Starting /dee2/code/volunteer_pipeline.sh ERR3317428 current disk space = 1525058973696 free memory = 1524367064 ERR3317428 SRAfilesize 5d0594c6d2367d444cb03e1350d3edbb ERR3317428.sra ERR3317428.sra file validated ERR3317428 is paired end ERR3317428 is conventional basespace ERR3317428 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317428_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7825 33.0 33.0 33.0 33.0 33.0 2 32.84775 33.0 33.0 33.0 33.0 33.0 3 32.7925 33.0 33.0 33.0 33.0 33.0 4 32.834 33.0 33.0 33.0 33.0 33.0 5 32.828 33.0 33.0 33.0 33.0 33.0 6 36.6715 37.0 37.0 37.0 37.0 37.0 7 36.648 37.0 37.0 37.0 37.0 37.0 8 36.747 37.0 37.0 37.0 37.0 37.0 9 36.71775 37.0 37.0 37.0 37.0 37.0 10-11 36.7465 37.0 37.0 37.0 37.0 37.0 12-13 36.69775 37.0 37.0 37.0 37.0 37.0 14-15 36.685375 37.0 37.0 37.0 37.0 37.0 16-17 36.745999999999995 37.0 37.0 37.0 37.0 37.0 18-19 36.747 37.0 37.0 37.0 37.0 37.0 20-21 36.727374999999995 37.0 37.0 37.0 37.0 37.0 22-23 36.71362499999999 37.0 37.0 37.0 37.0 37.0 24-25 36.706 37.0 37.0 37.0 37.0 37.0 26-27 36.63325 37.0 37.0 37.0 37.0 37.0 28-29 36.664375 37.0 37.0 37.0 37.0 37.0 30-31 36.663250000000005 37.0 37.0 37.0 37.0 37.0 32-33 36.681875000000005 37.0 37.0 37.0 37.0 37.0 34-35 36.586125 37.0 37.0 37.0 37.0 37.0 36-37 36.60725 37.0 37.0 37.0 37.0 37.0 38-39 36.577125 37.0 37.0 37.0 37.0 37.0 40-41 36.463625 37.0 37.0 37.0 37.0 37.0 42-43 36.260999999999996 37.0 37.0 37.0 37.0 37.0 44-45 36.03975 37.0 37.0 37.0 37.0 37.0 46-47 35.9705 37.0 37.0 37.0 37.0 37.0 48-49 35.72 37.0 37.0 37.0 37.0 37.0 50-51 35.66525 37.0 37.0 37.0 37.0 37.0 52-53 35.756625 37.0 37.0 37.0 37.0 37.0 54-55 36.062125 37.0 37.0 37.0 37.0 37.0 56-57 36.092625 37.0 37.0 37.0 37.0 37.0 58-59 36.213750000000005 37.0 37.0 37.0 37.0 37.0 60-61 36.327 37.0 37.0 37.0 37.0 37.0 62-63 36.37975 37.0 37.0 37.0 37.0 37.0 64-65 36.414125 37.0 37.0 37.0 37.0 37.0 66-67 36.403999999999996 37.0 37.0 37.0 37.0 37.0 68-69 36.25025 37.0 37.0 37.0 37.0 37.0 70-71 36.307625 37.0 37.0 37.0 37.0 37.0 72-73 36.282 37.0 37.0 37.0 37.0 37.0 74-75 36.20975 37.0 37.0 37.0 37.0 37.0 76-77 36.08525 37.0 37.0 37.0 37.0 37.0 78-79 36.08425 37.0 37.0 37.0 37.0 37.0 80-81 35.931124999999994 37.0 37.0 37.0 37.0 37.0 82-83 35.537499999999994 37.0 37.0 37.0 37.0 37.0 84-85 35.471000000000004 37.0 37.0 37.0 37.0 37.0 86-87 35.490125000000006 37.0 37.0 37.0 37.0 37.0 88-89 35.481750000000005 37.0 37.0 37.0 37.0 37.0 90-91 35.4185 37.0 37.0 37.0 37.0 37.0 92-93 35.423375 37.0 37.0 37.0 37.0 37.0 94-95 35.445 37.0 37.0 37.0 37.0 37.0 96-97 35.422375 37.0 37.0 37.0 37.0 37.0 98-99 35.257625 37.0 37.0 37.0 35.0 37.0 100-101 35.304625 37.0 37.0 37.0 37.0 37.0 102-103 35.2655 37.0 37.0 37.0 37.0 37.0 104-105 35.209625 37.0 37.0 37.0 35.0 37.0 106-107 35.199875000000006 37.0 37.0 37.0 33.0 37.0 108-109 35.193875 37.0 37.0 37.0 33.0 37.0 110-111 35.078375 37.0 37.0 37.0 33.0 37.0 112-113 35.15875 37.0 37.0 37.0 35.0 37.0 114-115 35.016999999999996 37.0 37.0 37.0 33.0 37.0 116-117 34.948125000000005 37.0 37.0 37.0 33.0 37.0 118-119 34.8805 37.0 37.0 37.0 33.0 37.0 120-121 34.793 37.0 37.0 37.0 33.0 37.0 122-123 34.595875 37.0 37.0 37.0 33.0 37.0 124-125 33.427125000000004 37.0 37.0 37.0 17.5 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 5.0 9 1.0 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 1.0 17 3.0 18 4.0 19 3.0 20 4.0 21 4.0 22 13.0 23 26.0 24 46.0 25 8.0 26 7.0 27 7.0 28 14.0 29 18.0 30 34.0 31 40.0 32 63.0 33 82.0 34 114.0 35 240.0 36 3257.0 >>END_MODULE >>Per base sequence content pass #Base G A T C 1 23.400000000000002 25.4 19.400000000000002 31.8 2 24.325 24.325 19.425 31.924999999999997 3 24.224999999999998 23.825 22.25 29.7 4 26.200000000000003 21.825 20.4 31.574999999999996 5 28.525 20.875 19.775000000000002 30.825000000000003 6 28.449999999999996 22.900000000000002 22.925 25.724999999999998 7 23.05 26.075 26.75 24.125 8 24.975 25.575 27.650000000000002 21.8 9 24.7 28.249999999999996 27.950000000000003 19.1 10-11 25.5625 26.825 25.95 21.6625 12-13 26.487500000000004 24.85 25.4375 23.225 14-15 24.762500000000003 25.825 25.724999999999998 23.6875 16-17 24.975 24.4 25.7125 24.9125 18-19 23.7875 24.3875 26.150000000000002 25.674999999999997 20-21 