Starting /dee2/code/volunteer_pipeline.sh ERR3317426 current disk space = 1525405016064 free memory = 1602344656 ERR3317426 SRAfilesize d0f0ccc3b16703cf34bdd59c04da2c3b ERR3317426.sra ERR3317426.sra file validated ERR3317426 is paired end ERR3317426 is conventional basespace ERR3317426 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317426_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.2275 34.0 31.0 34.0 27.0 34.0 2 31.63775 34.0 31.0 34.0 27.0 34.0 3 32.588 34.0 31.0 34.0 28.0 34.0 4 36.25725 37.0 35.0 37.0 35.0 37.0 5 36.34025 37.0 37.0 37.0 35.0 37.0 6 36.341 37.0 37.0 37.0 35.0 37.0 7 36.3545 37.0 37.0 37.0 35.0 37.0 8 36.39425 37.0 37.0 37.0 35.0 37.0 9 38.134 39.0 39.0 39.0 37.0 39.0 10-11 38.173375 39.0 39.0 39.0 37.0 39.0 12-13 38.105625 39.0 39.0 39.0 36.0 39.0 14-15 39.670375 41.0 40.0 41.0 37.0 41.0 16-17 39.546875 41.0 40.0 41.0 37.0 41.0 18-19 39.587999999999994 41.0 40.0 41.0 37.0 41.0 20-21 39.511375 41.0 40.0 41.0 36.5 41.0 22-23 39.441874999999996 41.0 39.0 41.0 36.0 41.0 24-25 39.415499999999994 41.0 39.0 41.0 36.0 41.0 26-27 39.277 41.0 39.0 41.0 36.0 41.0 28-29 39.165125 41.0 39.0 41.0 35.5 41.0 30-31 39.04075 40.5 39.0 41.0 35.0 41.0 32-33 38.832499999999996 40.0 38.0 41.0 35.0 41.0 34-35 38.69425 40.0 38.0 41.0 35.0 41.0 36-37 38.485875 40.0 38.0 41.0 34.0 41.0 38-39 38.29275 40.0 38.0 41.0 33.5 41.0 40-41 38.076750000000004 40.0 38.0 41.0 33.0 41.0 42-43 37.782375 40.0 37.0 41.0 33.0 41.0 44-45 37.450625 40.0 36.5 41.0 32.5 41.0 46-47 37.322874999999996 39.5 36.0 41.0 32.0 41.0 48-49 37.2545 39.0 36.0 41.0 32.0 41.0 50-51 37.00775 39.0 35.0 41.0 31.5 41.0 52-53 37.166125 39.0 35.0 41.0 32.0 41.0 54-55 37.093500000000006 39.0 35.0 41.0 33.0 41.0 56-57 36.834625 39.0 35.0 41.0 32.0 41.0 58-59 36.5015 38.0 35.0 41.0 32.0 41.0 60-61 36.106625 37.0 35.0 40.5 31.0 41.0 62-63 35.854625 37.0 35.0 40.0 31.0 41.0 64-65 35.56225 36.5 35.0 39.5 31.0 41.0 66-67 35.266625000000005 36.0 35.0 39.0 31.0 41.0 68-69 34.9395 35.5 35.0 39.0 30.5 41.0 70-71 34.556625 35.0 34.0 37.5 30.0 40.0 72-73 34.16525 35.0 34.0 37.0 29.0 39.0 74-75 33.743125 35.0 34.0 36.5 29.0 39.0 76-77 32.7735 34.5 32.5 36.0 27.0 38.0 78-79 33.058499999999995 35.0 33.5 36.0 29.0 37.0 80-81 32.938125 35.0 34.0 35.0 29.0 37.0 82-83 32.715500000000006 35.0 33.5 35.0 28.0 36.5 84-85 32.44125 35.0 33.0 35.0 27.5 36.0 86-87 32.18175 35.0 33.0 35.0 26.5 36.0 88-89 31.844749999999998 35.0 33.0 35.0 25.5 35.5 90-91 31.636875 35.0 33.0 35.0 25.0 35.0 92-93 31.475749999999998 35.0 33.0 35.0 24.5 35.0 94-95 31.177375 35.0 32.5 35.0 24.5 35.0 96-97 30.775875 35.0 32.0 35.0 20.0 35.0 98-99 30.380000000000003 35.0 32.0 35.0 10.0 35.0 100-101 27.974125 33.0 27.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 2.0 9 1.0 10 2.0 11 3.0 12 4.0 13 10.0 14 8.0 15 9.0 16 8.0 17 12.0 18 6.0 19 9.0 20 8.0 21 14.0 22 16.0 23 13.0 24 14.0 25 19.0 26 20.0 27 26.0 28 40.0 29 56.0 30 54.0 31 87.0 32 97.0 33 168.0 34 201.0 35 319.0 36 620.0 37 1049.0 38 977.0 39 126.