33.0 37.0 5 35.64725 37.0 35.0 37.0 35.0 37.0 6 35.66275 37.0 35.0 37.0 35.0 37.0 7 35.6955 37.0 36.0 37.0 35.0 37.0 8 35.665 37.0 37.0 37.0 35.0 37.0 9 37.55475 39.0 38.0 39.0 35.0 39.0 10-11 37.516625000000005 39.0 38.0 39.0 35.0 39.0 12-13 37.558499999999995 39.0 38.5 39.0 35.0 39.0 14-15 39.0355 41.0 40.0 41.0 36.0 41.0 16-17 38.94725 41.0 39.0 41.0 36.0 41.0 18-19 38.825500000000005 41.0 39.0 41.0 35.0 41.0 20-21 38.790875 41.0 39.0 41.0 35.0 41.0 22-23 38.765375 41.0 39.0 41.0 35.0 41.0 24-25 38.754999999999995 41.0 39.0 41.0 35.0 41.0 26-27 38.693125 41.0 39.0 41.0 35.0 41.0 28-29 38.614999999999995 41.0 39.0 41.0 35.0 41.0 30-31 38.443625 41.0 38.5 41.0 35.0 41.0 32-33 38.2765 40.0 38.5 41.0 34.5 41.0 34-35 38.1375 40.0 38.0 41.0 34.0 41.0 36-37 38.049875 40.0 38.0 41.0 33.5 41.0 38-39 37.8895 40.0 38.0 41.0 33.0 41.0 40-41 37.785875000000004 40.0 38.0 41.0 33.0 41.0 42-43 37.661874999999995 40.0 38.0 41.0 33.0 41.0 44-45 37.42075 40.0 37.5 41.0 32.5 41.0 46-47 37.245125 40.0 37.0 41.0 32.0 41.0 48-49 37.1425 40.0 36.5 41.0 32.0 41.0 50-51 36.545500000000004 39.0 36.0 40.5 31.0 40.5 52-53 36.491375 39.0 35.5 40.5 31.0 41.0 54-55 36.69 40.0 35.5 41.0 31.0 41.0 56-57 36.427625000000006 39.0 35.0 41.0 31.0 41.0 58-59 36.181125 39.0 35.0 41.0 30.5 41.0 60-61 35.894625000000005 38.5 35.0 41.0 30.5 41.0 62-63 35.586375000000004 38.0 35.0 40.5 29.5 41.0 64-65 35.250125 37.0 35.0 40.0 29.0 41.0 66-67 34.880875 37.0 34.0 40.0 29.0 41.0 68-69 34.3445 36.0 34.0 39.0 27.5 41.0 70-71 33.8665 35.5 34.0 39.0 26.0 40.5 72-73 33.755250000000004 35.0 34.0 38.0 27.0 40.0 74-75 33.695 35.0 34.0 37.0 28.5 39.5 76-77 33.351749999999996 35.0 34.0 37.0 27.5 39.0 78-79 32.994625 35.0 34.0 36.5 27.0 39.0 80-81 32.656625 35.0 34.0 36.0 27.0 37.0 82-83 32.42425 35.0 33.0 35.5 26.5 37.0 84-85 32.187875000000005 35.0 33.0 35.0 26.0 36.5 86-87 31.877499999999998 35.0 33.0 35.0 25.5 36.0 88-89 31.662125 35.0 33.0 35.0 24.5 36.0 90-91 31.423499999999997 35.0 33.0 35.0 24.5 35.5 92-93 31.12175 35.0 33.0 35.0 23.0 35.0 94-95 30.98275 35.0 32.5 35.0 22.5 35.0 96-97 30.718125 35.0 32.0 35.0 19.5 35.0 98-99 30.348 35.0 32.0 35.0 10.0 35.0 100-101 28.508875 33.5 28.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 43.0 3 3.0 4 3.0 5 2.0 6 5.0 7 4.0 8 4.0 9 4.0 10 5.0 11 9.0 12 7.0 13 10.0 14 9.0 15 10.0 16 9.0 17 11.0 18 3.0 19 12.0 20 14.0 21 8.0 22 14.0 23 13.0 24 11.0 25 21.0 26 30.0 27 16.0 28 41.0 29 50.0 30 60.0 31 58.0 32 87.0 33 116.0 34 179.0 35 301.0 36 486.0 37 952.0 38 1173.0 39 217.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.7 11.425 31.175000000000004 28.7 2 27.175 11.1 26.875 34.849999999999994 3 22.75 12.049999999999999 29.349999999999998 35.85 4 24.275 11.625 27.6 36.5 5 25.525 13.450000000000001 25.15 35.875 6 25.275 19.075 30.425 25.224999999999998 7 18.55 23.599999999999998 39.6 18.25 8 17.4 24.2 37.3 21.099999999999998 9 18.9 27.575 34.849999999999994 18.675 10-11 19.6375 25.7625 32.4375 22.162499999999998 12-13 19.375 26.6125 32.1375 21.875 