23.799999999999997 23.674999999999997 26.387500000000003 26.137500000000003 22-23 24.075 23.65 26.8375 25.4375 24-25 24.15 24.087500000000002 26.5375 25.224999999999998 26-27 24.8 23.1 26.637499999999996 25.4625 28-29 25.087500000000002 24.525 25.275 25.112499999999997 30-31 23.9375 24.4 26.0625 25.6 32-33 24.425 23.35 26.25 25.974999999999998 34-35 24.4375 24.125 25.35 26.087500000000002 36-37 24.1375 24.2 26.174999999999997 25.4875 38-39 24.925 24.5125 25.424999999999997 25.137500000000003 40-41 25.360050093926112 25.24733876017533 23.681903569192237 25.710707576706326 42-43 24.32976714915041 24.959093769666456 25.802391441157962 24.908747640025172 44-45 25.08556217518063 23.957409050576754 26.403853466852578 24.55317530739004 46-47 25.82857142857143 23.86031746031746 25.536507936507935 24.774603174603175 48-49 24.55425369332654 24.108507386653084 26.579215486500257 24.758023433520123 50-51 24.830757440286117 23.98773789756035 25.316132328522162 25.86537233363137 52-53 25.870646766169152 24.174001785942085 24.875621890547265 25.079729557341494 54-55 24.552558608520293 24.338290899924374 26.959919334509706 24.149231157045627 56-57 25.422020660115898 23.796926177878557 25.636180398085163 25.144872763920382 58-59 25.69706103993971 24.001507159005275 24.466214518965085 25.83521728208993 60-61 25.337500000000002 23.8125 25.912499999999998 24.9375 62-63 25.424999999999997 24.0375 26.775 23.7625 64-65 24.675 23.25 26.6625 25.412499999999998 66-67 24.6625 24.3625 26.575 24.4 68-69 24.349999999999998 24.7875 25.8625 25.0 70-71 25.124999999999996 24.6875 25.624999999999996 24.5625 72-73 26.025 25.25 24.7875 23.9375 74-75 24.6625 26.1625 25.4625 23.7125 76-77 25.7 25.6 24.675 24.025 78-79 24.75 25.5 25.8 23.95 80-81 25.025 25.674999999999997 24.9375 24.3625 82-83 25.174999999999997 25.662499999999998 24.3625 24.8 84-85 25.0125 25.4 24.875 24.712500000000002 86-87 25.45 25.4625 24.575 24.5125 88-89 24.5125 24.6625 24.775 26.05 90-91 24.9 26.0 25.0625 24.0375 92-93 24.474999999999998 25.424999999999997 25.7 24.4 94-95 25.3125 24.325 25.0375 25.324999999999996 96-97 25.3 24.462500000000002 26.7625 23.474999999999998 98-99 25.35 25.137500000000003 26.187500000000004 23.325000000000003 100-101 26.2875 24.474999999999998 23.6875 25.55 102-103 25.0625 25.0125 25.2875 24.637500000000003 104-105 24.975 25.525 24.425 25.074999999999996 106-107 24.837500000000002 25.087500000000002 25.0125 25.0625 108-109 24.1625 26.25 25.3 24.2875 110-111 24.8125 26.625 24.75 23.8125 112-113 24.275 25.662499999999998 24.4375 25.624999999999996 114-115 24.9375 26.2125 24.887500000000003 23.962500000000002 116-117 24.5375 26.8125 23.8625 24.7875 118-119 26.0625 26.3 23.375 24.2625 120-121 24.8125 26.6 24.099999999999998 24.4875 122-123 25.178414924251907 25.629147364467258 24.502316263928883 24.69012144735195 124-125 26.25516464254413 25.103292850882685 24.327031426067357 24.31451108050582 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 4.5 2 4.5 3 2.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.5 22 1.5 23 0.5 24 1.5 25 1.0 26 3.0 27 4.5 28 2.5 29 4.0 30 9.5 31 15.0 32 16.5 33 23.5 34 32.5 35 37.0 36 45.5 37 64.5 38 80.0 39 96.5 40 114.5 41 134.0 42 171.5 43 188.5 44 187.5 45 199.5 46 199.0 47 190.5 48 176.0 49 162.0 50 149.0 51 136.5 52 128.0 53 114.5 54 97.5 55 83.5 56 84.0 57 85.0 58 68.0 59 60.0 60 69.0 61 72.5 62 70.0 63 62.5 64 60.0 65 52.0 66 45.0 67 46.5 68 48.5 69 43.0 70 36.5 71 35.5 72 35.0 73 32.0 74 23.0 75 20.5 76 20.0 77 11.0 78 6.0 79 6.5 80 7.0 81 4.5 82 2.0 83 2.5 84 1.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.1875 42-43 0.6875 44-45 1.3875 46-47 1.5625 48-49 1.8499999999999999 50-51 2.1375 52-53 2.0125 54-55 0.8250000000000001 56-57 0.775 58-59 0.475 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.1625 124-125 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.475 #Duplication Level Percentage of deduplicated Percentage of total 1 98.58938189279303 96.1 2 1.000256476019492 1.95 3 0.20518081559374196 0.6 4 0.025647601949217745 0.1 5 0.025647601949217745 0.125 6 0.05129520389843549 0.3 7 0.05129520389843549 0.35000000000000003 8 0.0 0.0 9 0.025647601949217745 0.22499999999999998 >10 0.025647601949217745 