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 25.514403292181072 26.886145404663925 20.603566529492458 26.995884773662553 2 26.96348174087044 25.11255627813907 19.35967983991996 28.564282141070535 3 26.400000000000002 25.974999999999998 18.55 29.075 4 26.950000000000003 25.525 18.8 28.725 5 29.5 24.474999999999998 15.875 30.15 6 28.499999999999996 27.150000000000002 19.025 25.324999999999996 7 28.475 24.099999999999998 21.85 25.575 8 30.425 26.55 24.2 18.825 9 31.275 26.85 24.95 16.925 10-11 33.324999999999996 26.525 21.462500000000002 18.6875 12-13 29.6875 26.187500000000004 23.4375 20.6875 14-15 27.250000000000004 26.55 24.6875 21.512500000000003 16-17 26.825 25.95 24.9125 22.3125 18-19 25.8 26.125 25.837500000000002 22.237499999999997 20-21 25.5625 26.5625 24.637500000000003 23.2375 22-23 25.6 26.0625 25.1 23.2375 24-25 26.075 25.937500000000004 24.9375 23.05 26-27 25.2375 27.0 24.3625 23.400000000000002 28-29 26.0125 25.937500000000004 24.75 23.3 30-31 25.85 25.674999999999997 25.874999999999996 22.6 32-33 25.7375 25.6 25.275 23.3875 34-35 25.4875 26.85 24.0125 23.65 36-37 25.8 25.974999999999998 24.9 23.325000000000003 38-39 25.4625 26.1 25.25 23.1875 40-41 25.724999999999998 26.650000000000002 24.712500000000002 22.912499999999998 42-43 26.174999999999997 25.887500000000003 24.825 23.1125 44-45 26.674999999999997 25.724999999999998 24.762500000000003 22.8375 46-47 26.8 25.8 24.625 22.775000000000002 48-49 26.275 27.462500000000002 24.7375 21.525 50-51 25.7 26.9125 24.6875 22.7 52-53 25.7375 27.125 24.05 23.0875 54-55 26.0125 27.05 24.6625 22.275 56-57 25.575 27.425 24.1625 22.8375 58-59 26.200000000000003 26.75 24.349999999999998 22.7 60-61 26.674999999999997 26.3625 24.637500000000003 22.325 62-63 25.825 27.525 24.224999999999998 22.425 64-65 25.337500000000002 26.137500000000003 25.0375 23.4875 66-67 25.474999999999998 26.887499999999996 24.825 22.8125 68-69 26.35 26.200000000000003 24.5 22.95 70-71 25.825 26.924999999999997 23.9 23.35 72-73 26.174999999999997 26.650000000000002 24.85 22.325 74-75 25.45 27.0875 24.65 22.8125 76-77 25.374999999999996 26.9125 24.1375 23.575 78-79 24.95 27.737499999999997 24.8125 22.5 80-81 26.0625 27.150000000000002 24.125 22.662499999999998 82-83 24.781195298824706 28.382095523880967 23.493373343335833 23.34333583395849 84-85 25.7125 26.825 24.675 22.787499999999998 86-87 25.8 26.5 23.9125 23.7875 88-89 25.3 27.1375 23.7875 23.775 90-91 25.15 27.500000000000004 24.3125 23.0375 92-93 25.8625 26.637499999999996 24.0 23.5 94-95 26.04401100275069 27.544386096524132 23.10577644411103 23.305826456614152 96-97 25.775 27.0125 23.75 23.4625 98-99 25.668917229307326 26.644161040260066 23.918479619904975 23.768442110527634 100-101 25.34203589807958 27.375423622442575 23.070164428266597 24.212376051211244 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.5 8 1.0 9 0.5 10 0.0 11 0.0 12 1.5 13 2.0 14 0.5 15 0.5 16 1.0 17 1.0 18 0.5 19 1.5 20 2.0 