Starting /dee2/code/volunteer_pipeline.sh ERR3317429 current disk space = 1525140856832 free memory = 1523991084 ERR3317429 SRAfilesize 63b9c404cf59d036b6f16ab00aa60825 ERR3317429.sra ERR3317429.sra file validated ERR3317429 is paired end ERR3317429 is conventional basespace ERR3317429 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317429_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7975 33.0 33.0 33.0 33.0 33.0 2 32.8375 33.0 33.0 33.0 33.0 33.0 3 32.7945 33.0 33.0 33.0 33.0 33.0 4 32.812 33.0 33.0 33.0 33.0 33.0 5 32.788 33.0 33.0 33.0 33.0 33.0 6 36.60475 37.0 37.0 37.0 37.0 37.0 7 36.70625 37.0 37.0 37.0 37.0 37.0 8 36.71025 37.0 37.0 37.0 37.0 37.0 9 36.6585 37.0 37.0 37.0 37.0 37.0 10-11 36.721000000000004 37.0 37.0 37.0 37.0 37.0 12-13 36.697375 37.0 37.0 37.0 37.0 37.0 14-15 36.716625 37.0 37.0 37.0 37.0 37.0 16-17 36.749875 37.0 37.0 37.0 37.0 37.0 18-19 36.687124999999995 37.0 37.0 37.0 37.0 37.0 20-21 36.70825 37.0 37.0 37.0 37.0 37.0 22-23 36.715625 37.0 37.0 37.0 37.0 37.0 24-25 36.639624999999995 37.0 37.0 37.0 37.0 37.0 26-27 36.68025 37.0 37.0 37.0 37.0 37.0 28-29 36.647875 37.0 37.0 37.0 37.0 37.0 30-31 36.631 37.0 37.0 37.0 37.0 37.0 32-33 36.5725 37.0 37.0 37.0 37.0 37.0 34-35 36.591375 37.0 37.0 37.0 37.0 37.0 36-37 36.553 37.0 37.0 37.0 37.0 37.0 38-39 36.547375 37.0 37.0 37.0 37.0 37.0 40-41 36.393625 37.0 37.0 37.0 37.0 37.0 42-43 36.176125 37.0 37.0 37.0 37.0 37.0 44-45 35.923874999999995 37.0 37.0 37.0 37.0 37.0 46-47 35.766375 37.0 37.0 37.0 37.0 37.0 48-49 35.483000000000004 37.0 37.0 37.0 37.0 37.0 50-51 35.54325 37.0 37.0 37.0 37.0 37.0 52-53 35.651375 37.0 37.0 37.0 37.0 37.0 54-55 35.993625 37.0 37.0 37.0 37.0 37.0 56-57 35.99425 37.0 37.0 37.0 37.0 37.0 58-59 36.084375 37.0 37.0 37.0 37.0 37.0 60-61 36.216499999999996 37.0 37.0 37.0 37.0 37.0 62-63 36.308875 37.0 37.0 37.0 37.0 37.0 64-65 36.292625 37.0 37.0 37.0 37.0 37.0 66-67 36.26875 37.0 37.0 37.0 37.0 37.0 68-69 36.192125 37.0 37.0 37.0 37.0 37.0 70-71 36.218374999999995 37.0 37.0 37.0 37.0 37.0 72-73 36.12575 37.0 37.0 37.0 37.0 37.0 74-75 36.087125 37.0 37.0 37.0 37.0 37.0 76-77 36.003 37.0 37.0 37.0 37.0 37.0 78-79 35.847375 37.0 37.0 37.0 37.0 37.0 80-81 35.517624999999995 37.0 37.0 37.0 37.0 37.0 82-83 34.9275 37.0 37.0 37.0 33.0 37.0 84-85 34.5625 37.0 37.0 37.0 33.0 37.0 86-87 34.58 37.0 37.0 37.0 33.0 37.0 88-89 34.509625 37.0 37.0 37.0 33.0 37.0 90-91 34.5035 37.0 37.0 37.0 33.0 37.0 92-93 34.477625 37.0 37.0 37.0 33.0 37.0 94-95 34.510625000000005 37.0 37.0 37.0 33.0 37.0 96-97 34.4465 37.0 37.0 37.0 33.0 37.0 98-99 34.385 37.0 37.0 37.0 33.0 37.0 100-101 34.365 37.0 37.0 37.0 33.0 37.0 102-103 34.339375000000004 37.0 37.0 37.0 33.0 37.0 104-105 34.243875 37.0 37.0 37.0 33.0 37.0 106-107 34.218875 37.0 37.0 37.0 33.0 37.0 108-109 34.245374999999996 37.0 37.0 37.0 33.0 37.0 110-111 34.176500000000004 37.0 37.0 37.0 33.0 37.0 112-113 34.142624999999995 37.0 37.0 37.0 33.0 37.0 114-115 34.085499999999996 37.0 37.0 37.0 33.0 37.0 116-117 34.066875 37.0 37.0 37.0 33.0 37.0 118-119 33.932375 37.0 37.0 37.0 30.0 37.0 120-121 