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TATCCCCTGCTTCCCCGCTTCCTCTTCCTCCTCCCCCTCACTCCCCAAGC 10 0.25 No Hit AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATG 9 0.22499999999999998 TruSeq Adapter, Index 5 (100% over 49bp) CCAGTCACCTCAGCGCCCTCCCTCCTTGTCCCCGATGGCCCGCACGAAGC 7 0.17500000000000002 No Hit AAATCCCTTAACGAGGATCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCG 7 0.17500000000000002 No Hit CCACGCACACCAGAGCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCA 6 0.15 No Hit CCCCCTACCAAGCAGCAGCCATGGCAGCGTCTCTCCAGGCCGCCGCCACC 6 0.15 No Hit CTCCTCCACCGCCACCGCCTCCTCGCGTCCTCATCCCCTGCTCCTCGACT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.225 0.0 0.0 0.0 0.0 2 0.225 0.0 0.0 0.0 0.0 3 0.3 0.0 0.0 0.0 0.0 4 0.375 0.0 0.0 0.0 0.0 5 0.45 0.0 0.0 0.0 0.0 6 0.725 0.0 0.0 0.0 0.0 7 1.525 0.0 0.0 0.0 0.0 8 2.0 0.0 0.0 0.0 0.0 9 2.15 0.0 0.0 0.0 0.0 10-11 2.1624999999999996 0.0 0.0 0.0 0.0 12-13 2.175 0.0 0.0 0.0 0.0 14-15 2.175 0.0 0.0 0.0 0.0 16-17 2.175 0.0 0.0 0.0 0.0 18-19 2.175 0.0 0.0 0.0 0.0 20-21 2.2 0.0 0.0 0.0 0.0 22-23 2.25 0.0 0.0 0.0 0.0 24-25 2.25 0.0 0.0 0.0 0.0 26-27 2.2874999999999996 0.0 0.0 0.0 0.0 28-29 2.35 0.0 0.0 0.0 0.0 30-31 2.375 0.0 0.0 0.0 0.0 32-33 2.375 0.0 0.0 0.0 0.0 34-35 2.4124999999999996 0.0 0.0 0.0 0.0 36-37 2.4625000000000004 0.0 0.0 0.0 0.0 38-39 2.5 0.0 0.0 0.0 0.0 40-41 2.575 0.0 0.0 0.0 0.0 42-43 2.6125 0.0 0.0 0.0 0.0 44-45 2.625 0.0 0.0 0.0 0.0 46-47 2.6375 0.0 0.0 0.0 0.0 48-49 2.6875 0.0 0.0 0.0 0.0 50-51 2.75 0.0 0.0 0.0 0.0 52-53 2.8375000000000004 0.0 0.0 0.0 0.0 54-55 2.85 0.0 0.0 0.0 0.0 56-57 2.8875 0.0 0.0 0.0 0.0 58-59 2.95 0.0 0.0 0.0 0.0 60-61 3.0125 0.0 0.0 0.0 0.0 62-63 3.1500000000000004 0.0 0.0 0.0 0.0 64-65 3.2625 0.0 0.0 0.0 0.0 66-67 3.3625 0.0 0.0 0.0 0.0 68-69 3.45 0.0 0.0 0.0 0.0 70-71 3.625 0.0 0.0 0.0 0.0 72-73 3.75 0.0 0.0 0.0 0.0 74-75 3.9625 0.0 0.0 0.0 0.0 76-77 4.15 0.0 0.0 0.0 0.0 78-79 4.2625 0.0 0.0 0.0 0.0 80-81 4.3875 0.0 0.0 0.0 0.0 82-83 4.5125 0.0 0.0 0.0 0.0 84-85 4.7 0.0 0.0 0.0 0.0 86-87 4.925 0.0 0.0 0.0 0.0 88-89 5.2125 0.0 0.0 0.0 0.0 90-91 5.5625 0.0 0.0 0.0 0.0 92-93 5.75 0.0 0.0 0.0 0.0 94-95 6.0875 0.0 0.0 0.0 0.0 96-97 6.4 0.0 0.0 0.0 0.0 98-99 6.7875 0.0 0.0 0.0 0.0 100-101 6.975 0.0 0.0 0.0 0.0 102-103 7.25 0.0 0.0 0.0 0.0 104-105 7.725 0.0 0.0 0.0 0.0 106-107 8.05 0.0 0.0 0.0 0.0 108-109 8.3875 0.0 0.0 0.0 0.0 110-111 8.875 0.0 0.0 0.0 0.0 112-113 9.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317428 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317428_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.56 33.0 33.0 33.0 33.0 33.0 2 32.5655 33.0 33.0 33.0 33.0 33.0 3 32.51575 33.0 33.0 33.0 33.0 33.0 4 32.51075 33.0 33.0 33.0 33.0 33.0 5 32.49075 33.0 33.0 33.0 33.0 33.0 6 36.25625 37.0 37.0 37.0 37.0 37.0 7 36.32675 37.0 37.0 37.0 37.0 37.0 8 36.2765 37.0 37.0 37.0 37.0 37.0 9 36.28075 37.0 37.0 37.0 37.0 37.0 10-11 36.307875 37.0 37.0 37.0 37.0 37.0 12-13 36.352875 37.0 37.0 37.0 37.0 37.0 14-15 36.256 37.0 37.0 37.0 37.0 37.0 16-17 36.280375 37.0 37.0 37.0 37.0 37.0 18-19 36.27825 37.0 37.0 37.0 37.0 37.0 20-21 36.256249999999994 37.0 37.0 37.0 37.0 37.0 22-23 36.29 37.0 37.0 37.0 37.0 37.0 24-25 36.277125 37.0 37.0 37.0 37.0 37.0 26-27 36.254875 37.0 37.0 37.0 37.0 37.0 28-29 36.290375 37.0 37.0 37.0 37.0 37.0 30-31 36.257625000000004 37.0 37.0 37.0 37.0 37.0 32-33 36.308375 37.0 37.0 37.0 37.0 37.0 34-35 36.3275 37.0 37.0 37.0 37.0 37.0 36-37 36.358374999999995 37.0 37.0 37.0 37.0 37.0 38-39 36.327749999999995 37.0 37.0 37.0 37.0 37.0 40-41 36.307375 37.0 37.0 37.0 37.0 37.0 42-43 36.303625 37.0 37.0 37.0 37.0 37.0 44-45 36.34 37.0 37.0 37.0 37.0 37.0 46-47 36.325374999999994 37.0 37.0 37.0 37.0 37.0 48-49 36.306 37.0 37.0 37.0 37.0 37.0 50-51 36.304 37.0 37.0 37.0 37.0 37.0 52-53 36.322500000000005 37.0 37.0 37.0 37.0 37.0 54-55 36.244625 37.0 37.0 37.0 37.0 37.0 56-57 36.132999999999996 37.0 37.0 37.0 37.0 37.0 58-59 35.89875 37.0 37.0 37.0 37.0 37.0 60-61 35.909625000000005 37.0 37.0 37.0 37.0 37.0 62-63 35.925375 37.0 37.0 37.0 37.0 37.0 64-65 36.150999999999996 37.0 37.0 37.0 37.0 37.0 66-67 36.2055 37.0 37.0 37.0 37.0 37.0 68-69 36.216499999999996 37.0 37.0 37.0 37.0 37.0 70-71 36.16475 37.0 37.0 37.0 37.0 37.0 72-73 