21 1.0 22 2.0 23 3.0 24 3.0 25 4.0 26 4.5 27 4.5 28 6.0 29 9.0 30 16.0 31 14.5 32 9.5 33 14.0 34 23.5 35 36.5 36 49.5 37 60.5 38 74.5 39 95.5 40 118.0 41 143.0 42 167.5 43 177.0 44 184.5 45 193.0 46 202.5 47 203.0 48 213.5 49 203.5 50 163.0 51 152.0 52 135.5 53 115.5 54 110.0 55 93.5 56 76.0 57 77.5 58 77.5 59 66.0 60 66.0 61 69.0 62 62.0 63 54.5 64 48.5 65 42.5 66 39.5 67 37.0 68 34.0 69 40.5 70 36.5 71 27.0 72 24.0 73 22.5 74 24.0 75 18.5 76 8.0 77 3.0 78 4.5 79 4.5 80 3.5 81 3.0 82 1.5 83 1.0 84 0.5 85 2.0 86 2.0 87 0.0 88 0.5 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.875 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.025 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.025 96-97 0.0 98-99 0.025 100-101 0.41250000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93563101875317 97.6 2 0.8109477952356817 1.6 3 0.20273694880892043 0.6 4 0.05068423720223011 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.15 0.0 0.0 0.0 0.0 10-11 0.15 0.0 0.0 0.0 0.0 12-13 0.15 0.0 0.0 0.0 0.0 14-15 0.15 0.0 0.0 0.0 0.0 16-17 0.15 0.0 0.0 0.0 0.0 18-19 0.16249999999999998 0.0 0.0 0.0 0.0 20-21 0.175 0.0 0.0 0.0 0.0 22-23 0.175 0.0 0.0 0.0 0.0 24-25 0.2 0.0 0.0 0.0 0.0 26-27 0.2 0.0 0.0 0.0 0.0 28-29 0.2 0.0 0.0 0.0 0.0 30-31 0.225 0.0 0.0 0.0 0.0 32-33 0.25 0.0 0.0 0.0 0.0 34-35 0.32499999999999996 0.0 0.0 0.0 0.0 36-37 0.4 0.0 0.0 0.0 0.0 38-39 0.4625 0.0 0.0 0.0 0.0 40-41 0.65 0.0 0.0 0.0 0.0 42-43 0.8375 0.0 0.0 0.0 0.0 44-45 1.0 0.0 0.0 0.0 0.0 46-47 1.1625 0.0 0.0 0.0 0.0 48-49 1.3125 0.0 0.0 0.0 0.0 50-51 1.5375 0.0 0.0 0.0 0.0 52-53 1.9125 0.0 0.0 0.0 0.0 54-55 2.1375 0.0 0.0 0.0 0.0 56-57 2.4125 0.0 0.0 0.0 0.0 58-59 2.5875 0.0 0.0 0.0 0.0 60-61 2.9749999999999996 0.0 0.0 0.0 0.0 62-63 3.25 0.0 0.0 0.0 0.0 64-65 3.625 0.0 0.0 0.0 0.0 66-67 4.0625 0.0 0.0 0.0 0.0 68-69 4.4875 0.0 0.0 0.0 0.0 70-71 4.875 0.0 0.0 0.0 0.0 72-73 5.4625 0.0 0.0 0.0 0.0 74-75 5.9625 0.0 0.0 0.0 0.0 76-77 6.6 0.0 0.0 0.0 0.0 78-79 7.175 0.0 0.0 0.0 0.0 80-81 7.762499999999999 0.0 0.0 0.0 0.0 82-83 8.4625 0.0 0.0 0.0 0.0 84-85 9.225000000000001 0.0 0.0 0.0 0.0 86-87 10.025 0.0 0.0 0.0 0.0 88-89 10.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317426 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317426_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0625 34.0 31.0 34.0 30.0 34.0 2 31.935 34.0 31.0 34.0 30.0 34.0 3 32.1705 34.0 31.0 34.0 30.0 34.0 4 35.12925 37.0 35.0 37.0 33.0 37.0 5 35.6345 37.0 35.0 37.0 35.0 37.0 6 35.7035 37.0 35.0 37.0 35.0 37.0 7 35.69825 37.0 36.0 37.0 35.0 37.0 8 35.71475 37.0 37.0 37.0 35.0 37.0 9 37.5225 39.0 38.0 39.0 35.0 39.0 10-11 37.522125 39.0 38.0 39.0 35.0 39.0 12-13 37.529875 39.0 38.5 39.0 35.0 39.0 14-15 38.985125 41.0 39.0 41.0 36.0 41.0 16-17 38.966875 41.0 39.0 41.0 36.0 41.0 18-19 38.807375 41.0 39.0 41.0 35.0 41.0 20-21 38.838499999999996 41.0 39.0 41.0 35.0 41.0 22-23 38.729749999999996 41.0 39.0 41.0 35.0 41.0 24-25 38.667375 41.0 39.0 41.0 35.0 