14-15 20.075000000000003 26.0625 30.8125 23.05 16-17 19.825 25.3125 30.7375 24.125 18-19 20.0 25.924999999999997 30.887500000000003 23.1875 20-21 21.1625 25.4375 28.449999999999996 24.95 22-23 21.1625 24.7875 29.1375 24.9125 24-25 20.9375 26.137500000000003 29.012500000000003 23.9125 26-27 21.0125 25.337500000000002 28.125 25.525 28-29 20.974999999999998 24.587500000000002 27.900000000000002 26.5375 30-31 21.125 25.4375 28.475 24.962500000000002 32-33 22.625 25.337500000000002 27.35 24.6875 34-35 21.3625 24.212500000000002 29.012500000000003 25.412499999999998 36-37 21.462500000000002 25.2375 28.1625 25.137500000000003 38-39 21.087500000000002 25.7375 27.55 25.624999999999996 40-41 22.875 25.2625 26.5875 25.275 42-43 21.1625 24.825 28.812500000000004 25.2 44-45 21.95 25.85 27.05 25.15 46-47 22.425 24.775 27.200000000000003 25.6 48-49 21.05 25.412499999999998 28.3625 25.174999999999997 50-51 22.325 25.912499999999998 26.5875 25.174999999999997 52-53 22.3125 26.4125 26.224999999999998 25.05 54-55 21.6875 25.9625 27.487499999999997 24.8625 56-57 22.650000000000002 25.6125 27.1125 24.625 58-59 22.825 25.2875 26.787499999999998 25.1 60-61 22.3125 25.912499999999998 27.737499999999997 24.0375 62-63 21.9 26.575 26.1125 25.412499999999998 64-65 22.5125 24.3125 27.6625 25.5125 66-67 21.8875 26.224999999999998 27.8125 24.075 68-69 23.1125 25.5375 26.650000000000002 24.7 70-71 22.900000000000002 25.662499999999998 26.75 24.6875 72-73 22.8125 26.450000000000003 26.025 24.712500000000002 74-75 23.45 25.525 26.424999999999997 24.6 76-77 23.9875 25.837500000000002 24.8125 25.362499999999997 78-79 22.900000000000002 26.3125 26.387500000000003 24.4 80-81 23.1125 25.887500000000003 26.5 24.5 82-83 23.6875 25.412499999999998 25.7125 25.1875 84-85 24.087500000000002 27.212500000000002 25.5125 23.1875 86-87 24.637500000000003 26.687499999999996 25.4 23.275000000000002 88-89 24.4 26.025 25.137500000000003 24.4375 90-91 24.5375 26.05 26.3625 23.05 92-93 24.05 25.825 25.6 24.525 94-95 24.9125 25.4875 25.174999999999997 24.425 96-97 25.2875 26.087500000000002 26.0375 22.5875 98-99 25.05 25.337500000000002 24.7 24.9125 100-101 26.357366771159874 24.539184952978058 25.391849529780565 23.711598746081506 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 23.0 1 16.0 2 7.0 3 4.0 4 2.5 5 2.0 6 2.0 7 3.0 8 3.5 9 3.0 10 2.0 11 0.5 12 0.0 13 1.0 14 2.5 15 2.5 16 1.5 17 1.0 18 1.0 19 1.0 20 2.0 21 2.5 22 1.0 23 2.0 24 6.0 25 5.0 26 5.0 27 6.0 28 6.5 29 10.5 30 12.5 31 18.0 32 22.0 33 23.5 34 34.5 35 46.5 36 55.5 37 68.0 38 87.5 39 111.0 40 128.0 41 144.5 42 169.0 43 200.0 44 206.0 45 191.0 46 209.0 47 223.0 48 209.5 49 195.0 50 179.0 51 151.5 52 125.0 53 120.5 54 110.0 55 95.5 56 84.5 57 72.5 58 66.0 59 59.0 60 45.0 61 41.0 62 50.5 63 42.0 64 35.5 65 35.5 66 29.5 67 25.5 68 19.5 69 15.5 70 16.0 71 18.5 72 18.0 73 15.5 74 10.5 75 7.5 76 6.0 77 6.0 78 6.5 79 4.5 80 4.0 81 3.5 82 2.5 83 2.5 84 2.