36.099000000000004 37.0 37.0 37.0 37.0 37.0 74-75 35.830625 37.0 37.0 37.0 37.0 37.0 76-77 35.469 37.0 37.0 37.0 37.0 37.0 78-79 35.378875 37.0 37.0 37.0 37.0 37.0 80-81 35.294125 37.0 37.0 37.0 37.0 37.0 82-83 35.291 37.0 37.0 37.0 37.0 37.0 84-85 35.297875 37.0 37.0 37.0 37.0 37.0 86-87 35.300125 37.0 37.0 37.0 37.0 37.0 88-89 35.244 37.0 37.0 37.0 37.0 37.0 90-91 35.2545 37.0 37.0 37.0 37.0 37.0 92-93 35.180875 37.0 37.0 37.0 37.0 37.0 94-95 35.197874999999996 37.0 37.0 37.0 37.0 37.0 96-97 35.20125 37.0 37.0 37.0 37.0 37.0 98-99 35.161125 37.0 37.0 37.0 37.0 37.0 100-101 35.168625000000006 37.0 37.0 37.0 37.0 37.0 102-103 35.097625 37.0 37.0 37.0 37.0 37.0 104-105 35.064125 37.0 37.0 37.0 37.0 37.0 106-107 35.00175 37.0 37.0 37.0 37.0 37.0 108-109 34.98075 37.0 37.0 37.0 37.0 37.0 110-111 34.914249999999996 37.0 37.0 37.0 35.0 37.0 112-113 34.881125 37.0 37.0 37.0 33.0 37.0 114-115 34.798125 37.0 37.0 37.0 33.0 37.0 116-117 34.811125000000004 37.0 37.0 37.0 33.0 37.0 118-119 34.67275 37.0 37.0 37.0 33.0 37.0 120-121 34.687125 37.0 37.0 37.0 33.0 37.0 122-123 34.568875 37.0 37.0 37.0 33.0 37.0 124-125 33.056625 37.0 35.0 37.0 17.5 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 3.0 4 1.0 5 3.0 6 3.0 7 0.0 8 1.0 9 0.0 10 1.0 11 1.0 12 3.0 13 5.0 14 3.0 15 4.0 16 2.0 17 3.0 18 6.0 19 2.0 20 12.0 21 10.0 22 63.0 23 14.0 24 6.0 25 4.0 26 9.0 27 14.0 28 20.0 29 21.0 30 26.0 31 29.0 32 26.0 33 51.0 34 65.0 35 175.0 36 3395.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.35 14.575 26.700000000000003 25.374999999999996 2 29.882470617654416 13.87846961740435 21.655413853463365 34.583645911477866 3 26.62825651302605 14.529058116232466 25.125250501002007 33.71743486973948 4 26.842105263157894 14.110275689223057 25.513784461152884 33.53383458646616 5 31.66207069440963 15.367259964903484 21.609425921283528 31.361243419403362 6 32.52256770310933 16.574724172517552 26.178535606820464 24.72417251755266 7 25.050150451354064 27.331995987963893 31.519558676028087 16.098294884653964 8 19.28284854563691 27.256770310932797 33.52557673019057 19.934804413239718 9 24.448345035105316 29.58876629889669 27.883650952858574 18.079237713139417 10-11 22.464585683841044 27.265889432117334 29.986210354769966 20.283314529271657 12-13 21.51184655885671 27.215745267644476 28.218628557101667 23.05377961639714 14-15 21.351554663991976 26.64242728184554 27.39468405215647 24.611334002006018 16-17 21.063189568706118 26.980942828485453 26.06569709127382 25.890170511534606 18-19 23.746238716148447 26.165997993981943 25.22567703109328 24.86208625877633 20-21 22.893681043129387 26.90571715145436 26.993480441323968 23.207121364092277 22-23 22.484020553954128 25.328988595062036 26.10602832435142 26.080962526632412 24-25 23.53678405815265 26.043363830053888 25.993232234615864 24.42661987717759 26-27 24.050632911392405 27.083594435392904 23.93783682165685 24.92793583155784 28-29 24.50845335003131 26.637445209768316 22.40450845335003 26.449592986850345 30-31 23.954420235411973 27.64838467317806 24.78086651640371 23.61632857500626 32-33 24.496434380082572 27.886901038408606 24.046040285249592 23.570624296259226 34-35 24.73104828621466 26.90768076057043 22.016512384288216 26.344758568926697 36-37 23.608853319995 26.722520945354507 25.472052019507313 24.19657371514318 38-39 23.8375 26.1125 24.875 25.174999999999997 40-41 24.325 26.450000000000003 23.35 25.874999999999996 42-43 23.0 27.6875 25.124999999999996 24.1875 44-45 23.4875 26.974999999999998 24.6 24.9375 46-47 23.7875 26.1125 23.7625 26.337500000000002 48-49 23.3875 26.237500000000004 25.324999999999996 25.05 50-51 24.6125 25.837500000000002 24.95 24.6 52-53 23.724999999999998 25.974999999999998 24.087500000000002 26.2125 54-55 24.101215082049354 26.481272704497055 24.201428034573468 25.21608417888012 56-57 23.9638281838734 27.279577995478522 23.888470233609645 24.868123587038433 58-59 22.71117855336368 26.820940819423367 24.582701062215477 25.885179564997472 60-61 23.44993054678621 27.124636949109735 24.801111251420636 24.62432125268342 62-63 23.543505674653215 27.33921815889029 23.972257250945773 25.145018915510718 64-65 23.446292359634864 27.27272727272727 24.571714392897338 24.70926597474053 66-67 23.01726294721041 29.00925694270703 