41.0 26-27 38.6425 41.0 39.0 41.0 35.0 41.0 28-29 38.528375 41.0 39.0 41.0 35.0 41.0 30-31 38.424625000000006 41.0 39.0 41.0 34.5 41.0 32-33 38.237875 40.0 38.0 41.0 34.5 41.0 34-35 38.048125 40.0 38.0 41.0 33.5 41.0 36-37 37.976625 40.0 38.0 41.0 33.0 41.0 38-39 37.766000000000005 40.0 38.0 41.0 33.0 41.0 40-41 37.753375000000005 40.0 38.0 41.0 33.0 41.0 42-43 37.59375 40.0 37.5 41.0 33.0 41.0 44-45 37.36425 40.0 37.0 41.0 32.5 41.0 46-47 37.161249999999995 40.0 37.0 41.0 31.5 41.0 48-49 37.030249999999995 40.0 36.0 41.0 31.5 41.0 50-51 36.509625 39.0 35.5 40.5 31.0 40.5 52-53 36.52175 39.0 36.0 40.5 31.0 41.0 54-55 36.577875 40.0 35.0 41.0 31.0 41.0 56-57 36.435249999999996 39.0 35.0 41.0 31.0 41.0 58-59 36.117999999999995 39.0 35.0 41.0 30.0 41.0 60-61 35.75475 38.5 35.0 41.0 29.0 41.0 62-63 35.565375 38.0 35.0 40.5 29.0 41.0 64-65 35.137875 37.0 35.0 40.0 28.5 41.0 66-67 34.81 37.0 34.0 40.0 28.0 41.0 68-69 34.318875 36.0 34.0 39.0 27.5 41.0 70-71 33.864000000000004 35.5 34.0 39.0 26.5 40.5 72-73 33.675 35.0 33.5 38.5 27.0 40.0 74-75 33.60825 35.0 34.0 37.0 28.0 39.5 76-77 33.255375 35.0 34.0 37.0 27.5 39.0 78-79 32.852625 35.0 34.0 36.5 27.0 39.0 80-81 32.449250000000006 35.0 33.0 36.0 25.5 37.0 82-83 32.178749999999994 35.0 33.0 36.0 25.5 37.0 84-85 31.931 35.0 33.0 35.0 25.0 36.5 86-87 31.58975 35.0 33.0 35.0 24.0 36.0 88-89 31.437624999999997 35.0 33.0 35.0 23.5 36.0 90-91 31.273249999999997 35.0 33.0 35.0 24.0 36.0 92-93 30.937875 35.0 32.5 35.0 20.0 35.0 94-95 30.784 35.0 32.5 35.0 19.5 35.0 96-97 30.44925 35.0 32.0 35.0 12.0 35.0 98-99 30.050375 35.0 32.0 35.0 2.0 35.0 100-101 28.190624999999997 33.5 28.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 41.0 3 2.0 4 3.0 5 9.0 6 4.0 7 1.0 8 2.0 9 5.0 10 7.0 11 11.0 12 10.0 13 12.0 14 11.0 15 3.0 16 8.0 17 5.0 18 10.0 19 17.0 20 18.0 21 10.0 22 16.0 23 11.0 24 19.0 25 23.0 26 18.0 27 20.0 28 35.0 29 53.0 30 60.0 31 66.0 32 100.0 33 107.0 34 198.0 35 294.0 36 469.0 37 895.0 38 1209.0 39 218.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.575000000000003 11.825 29.675 28.925 2 27.250000000000004 10.825 26.575 35.35 3 23.125 12.525 29.925 34.425 4 25.674999999999997 11.275 27.6 35.449999999999996 5 26.150000000000002 14.424999999999999 24.474999999999998 34.949999999999996 6 24.05 17.424999999999997 30.45 28.075 7 18.6 23.65 40.025 17.724999999999998 8 18.0 25.525 36.875 19.6 9 18.325 27.525 35.225 18.925 10-11 19.375 28.15 32.125 20.349999999999998 12-13 19.975 26.8 32.3125 20.9125 14-15 20.1125 26.025 31.225 22.6375 16-17 20.8625 26.05 29.275000000000002 23.8125 18-19 20.3375 25.887500000000003 30.0375 23.7375 20-21 20.95 25.324999999999996 29.049999999999997 24.675 22-23 20.9125 24.575 29.262500000000003 25.25 24-25 19.9875 26.25 29.2 24.5625 26-27 21.2 26.375 27.700000000000003 24.725 28-29 20.599999999999998 25.4625 26.825 27.1125 30-31 21.075 25.7875 28.525 24.6125 32-33 21.475 25.412499999999998 28.15 24.962500000000002 34-35 21.675 