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.5 91 1.0 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.3125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.05 #Duplication Level Percentage of deduplicated Percentage of total 1 99.28607853136155 97.35000000000001 2 0.5609382967873533 1.0999999999999999 3 0.05099439061703213 0.15 4 0.025497195308516064 0.1 5 0.0 0.0 6 0.05099439061703213 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025497195308516064 1.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 40 1.0 No Hit TCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 6 0.15 No Hit TGGGGTTGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.175 0.0 0.0 0.0 0.0 30-31 0.2375 0.0 0.0 0.0 0.0 32-33 0.2625 0.0 0.0 0.0 0.0 34-35 0.32499999999999996 0.0 0.0 0.0 0.0 36-37 0.48750000000000004 0.0 0.0 0.0 0.0 38-39 0.55 0.0 0.0 0.0 0.0 40-41 0.6 0.0 0.0 0.0 0.0 42-43 0.6375 0.0 0.0 0.0 0.0 44-45 0.85 0.0 0.0 0.0 0.0 46-47 1.0750000000000002 0.0 0.0 0.0 0.0 48-49 1.2625000000000002 0.0 0.0 0.0 0.0 50-51 1.5750000000000002 0.0 0.0 0.0 0.0 52-53 1.825 0.0 0.0 0.0 0.0 54-55 1.9874999999999998 0.0 0.0 0.0 0.0 56-57 2.2750000000000004 0.0 0.0 0.0 0.0 58-59 2.425 0.0 0.0 0.0 0.0 60-61 2.8375 0.0 0.0 0.0 0.0 62-63 3.15 0.0 0.0 0.0 0.0 64-65 3.625 0.0 0.0 0.0 0.0 66-67 4.0125 0.0 0.0 0.0 0.0 68-69 4.4125 0.0 0.0 0.0 0.0 70-71 4.737500000000001 0.0 0.0 0.0 0.0 72-73 5.25 0.0 0.0 0.0 0.0 74-75 5.8375 0.0 0.0 0.0 0.0 76-77 6.4125 0.0 0.0 0.0 0.0 78-79 7.175000000000001 0.0 0.0 0.0 0.0 80-81 7.825 0.0 0.0 0.0 0.0 82-83 8.5 0.0 0.0 0.0 0.0 84-85 9.4875 0.0 0.0 0.0 0.0 86-87 10.175 0.0 0.0 0.0 0.0 88-89 10.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTTCT 15 0.009957196 47.5 20-21 >>END_MODULE Read 1975782 spots for ERR3317425.sra Written 1975782 spots for ERR3317425.sra Read 1975782 spots for ERR3317425.sra Written 1975782 spots for ERR3317425.sra Read 1975782 spots for ERR3317425.sra Written 1975782 spots for ERR3317425.sra Read 1975782 spots for ERR3317425.sra Written 1975782 spots for ERR3317425.sra Read 1975782 spots for ERR3317425.sra Written 1975782 spots for ERR3317425.sra Read 1975782 spots for ERR3317425.sra Written 1975782 spots for ERR3317425.sra Read 1975782 spots for ERR3317425.sra Written 1975782 spots for ERR3317425.sra Read 1975782 spots for ERR3317425.sra Written 1975782 spots for ERR3317425.sra Read 1975782 spots for ERR3317425.sra Written 1975782 spots for ERR3317425.sra Read 1975782 spots for ERR3317425.sra Written 1975782 spots for ERR3317425.sra Read 1975782 spots for ERR3317425.sra Written 1975782 spots for ERR3317425.sra Read 1975782 spots for ERR3317425.sra Written 1975782 spots for ERR3317425.sra Read 1975782 spots for ERR3317425.sra Written 1975782 spots for ERR3317425.sra Read 1975782 spots for ERR3317425.sra Written 1975782 spots for ERR3317425.sra Read 1975789 spots for ERR3317425.sra Written 1975789 spots for ERR3317425.sra Read 1975782 spots for ERR3317425.sra Written 1975782 spots for ERR3317425.sra Read 1975782 spots for ERR3317425.sra Written 1975782 spots for ERR3317425.sra Read 1975782 spots for ERR3317425.sra Written 1975782 spots for ERR3317425.sra Read 1975782 spots for ERR3317425.sra Written 1975782 spots for ERR3317425.sra Read 1975782 spots for ERR3317425.sra Written 1975782 spots for ERR3317425.sra SRR ids: ['ERR3317425.