24.26820115086315 23.705278959219413 68-69 23.474999999999998 29.125 22.775000000000002 24.625 70-71 23.8625 29.5375 22.7375 23.8625 72-73 23.29041130141268 27.990998874859358 24.253031628953618 24.46555819477435 74-75 23.280820205051263 27.94448612153038 24.58114528632158 24.193548387096776 76-77 23.5728592889334 28.217325988983475 22.759138708062093 25.450676014021035 78-79 23.449830890642616 28.022046849555306 23.412251033446076 25.115871226356006 80-81 23.251441464026072 28.03960892454249 23.677613436951617 25.03133617447982 82-83 23.48294884653962 28.372617853560683 22.27933801404213 25.86509528585757 84-85 24.749247743229688 27.206619859578733 23.432798395185557 24.611334002006018 86-87 24.837011033099298 26.86810431293882 24.072216649949848 24.222668004012036 88-89 24.70219435736677 26.921630094043884 22.608150470219435 25.768025078369906 90-91 24.63640922768305 28.36008024072217 23.395185556670008 23.608324974924773 92-93 24.63640922768305 27.0937813440321 23.946840521564695 24.32296890672016 94-95 25.02507522567703 26.592276830491475 23.771313941825476 24.611334002006018 96-97 24.473420260782348 27.62036108324975 23.64593781344032 24.26028084252758 98-99 25.169215342191027 26.89897217347706 23.276510403609926 24.655302080721984 100-101 24.912236710130394 26.71765295887663 23.119358074222667 25.25075225677031 102-103 25.08461827754795 26.95248840416197 23.918766453553967 24.044126864736114 104-105 24.89033713497932 26.757739065045744 24.088231607970922 24.26369219200401 106-107 26.01177797268513 26.31249216890114 23.104874075930333 24.5708557824834 108-109 24.38627254509018 27.11673346693387 23.935370741482966 24.561623246492985 110-111 25.291243893273208 27.082550419641738 22.823499937366904 24.80270574971815 112-113 24.380165289256198 27.18507387928876 23.541197094916104 24.893563736538944 114-115 25.084448892781186 27.236331790316527 22.744901789065434 24.934317527836857 116-117 24.86865148861646 26.745058794095574 23.91793845384038 24.468351263447584 118-119 25.50025012506253 27.026013006503252 22.373686843421712 25.100050025012504 120-121 24.1875 28.287499999999998 23.3875 24.1375 122-123 26.053256657082137 27.240905113139142 23.29041130141268 23.415426928366045 124-125 25.6125 25.8625 24.575 23.95 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 2.0 2 1.5 3 0.5 4 0.5 5 1.5 6 1.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 2.0 21 2.0 22 1.5 23 2.0 24 3.0 25 4.0 26 4.0 27 4.5 28 5.5 29 9.0 30 13.0 31 21.5 32 26.0 33 27.0 34 37.5 35 46.5 36 57.5 37 73.5 38 91.5 39 109.0 40 136.5 41 162.0 42 178.5 43 189.0 44 198.0 45 198.5 46 182.5 47 178.0 48 175.5 49 161.0 50 154.5 51 143.5 52 129.5 53 132.0 54 112.0 55 89.0 56 78.5 57 68.0 58 61.0 59 58.5 60 59.0 61 54.5 62 48.0 63 43.0 64 40.5 65 42.5 66 43.5 67 39.0 68 36.0 69 31.0 70 29.5 71 34.5 72 31.0 73 25.5 74 19.5 75 14.0 76 15.0 77 16.0 78 15.0 79 9.0 80 5.0 81 4.0 82 3.0 83 1.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.2 4 0.25 5 0.27499999999999997 6 0.3 7 0.3 8 0.3 9 0.3 10-11 0.2875 12-13 0.2875 14-15 0.3 16-17 0.3 18-19 0.3 20-21 0.3 22-23 0.2625 24-25 0.2625 26-27 0.2625 28-29 0.1875 30-31 0.17500000000000002 32-33 0.08750000000000001 34-35 0.075 36-37 0.0375 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.21250000000000002 56-57 0.475 58-59 1.15 60-61 1.0125 62-63 0.8750000000000001 64-65 0.0375 66-67 0.075 68-69 0.0 70-71 0.0 72-73 0.0125 74-75 0.025 76-77 0.15 78-79 0.21250000000000002 80-81 0.27499999999999997 82-83 0.3 84-85 0.3 86-87 0.3 88-89 0.3125 90-91 0.3 92-93 0.3 94-95 0.3 96-97 0.3 98-99 0.27499999999999997 100-101 0.3 102-103 0.2875 104-105 0.2625 106-107 0.2375 108-109 0.2 110-111 0.21250000000000002 112-113 0.17500000000000002 114-115 0.08750000000000001 116-117 0.075 118-119 0.05 120-121 0.0 122-123 0.0125 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3426042983565 98.225 2 0.5056890012642226 1.0 3 0.05056890012642225 0.15 4 0.0 0.0 5 0.05056890012642225 0.25 6 0.025284450063211124 0.15 7 0.0 0.0 8 0.0 0.0 9 0.025284450063211124 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCC 9 0.22499999999999998 Illumina Single End PCR Primer 1 (100% over 50bp) TCTTCGTATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 6 0.15 