25.3125 27.6625 25.35 36-37 22.1 25.85 28.1375 23.9125 38-39 21.975 25.912499999999998 27.212500000000002 24.9 40-41 21.4 23.825 27.6125 27.1625 42-43 20.837500000000002 26.6625 28.249999999999996 24.25 44-45 21.9375 26.275 26.375 25.412499999999998 46-47 22.125 25.412499999999998 26.0625 26.400000000000002 48-49 21.05 26.825 27.712500000000002 24.4125 50-51 22.287499999999998 25.387500000000003 26.8 25.525 52-53 21.8125 25.7875 26.3625 26.0375 54-55 20.724999999999998 26.5375 27.987499999999997 24.75 56-57 22.25 26.6 25.8125 25.337500000000002 58-59 21.8875 26.174999999999997 26.450000000000003 25.4875 60-61 22.25 25.575 28.15 24.025 62-63 23.2875 25.887500000000003 25.924999999999997 24.9 64-65 22.787499999999998 25.2125 25.7625 26.237500000000004 66-67 21.7 26.1125 27.6375 24.55 68-69 23.2625 26.0625 26.325 24.349999999999998 70-71 23.375 26.0375 25.874999999999996 24.712500000000002 72-73 22.75 26.237500000000004 25.6125 25.4 74-75 22.8375 26.1 26.3125 24.75 76-77 23.5375 25.912499999999998 25.2125 25.337500000000002 78-79 22.8 26.937499999999996 26.200000000000003 24.0625 80-81 23.0875 26.1 26.237500000000004 24.575 82-83 24.212500000000002 25.2125 24.7875 25.7875 84-85 25.087500000000002 25.8 25.7625 23.35 86-87 25.8 25.7625 24.962500000000002 23.474999999999998 88-89 24.075 26.0125 25.15 24.762500000000003 90-91 24.925 25.6125 26.5625 22.900000000000002 92-93 25.137500000000003 25.362499999999997 24.625 24.875 94-95 25.0 25.0625 25.7875 24.15 96-97 25.650000000000002 25.624999999999996 25.2375 23.4875 98-99 23.9 26.5 25.374999999999996 24.224999999999998 100-101 25.319789315274644 25.09405568096313 24.667669927263606 24.91848507649862 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 27.0 1 18.0 2 6.5 3 2.5 4 0.5 5 1.0 6 1.5 7 1.5 8 1.5 9 2.0 10 2.5 11 2.0 12 1.0 13 0.0 14 0.5 15 1.0 16 1.0 17 2.0 18 2.0 19 1.5 20 1.0 21 2.0 22 5.5 23 6.0 24 3.0 25 2.0 26 2.0 27 3.5 28 7.0 29 10.0 30 16.0 31 20.0 32 21.0 33 29.0 34 41.5 35 58.0 36 70.0 37 76.5 38 89.5 39 109.5 40 129.5 41 168.5 42 204.0 43 206.5 44 203.0 45 198.5 46 189.0 47 190.5 48 185.5 49 159.0 50 155.0 51 163.5 52 133.5 53 109.0 54 93.5 55 80.0 56 76.5 57 70.0 58 66.0 59 49.5 60 49.5 61 49.0 62 45.0 63 40.5 64 29.5 65 31.5 66 32.5 67 29.5 68 29.0 69 32.0 70 33.5 71 26.0 72 19.0 73 19.0 74 16.0 75 9.5 76 10.0 77 9.5 78 6.0 79 4.5 80 4.0 81 3.5 82 2.5 83 1.5 84 0.5 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.325 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.18179493735617 96.975 2 0.6136537969828688 1.2 3 0.051137816415239075 0.15 4 0.025568908207619537 0.1 5 0.051137816415239075 0.25 6 0.025568908207619537 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.051137816415239075 1.175 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 37 0.9249999999999999 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 10 0.25 No Hit TCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 6 0.15 No Hit TGGGGGTGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 5 0.125 No Hit TCTTCGTATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10-11 0.125 0.0 0.0 0.0 0.0 12-13 0.125 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.125 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.15 0.0 0.0 0.0 0.0 26-27 0.15 0.0 0.0 0.0 0.0 28-29 0.15 0.0 0.0 0.0 0.0 30-31 0.175 0.0 0.0 0.0 0.0 32-33 0.2 0.0 0.0 0.0 0.0 34-35 0.275 0.0 0.0 0.0 0.0 36-37 0.3625 0.0 0.0 0.0 0.0 38-39 0.4375 0.0 0.0 0.0 0.0 40-41 0.625 0.0 0.0 0.0 0.0 42-43 0.8125 0.0 0.0 0.0 0.0 44-45 0.975 0.0 0.0 0.0 0.0 46-47 1.1375000000000002 0.0 0.0 0.0 0.0 48-49 1.2875 0.0 0.0 0.0 0.0 50-51 1.5125 0.0 0.0 0.0 0.0 52-53 1.8875 0.0 0.0 0.0 0.0 54-55 2.1125 0.0 0.0 0.0 0.0 56-57 2.3625 0.0 0.0 0.0 0.0 58-59 2.5375 0.0 0.0 0.0 0.0 60-61 2.925 0.0 0.0 0.0 0.0 62-63 3.2 0.0 0.0 0.0 0.0 64-65 3.5875 0.0 0.0 0.0 0.0 66-67 4.025 0.0 0.0 0.0 0.0 68-69 4.425000000000001 0.0 0.0 0.0 0.0 70-71 4.800000000000001 0.0 0.0 0.0 0.0 72-73 5.4 0.0 0.0 0.0 0.0 74-75 5.9 0.0 0.0 0.0 0.0 76-77 6.525 0.0 0.0 0.0 0.0 78-79 7.075 0.0 0.0 0.0 0.0 80-81 7.6625 0.0 0.0 0.0 0.0 82-83 8.3625 0.0 0.0 0.0 0.0 84-85 9.1375 0.0 0.0 0.0 0.0 86-87 9.9 0.0 0.0 0.0 0.0 88-89 10.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCATCA 15 0.009957196 47.5 74-75 >>END_MODULE Read 2031833 spots for ERR3317426.sra Written 2031833 spots for ERR3317426.sra Read 2031833 spots for ERR3317426.sra Written 2031833 spots for ERR3317426.sra Read 2031833 spots for ERR3317426.sra Written 2031833 spots for ERR3317426.sra Read 2031833 spots for ERR3317426.sra Written 2031833 spots for ERR3317426.sra Read 2031833 spots for ERR3317426.sra Written 2031833 spots for ERR3317426.sra Read 2031833 spots for ERR3317426.sra Written 2031833 spots for ERR3317426.sra Read 2031833 spots for ERR3317426.sra Written 2031833 spots for ERR3317426.sra Read 2031833 spots for ERR3317426.sra Written 2031833 spots for ERR3317426.sra Read 2031833 spots for ERR3317426.sra Written 2031833 spots for ERR3317426.sra Read 2031833 spots for ERR3317426.sra Written 2031833 spots for ERR3317426.sra Read 2031833 spots for ERR3317426.sra Written 2031833 spots for ERR3317426.sra Read 2031833 spots for ERR3317426.sra Written 2031833 spots for ERR3317426.sra Read 2031833 spots for ERR3317426.sra Written 2031833 spots for ERR3317426.sra Read 2031833 spots for ERR3317426.sra Written 2031833 spots for ERR3317426.sra Read 2031833 spots for ERR3317426.sra Written 2031833 spots for ERR3317426.sra Read 2031833 spots for ERR3317426.sra Written 2031833 spots for ERR3317426.sra Read 2031833 spots for ERR3317426.sra Written 2031833 spots for ERR3317426.sra Read 2031833 spots for ERR3317426.sra Written 2031833 spots for ERR3317426.sra Read 2031833 spots for ERR3317426.sra Written 2031833 spots for ERR3317426.sra Read 2031845 spots for ERR3317426.sra Written 2031845 spots for ERR3317426.sra SRR ids: ['ERR3317426.