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lqlmzju0 ERR3317425.sra spots: 39515647 blocks: [[1, 1975782], [1975783, 3951564], [3951565, 5927346], [5927347, 7903128], [7903129, 9878910], [9878911, 11854692], [11854693, 13830474], [13830475, 15806256], [15806257, 17782038], [17782039, 19757820], [19757821, 21733602], [21733603, 23709384], [23709385, 25685166], [25685167, 27660948], [27660949, 29636730], [29636731, 31612512], [31612513, 33588294], [33588295, 35564076], [35564077, 37539858], [37539859, 39515647]] ERR3317425 file size 9509905 ERR3317425 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317425 ERR3317425_1.fastq ERR3317425_2.fastq Input file: ERR3317425_1.fastq Paired file: ERR3317425_2.fastq trimmed: ERR3317425-trimmed-pair1.fastq, ERR3317425-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:01:42 2024 >> started Tue Dec 10 09:02:22 2024 >> done (40.138s) 39515647 read pairs processed; of these: 267515 ( 0.68%) short read pairs filtered out after trimming by size control 604081 ( 1.53%) empty read pairs filtered out after trimming by size control 38644051 (97.79%) read pairs available; of these: 13543447 (35.05%) trimmed read pairs available after processing 25100604 (64.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1459 0.00% 19 1582 0.00% 20 2320 0.01% 21 2752 0.01% 22 3257 0.01% 23 4492 0.01% 24 5245 0.01% 25 6159 0.02% 26 7410 0.02% 27 8917 0.02% 28 9578 0.02% 29 11498 0.03% 30 12262 0.03% 31 16072 0.04% 32 16601 0.04% 33 18199 0.05% 34 20918 0.05% 35 22272 0.06% 36 24348 0.06% 37 25529 0.07% 38 29005 0.08% 39 32052 0.08% 40 31985 0.08% 41 34768 0.09% 42 36636 0.09% 43 38776 0.10% 44 41135 0.11% 45 43678 0.11% 46 45446 0.12% 47 50692 0.13% 48 52848 0.14% 49 54965 0.14% 50 61615 0.16% 51 60888 0.16% 52 62870 0.16% 53 67752 0.18% 54 71122 0.18% 55 75982 0.20% 56 79914 0.21% 57 83798 0.22% 58 89464 0.23% 59 107028 0.28% 60 116685 0.30% 61 125648 0.33% 62 131960 0.34% 63 138740 0.36% 64 145232 0.38% 65 152719 0.40% 66 163435 0.42% 67 164641 0.43% 68 169677 0.44% 69 172600 0.45% 70 176839 0.46% 71 181405 0.47% 72 187524 0.49% 73 192680 0.50% 74 194975 0.50% 75 198065 0.51% 76 193472 0.50% 77 205305 0.53% 78 216305 0.56% 79 225608 0.58% 80 232278 0.60% 81 228135 0.59% 82 227936 0.59% 83 238434 0.62% 84 245038 0.63% 85 254090 0.66% 86 256367 0.66% 87 259907 0.67% 88 264291 0.68% 89 285487 0.74% 90 280996 0.73% 91 291198 0.75% 92 310680 0.80% 93 329680 0.85% 94 355827 0.92% 95 391131 1.01% 96 438916 1.14% 97 507624 1.31% 98 612419 1.58% 99 816485 2.11% 100 1789724 4.63% 101 25100604 64.95% 38644051 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=3.72 fanout-score-rank=20 prefix-density=0.48 prefix-fanout=3.1 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.10 