No Hit TCGGGGATTCGGTGGCGGTGGAGGCAACGGCGACGGCGCGGCGGCGGCGG 5 0.125 No Hit CGGGGTCAGCCGAGAGCCCGGCGGTGTCCCACCCGTAATCGCCGGGGAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.225 0.0 0.0 0.0 0.0 2 0.225 0.0 0.0 0.0 0.0 3 0.3 0.0 0.0 0.0 0.0 4 0.375 0.0 0.0 0.0 0.0 5 0.45 0.0 0.0 0.0 0.0 6 0.725 0.0 0.0 0.0 0.0 7 1.5 0.0 0.0 0.0 0.0 8 1.95 0.0 0.0 0.0 0.0 9 2.1 0.0 0.0 0.0 0.0 10-11 2.1125 0.0 0.0 0.0 0.0 12-13 2.125 0.0 0.0 0.0 0.0 14-15 2.125 0.0 0.0 0.0 0.0 16-17 2.125 0.0 0.0 0.0 0.0 18-19 2.125 0.0 0.0 0.0 0.0 20-21 2.15 0.0 0.0 0.0 0.0 22-23 2.2 0.0 0.0 0.0 0.0 24-25 2.2 0.0 0.0 0.0 0.0 26-27 2.2375 0.0 0.0 0.0 0.0 28-29 2.3 0.0 0.0 0.0 0.0 30-31 2.325 0.0 0.0 0.0 0.0 32-33 2.325 0.0 0.0 0.0 0.0 34-35 2.3625 0.0 0.0 0.0 0.0 36-37 2.425 0.0 0.0 0.0 0.0 38-39 2.45 0.0 0.0 0.0 0.0 40-41 2.55 0.0 0.0 0.0 0.0 42-43 2.5875000000000004 0.0 0.0 0.0 0.0 44-45 2.6 0.0 0.0 0.0 0.0 46-47 2.6125 0.0 0.0 0.0 0.0 48-49 2.6624999999999996 0.0 0.0 0.0 0.0 50-51 2.7249999999999996 0.0 0.0 0.0 0.0 52-53 2.8125 0.0 0.0 0.0 0.0 54-55 2.825 0.0 0.0 0.0 0.0 56-57 2.8625 0.0 0.0 0.0 0.0 58-59 2.95 0.0 0.0 0.0 0.0 60-61 3.0 0.0 0.0 0.0 0.0 62-63 3.075 0.0 0.0 0.0 0.0 64-65 3.1625 0.0 0.0 0.0 0.0 66-67 3.2625 0.0 0.0 0.0 0.0 68-69 3.35 0.0 0.0 0.0 0.0 70-71 3.5250000000000004 0.0 0.0 0.0 0.0 72-73 3.6625 0.0 0.0 0.0 0.0 74-75 3.8875 0.0 0.0 0.0 0.0 76-77 4.1 0.0 0.0 0.0 0.0 78-79 4.2375 0.0 0.0 0.0 0.0 80-81 4.3625 0.0 0.0 0.0 0.0 82-83 4.4625 0.0 0.0 0.0 0.0 84-85 4.625 0.0 0.0 0.0 0.0 86-87 4.9 0.0 0.0 0.0 0.0 88-89 5.2125 0.0 0.0 0.0 0.0 90-91 5.525 0.0 0.0 0.0 0.0 92-93 5.7 0.0 0.0 0.0 0.0 94-95 6.025 0.0 0.0 0.0 0.0 96-97 6.3375 0.0 0.0 0.0 0.0 98-99 6.6875 0.0 0.0 0.0 0.0 100-101 6.875 0.0 0.0 0.0 0.0 102-103 7.125 0.0 0.0 0.0 0.0 104-105 7.525 0.0 0.0 0.0 0.0 106-107 7.9 0.0 0.0 0.0 0.0 108-109 8.2375 0.0 0.0 0.0 0.0 110-111 8.6375 0.0 0.0 0.0 0.0 112-113 9.024999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTGCTC 25 0.0019097715 71.4 8 GTGCTCT 25 0.0019097715 71.4 9 TGGTGCC 15 0.0040846216 59.5 84-85 GTGTGCT 30 0.003934916 59.5 7 >>END_MODULE Read 949579 spots for ERR3317428.sra Written 949579 spots for ERR3317428.sra Read 949579 spots for ERR3317428.sra Written 949579 spots for ERR3317428.sra Read 949579 spots for ERR3317428.sra Written 949579 spots for ERR3317428.sra Read 949579 spots for ERR3317428.sra Written 949579 spots for ERR3317428.sra Read 949579 spots for ERR3317428.sra Written 949579 spots for ERR3317428.sra Read 949579 spots for ERR3317428.sra Written 949579 spots for ERR3317428.sra Read 949579 spots for ERR3317428.sra Written 949579 spots for ERR3317428.sra Read 949579 spots for ERR3317428.sra Written 949579 spots for ERR3317428.sra Read 949579 spots for ERR3317428.sra Written 949579 spots for ERR3317428.sra Read 949579 spots for ERR3317428.sra Written 949579 spots for ERR3317428.sra Read 949579 spots for ERR3317428.sra Written 949579 spots for ERR3317428.sra Read 949590 spots for ERR3317428.sra Written 949590 spots for ERR3317428.sra Read 949579 spots for ERR3317428.sra Written 949579 spots for ERR3317428.sra Read 949579 spots for ERR3317428.sra Written 949579 spots for ERR3317428.sra Read 949579 spots for ERR3317428.sra Written 949579 spots for ERR3317428.sra Read 949579 spots for ERR3317428.sra Written 949579 spots for ERR3317428.sra Read 949579 spots for ERR3317428.sra Written 949579 spots for ERR3317428.sra Read 949579 spots for ERR3317428.sra Written 949579 spots for ERR3317428.sra Read 949579 spots for ERR3317428.sra Written 949579 spots for ERR3317428.sra Read 949579 spots for ERR3317428.sra Written 949579 spots for ERR3317428.sra SRR ids: ['ERR3317428.