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ruo_8bcd ERR3317426.sra spots: 40636672 blocks: [[1, 2031833], [2031834, 4063666], [4063667, 6095499], [6095500, 8127332], [8127333, 10159165], [10159166, 12190998], [12190999, 14222831], [14222832, 16254664], [16254665, 18286497], [18286498, 20318330], [20318331, 22350163], [22350164, 24381996], [24381997, 26413829], [26413830, 28445662], [28445663, 30477495], [30477496, 32509328], [32509329, 34541161], [34541162, 36572994], [36572995, 38604827], [38604828, 40636672]] ERR3317426 file size 9780309 ERR3317426 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317426 ERR3317426_1.fastq ERR3317426_2.fastq Input file: ERR3317426_1.fastq Paired file: ERR3317426_2.fastq trimmed: ERR3317426-trimmed-pair1.fastq, ERR3317426-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:02:10 2024 >> started Tue Dec 10 09:02:46 2024 >> done (36.716s) 40636672 read pairs processed; of these: 292242 ( 0.72%) short read pairs filtered out after trimming by size control 637400 ( 1.57%) empty read pairs filtered out after trimming by size control 39707030 (97.71%) read pairs available; of these: 13821391 (34.81%) trimmed read pairs available after processing 25885639 (65.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1549 0.00% 19 1728 0.00% 20 2686 0.01% 21 3192 0.01% 22 3521 0.01% 23 4791 0.01% 24 5604 0.01% 25 6903 0.02% 26 7979 0.02% 27 9756 0.02% 28 9896 0.02% 29 12590 0.03% 30 13403 0.03% 31 19543 0.05% 32 17135 0.04% 33 17958 0.05% 34 20980 0.05% 35 21710 0.05% 36 24340 0.06% 37 24758 0.06% 38 28957 0.07% 39 31901 0.08% 40 30640 0.08% 41 33231 0.08% 42 34667 0.09% 43 36758 0.09% 44 38699 0.10% 45 40062 0.10% 46 42257 0.11% 47 48292 0.12% 48 49676 0.13% 49 51574 0.13% 50 58191 0.15% 51 57418 0.14% 52 59529 0.15% 53 64721 0.16% 54 67104 0.17% 55 72657 0.18% 56 76622 0.19% 57 80785 0.20% 58 89258 0.22% 59 104216 0.26% 60 114922 0.29% 61 124066 0.31% 62 130486 0.33% 63 136084 0.34% 64 144031 0.36% 65 150056 0.38% 66 165689 0.42% 67 165501 0.42% 68 168743 0.42% 69 171512 0.43% 70 175220 0.44% 71 181027 0.46% 72 187716 0.47% 73 195123 0.49% 74 196762 0.50% 75 197212 0.50% 76 191983 0.48% 77 203750 0.51% 78 218240 0.55% 79 230232 0.58% 80 236059 0.59% 81 231190 0.58% 82 230529 0.58% 83 239567 0.60% 84 246353 0.62% 85 261902 0.66% 86 262171 0.66% 87 265592 0.67% 88 271265 0.68% 89 302184 0.76% 90 285188 0.72% 91 299268 0.75% 92 320517 0.81% 93 339954 0.86% 94 369818 0.93% 95 408433 1.03% 96 457823 1.15% 97 532464 1.34% 98 639778 1.61% 99 851388 2.14% 100 1894356 4.77% 101 25885639 65.19% 39707030 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.23 fanout-score-rank=12 prefix-density=0.59 prefix-fanout=2.9 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=19.50 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.4 