sequence-density-rank=11 fanout-score=231.06 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=28.1 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=4.32 fanout-score-rank=19 prefix-density=0.22 prefix-fanout=3.0 sequence=TTCGCTATCGGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=104.28 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=2.4 sequence=TATAAGAAAGAAAGTGATTTTCTCAACTCTTTCAAACTTTTAGGAATTCACATATGCAAGCTAGCTCCTCGATCGAGAGCCAGGTTGCTACACACAACAACAATCTTGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTGAGCTGACACTTTATATATGGTCCATCTTAATACGGAGCTGTCCTTGGTTGTTTATGCCTTGCCGGATTCCTCGCAGCCCGGTGGCTT ERR3317425 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:03:03 Started mapping on | Dec 10 09:03:03 Finished on | Dec 10 09:05:27 Mapping speed, Million of reads per hour | 966.10 Number of input reads | 38644051 Average input read length | 189 UNIQUE READS: Uniquely mapped reads number | 35505669 Uniquely mapped reads % | 91.88% Average mapped length | 187.83 Number of splices: Total | 21893398 Number of splices: Annotated (sjdb) | 20843893 Number of splices: GT/AG | 21571727 Number of splices: GC/AG | 284703 Number of splices: AT/AC | 18270 Number of splices: Non-canonical | 18698 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.00% Deletion average length | 1.22 Insertion rate per base | 0.00% Insertion average length | 1.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1997636 % of reads mapped to multiple loci | 5.17% Number of reads mapped to too many loci | 68271 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.00% % of reads unmapped: other | 0.77% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1336426 1336426 1336426 N_multimapping 1997636 1997636 1997636 N_noFeature 1213260 2890789 33110291 N_ambiguous 1010390 345314 21464 UnstrandedReadsAssigned:33282019 PositiveStrandReadsAssigned:32269566 NegativeStrandReadsAssigned:2373914 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=96 echo kmer=91 ERR3317425 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317425-trimmed-pair1.fastq ERR3317425-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,644,051 reads, 33,719,297 reads pseudoaligned [quant] estimated average fragment length: 175.014 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,237 rounds 52973 ERR3317425.ke.tsv 35125 ERR3317425.se.tsv 88098 total ==> ERR3317425.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 762.223 0 0 PNS24247 1044 869.986 20.5714 1.09713 PNS24249 1928 1753.99 222.39 5.88297 PNS24246 1044 869.986 20.5714 1.09713 PNS24248 1044 869.986 20.5714 1.09713 PNS24244 1471 1296.99 217.896 7.79509 PNS24243 293 140.917 3 0.987789 KQK14069 1603 1428.99 4285.44 139.147 KQK14071 474 305.452 5.6794 0.862713 ==> ERR3317425.se.tsv <== BRADI_1g14170v3 4608 BRADI_1g53295v3 117 BRADI_1g59795v3 312 BRADI_1g07683v3 0 BRADI_1g00485v3 131 BRADI_1g20270v3 2560 BRADI_1g74790v3 389 BRADI_1g09890v3 11 BRADI_1g77505v3 450 BRADI_1g48960v3 0 ERR3317425 completed mapping pipeline successfully