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fy8niy_r ERR3317428.sra spots: 18991591 blocks: [[1, 949579], [949580, 1899158], [1899159, 2848737], [2848738, 3798316], [3798317, 4747895], [4747896, 5697474], [5697475, 6647053], [6647054, 7596632], [7596633, 8546211], [8546212, 9495790], [9495791, 10445369], [10445370, 11394948], [11394949, 12344527], [12344528, 13294106], [13294107, 14243685], [14243686, 15193264], [15193265, 16142843], [16142844, 17092422], [17092423, 18042001], [18042002, 18991591]] ERR3317428 file size 5449509 ERR3317428 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317428 ERR3317428_1.fastq ERR3317428_2.fastq Input file: ERR3317428_1.fastq Paired file: ERR3317428_2.fastq trimmed: ERR3317428-trimmed-pair1.fastq, ERR3317428-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:05:54 2024 >> started Tue Dec 10 09:06:14 2024 >> done (19.418s) 18991591 read pairs processed; of these: 448917 ( 2.36%) short read pairs filtered out after trimming by size control 143132 ( 0.75%) empty read pairs filtered out after trimming by size control 18399542 (96.88%) read pairs available; of these: 4978538 (27.06%) trimmed read pairs available after processing 13421004 (72.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 666 0.00% 19 2166 0.01% 20 2174 0.01% 21 3817 0.02% 22 1466 0.01% 23 1630 0.01% 24 1030 0.01% 25 1010 0.01% 26 1283 0.01% 27 1500 0.01% 28 1575 0.01% 29 1383 0.01% 30 1186 0.01% 31 1788 0.01% 32 1667 0.01% 33 1921 0.01% 34 2298 0.01% 35 3554 0.02% 36 2340 0.01% 37 2333 0.01% 38 2542 0.01% 39 3139 0.02% 40 2997 0.02% 41 3549 0.02% 42 3770 0.02% 43 3983 0.02% 44 4594 0.02% 45 4370 0.02% 46 4493 0.02% 47 4700 0.03% 48 5420 0.03% 49 5160 0.03% 50 5880 0.03% 51 5840 0.03% 52 6510 0.04% 53 6712 0.04% 54 7462 0.04% 55 7277 0.04% 56 7541 0.04% 57 8007 0.04% 58 8352 0.05% 59 9135 0.05% 60 10205 0.06% 61 10219 0.06% 62 10710 0.06% 63 11971 0.07% 64 13383 0.07% 65 11417 0.06% 66 12374 0.07% 67 12823 0.07% 68 13221 0.07% 69 13462 0.07% 70 14316 0.08% 71 17231 0.09% 72 19246 0.10% 73 21460 0.12% 74 21852 0.12% 75 21375 0.12% 76 22169 0.12% 77 23061 0.13% 78 23140 0.13% 79 23296 0.13% 80 24828 0.13% 81 24520 0.13% 82 24082 0.13% 83 25694 0.14% 84 26920 0.15% 85 27633 0.15% 86 27860 0.15% 87 28538 0.16% 88 29641 0.16% 89 31770 0.17% 90 31240 0.17% 91 30899 0.17% 92 32643 0.18% 93 32071 0.17% 94 33673 0.18% 95 35460 0.19% 96 37437 0.20% 97 38096 0.21% 98 39778 0.22% 99 42597 0.23% 100 44540 0.24% 101 44119 0.24% 102 41659 0.23% 103 41426 0.23% 104 41705 0.23% 105 42984 0.23% 106 42616 0.23% 107 44626 0.24% 108 45137 0.25% 109 47452 0.26% 110 47729 0.26% 111 49717 0.27% 112 52381 0.28% 113 53871 0.29% 114 56984 0.31% 115 59754 0.32% 116 62009 0.34% 117 67058 0.36% 118 73136 0.40% 119 82044 0.45% 120 94564 0.51% 121 116625 0.63% 122 160849 0.87% 123 299539 1.63% 124 2155483 11.71% 125 13421004 72.94% 18399542 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=60.79 fanout-score-rank=5 prefix-density=0.85 prefix-fanout=52.8 sequence=AGATCGGAAGAGCACACC criterion=fanout-score sequence-density=0.16 sequence-density-rank=9 fanout-score=137.50 fanout-score-rank=1 prefix-density=1.15 prefix-fanout=18.6 sequence=CGCCGCCGCCGC criterion=sequence-density sequence-density=4.28 sequence-density-rank=1 fanout-score=35.22 fanout-score-rank=1 prefix-density=4.36 prefix-fanout=34.5 sequence=GGTGTGCTCTTCCGATCT criterion=fanout-score sequence-density=4.28 sequence-density-rank=1 fanout-score=35.22 fanout-score-rank=1 prefix-density=4.36 prefix-fanout=34.5 sequence=GGTGTGCTCTTCCGATCT Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACC -y GGTGTGCTCTTCCGATCT -o ERR3317428 ERR3317428_1.fastq ERR3317428_2.fastq Input file: ERR3317428_1.fastq Paired file: ERR3317428_2.fastq trimmed: ERR3317428-trimmed-pair1.fastq, ERR3317428-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACC -- paired 3' end adapter sequence (-y): GGTGTGCTCTTCCGATCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:07:49 2024 >> started Tue Dec 10 09:07:55 2024 >> done (6.154s) 6133181 read pairs processed; of these: 782 ( 0.01%) short read pairs filtered out after trimming by size control 353 ( 0.01%) empty read pairs filtered out after trimming by size control 6132046 (99.98%) read pairs available; of these: 1026 ( 0.02%) trimmed read pairs available after processing 6131020 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 227 0.00% 19 738 0.01% 20 730 0.01% 21 1243 0.02% 22 472 0.01% 23 470 0.01% 24 312 0.01% 25 333 0.01% 26 421 0.01% 27 497 0.01% 28 525 0.01% 29 472 0.01% 30 392 0.01% 31 625 0.01% 32 566 0.01% 33 679 0.01% 34 723 0.01% 35 1192 0.02% 36 792 0.01% 37 839 0.01% 38 828 0.01% 39 1031 0.02% 40 1017 0.02% 41 1174 0.02% 42 1304 0.02% 43 1280 0.02% 44 1531 0.02% 45 1510 0.02% 46 1462 0.02% 47 1585 0.03% 48 1860 0.03% 49 