sequence=AGGTGAAGCTGGTGACGCCGGAGGGGGAGGTGGAGATGGAGGTCCCCGACGACGTGTACATCCTTGACCACTTCGAGGAAGAAGGGATCGACCTGCCCTACTCGTGCAGGGCCGGGTCGTGCTCGTCGTGCGCCGGCAAGGTGATCTCCGGCGAGGTGGACCAGTCGGACCAGAGCTTCCTCGACGACGACCAGATGGAGGCCGGGTGGGTGCTCACCTGCCACGCATACCCCAAGTCCGACCTCGTCATCGAGACGCACAAGGAAGAAGAGCTCACCGCCTAAGTTTTTAGTCTTCAGCTTTTGCAAGAGTGTCTGATGATATCATAATCTCTCTAAGCTCCATGGATCTTATCGTGCATCGATTTGGTTGCTGCTGTGCGAGCGAGCTTGAATGAAATGCTCAAGTAATATTATGTGTTCCTCTTTTTTGTACTACCCCTGCCTGAGATCGATCCATACGGTCAAATTACTGCTGCTGCT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=4.00 fanout-score-rank=20 prefix-density=0.27 prefix-fanout=3.1 sequence=CTAGCAGCAGCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=22 fanout-score=131.89 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=14.3 sequence=CCTTCTTCTCCGGGTCC ERR3317426 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:03:22 Started mapping on | Dec 10 09:03:22 Finished on | Dec 10 09:05:22 Mapping speed, Million of reads per hour | 1191.21 Number of input reads | 39707030 Average input read length | 189 UNIQUE READS: Uniquely mapped reads number | 35816286 Uniquely mapped reads % | 90.20% Average mapped length | 188.23 Number of splices: Total | 20746349 Number of splices: Annotated (sjdb) | 19702875 Number of splices: GT/AG | 20446546 Number of splices: GC/AG | 265584 Number of splices: AT/AC | 14998 Number of splices: Non-canonical | 19221 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.00% Deletion average length | 1.24 Insertion rate per base | 0.00% Insertion average length | 1.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2673956 % of reads mapped to multiple loci | 6.73% Number of reads mapped to too many loci | 78876 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.85% % of reads unmapped: other | 1.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1406495 1406495 1406495 N_multimapping 2673956 2673956 2673956 N_noFeature 1303304 3236556 33147436 N_ambiguous 1037436 340913 18900 UnstrandedReadsAssigned:33475546 PositiveStrandReadsAssigned:32238817 NegativeStrandReadsAssigned:2649950 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=97 echo kmer=93 ERR3317426 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317426-trimmed-pair1.fastq ERR3317426-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,707,030 reads, 34,208,129 reads pseudoaligned [quant] estimated average fragment length: 176.925 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,329 rounds 52973 ERR3317426.ke.tsv 35125 ERR3317426.se.tsv 88098 total ==> ERR3317426.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 760.198 0 0 PNS24247 1044 868.075 46.6089 2.36426 PNS24249 1928 1752.07 162.303 4.07903 PNS24246 1044 868.075 46.6089 2.36426 PNS24248 1044 868.075 46.6089 2.36426 PNS24244 1471 1295.07 276.871 9.41383 PNS24243 293 139.934 1 0.314675 KQK14069 1603 1427.07 5073.65 156.552 KQK14071 474 303.547 50.0521 7.26072 ==> ERR3317426.se.tsv <== BRADI_1g14170v3 6346 BRADI_1g53295v3 204 BRADI_1g59795v3 1025 BRADI_1g07683v3 0 BRADI_1g00485v3 120 BRADI_1g20270v3 2773 BRADI_1g74790v3 202 BRADI_1g09890v3 5 BRADI_1g77505v3 467 BRADI_1g48960v3 0 ERR3317426 completed mapping pipeline successfully