1718 0.03% 50 2022 0.03% 51 1937 0.03% 52 2227 0.04% 53 2210 0.04% 54 2484 0.04% 55 2453 0.04% 56 2567 0.04% 57 2681 0.04% 58 2823 0.05% 59 3017 0.05% 60 3416 0.06% 61 3412 0.06% 62 3542 0.06% 63 3944 0.06% 64 4505 0.07% 65 3809 0.06% 66 4138 0.07% 67 4334 0.07% 68 4440 0.07% 69 4486 0.07% 70 4863 0.08% 71 5847 0.10% 72 6415 0.10% 73 7142 0.12% 74 7237 0.12% 75 7136 0.12% 76 7375 0.12% 77 7495 0.12% 78 7729 0.13% 79 7725 0.13% 80 8321 0.14% 81 8061 0.13% 82 8056 0.13% 83 8446 0.14% 84 8925 0.15% 85 9176 0.15% 86 9199 0.15% 87 9514 0.16% 88 9832 0.16% 89 10522 0.17% 90 10161 0.17% 91 10416 0.17% 92 10907 0.18% 93 10740 0.18% 94 11274 0.18% 95 11753 0.19% 96 12414 0.20% 97 12673 0.21% 98 13164 0.21% 99 14194 0.23% 100 14857 0.24% 101 14918 0.24% 102 14173 0.23% 103 13744 0.22% 104 13902 0.23% 105 14261 0.23% 106 14182 0.23% 107 14825 0.24% 108 15113 0.25% 109 15684 0.26% 110 15841 0.26% 111 16459 0.27% 112 17403 0.28% 113 18073 0.29% 114 19120 0.31% 115 19856 0.32% 116 20697 0.34% 117 22272 0.36% 118 24341 0.40% 119 27250 0.44% 120 31475 0.51% 121 38848 0.63% 122 53458 0.87% 123 99868 1.63% 124 717476 11.70% 125 4474243 72.96% criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=59.46 fanout-score-rank=4 prefix-density=0.85 prefix-fanout=51.9 sequence=AGATCGGAAGAGCACACC criterion=fanout-score sequence-density=0.16 sequence-density-rank=9 fanout-score=137.82 fanout-score-rank=1 prefix-density=1.16 prefix-fanout=18.5 sequence=CGCCGCCGCCGC criterion=sequence-density sequence-density=4.23 sequence-density-rank=1 fanout-score=35.30 fanout-score-rank=1 prefix-density=4.32 prefix-fanout=34.5 sequence=GGTGTGCTCTTCCGATCT criterion=fanout-score sequence-density=4.23 sequence-density-rank=1 fanout-score=35.30 fanout-score-rank=1 prefix-density=4.32 prefix-fanout=34.5 sequence=GGTGTGCTCTTCCGATCT ERR3317428 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:08:51 Started mapping on | Dec 10 09:08:53 Finished on | Dec 10 09:09:54 Mapping speed, Million of reads per hour | 1085.81 Number of input reads | 18398407 Average input read length | 242 UNIQUE READS: Uniquely mapped reads number | 16850628 Uniquely mapped reads % | 91.59% Average mapped length | 239.62 Number of splices: Total | 11726711 Number of splices: Annotated (sjdb) | 11116020 Number of splices: GT/AG | 11555669 Number of splices: GC/AG | 145550 Number of splices: AT/AC | 11161 Number of splices: Non-canonical | 14331 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.00% Deletion average length | 1.25 Insertion rate per base | 0.00% Insertion average length | 1.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 922551 % of reads mapped to multiple loci | 5.01% Number of reads mapped to too many loci | 67783 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.21% % of reads unmapped: other | 1.82% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 643880 643880 643880 N_multimapping 922551 922551 922551 N_noFeature 643672 2815612 14348578 N_ambiguous 496777 176609 39070 UnstrandedReadsAssigned:15710179 PositiveStrandReadsAssigned:13858407 NegativeStrandReadsAssigned:2462980 Dataset is classified positive stranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 ERR3317428 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317428-trimmed-pair1.fastq ERR3317428-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,398,407 reads, 14,580,072 reads pseudoaligned [quant] estimated average fragment length: 241.744 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,280 rounds 52973 ERR3317428.ke.tsv 35125 ERR3317428.se.tsv 88098 total ==> ERR3317428.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 695.971 13.8814 1.8571 PNS24247 1044 803.256 18.7734 2.17611 PNS24249 1928 1687.26 133.913 7.38985 PNS24246 1044 803.256 18.7734 2.17611 PNS24248 1044 803.256 18.7734 2.17611 PNS24244 1471 1230.26 123.885 9.37596 PNS24243 293 108.667 1 0.856835 KQK14069 1603 1362.26 1677.21 114.636 KQK14071 474 253.982 2.71852 0.996605 ==> ERR3317428.se.tsv <== BRADI_1g14170v3 1931 BRADI_1g53295v3 23 BRADI_1g59795v3 253 BRADI_1g07683v3 0 BRADI_1g00485v3 24 BRADI_1g20270v3 1685 BRADI_1g74790v3 79 BRADI_1g09890v3 0 BRADI_1g77505v3 158 BRADI_1g48960v3 0 ERR3317428 completed mapping pipeline successfully