33.82 37.0 37.0 37.0 27.0 37.0 122-123 33.59725 37.0 37.0 37.0 27.0 37.0 124-125 32.661375 37.0 35.0 37.0 14.5 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 4.0 7 1.0 8 3.0 9 2.0 10 3.0 11 1.0 12 2.0 13 0.0 14 2.0 15 4.0 16 3.0 17 3.0 18 3.0 19 7.0 20 4.0 21 11.0 22 26.0 23 59.0 24 83.0 25 18.0 26 9.0 27 11.0 28 11.0 29 14.0 30 28.0 31 29.0 32 63.0 33 70.0 34 118.0 35 207.0 36 3200.0 >>END_MODULE >>Per base sequence content pass #Base G A T C 1 25.56278139069535 24.23711855927964 20.23511755877939 29.964982491245625 2 24.95 22.075 20.225 32.75 3 23.825 23.625 21.525 31.025000000000002 4 28.499999999999996 20.825 20.150000000000002 30.525000000000002 5 29.7 22.325 17.349999999999998 30.625000000000004 6 29.257314328582147 23.48087021755439 21.080270067516878 26.18154538634659 7 24.15 27.150000000000002 25.6 23.1 8 24.775 26.825 29.425 18.975 9 26.5 28.975 25.900000000000002 18.625 10-11 26.1625 26.85 26.1125 20.875 12-13 26.200000000000003 24.925 25.7875 23.0875 14-15 24.375 27.8375 26.075 21.712500000000002 16-17 26.325 25.074999999999996 24.025 24.575 18-19 24.8 24.8625 25.6125 24.725 20-21 23.875 24.8125 25.074999999999996 26.237500000000004 22-23 24.212500000000002 25.1875 24.9875 25.6125 24-25 24.712500000000002 25.162499999999998 25.224999999999998 24.9 26-27 24.325 24.75 25.650000000000002 25.275 28-29 25.474999999999998 24.6 25.5375 24.3875 30-31 23.2625 26.0125 25.674999999999997 25.05 32-33 24.3 24.0375 25.624999999999996 26.0375 34-35 23.6875 24.1625 24.837500000000002 27.3125 36-37 24.675 24.975 26.224999999999998 24.125 38-39 24.4 24.75 24.9125 25.937500000000004 40-41 24.120225422667502 25.14715090795241 24.77144646211647 25.96117720726362 42-43 23.955712128837444 24.886763965777554 26.5601409159537 24.597382989431303 44-45 24.400456794822993 24.2989468341581 26.63367592945058 24.66692044156833 46-47 25.298906130755533 25.85856016280845 23.848893411345713 24.99364029509031 48-49 23.510651868860823 25.30935068248501 26.776374537568564 24.4036229110856 50-51 24.923234390992835 24.309109518935518 25.70368474923234 25.063971340839302 52-53 25.84312723556464 23.518140010219724 26.25191619826265 24.38681655595299 54-55 25.211143325349806 24.744737173830835 26.622967351569393 23.42115214924997 56-57 25.730478589420652 24.571788413098236 24.94962216624685 24.748110831234257 58-59 25.775656324582343 23.47695013189298 24.293430473558598 26.453963069966086 60-61 23.7375 24.6 27.224999999999998 24.4375 62-63 24.55 23.175 27.0625 25.2125 64-65 25.337500000000002 22.7375 25.8625 26.0625 66-67 25.2125 23.65 25.900000000000002 25.2375 68-69 25.124999999999996 24.7875 26.5625 23.525 70-71 25.7 26.0 25.124999999999996 23.175 72-73 24.025 28.1625 25.05 22.7625 74-75 24.224999999999998 27.950000000000003 24.4875 23.3375 76-77 23.95 28.15 23.799999999999997 24.099999999999998 78-79 24.0 28.212500000000002 23.799999999999997 23.9875 80-81 23.95 27.3875 24.675 23.9875 82-83 24.2625 27.675 24.075 23.9875 84-85 24.1875 27.150000000000002 25.5125 23.150000000000002 86-87 24.224999999999998 27.175 24.837500000000002 23.7625 88-89 24.1625 26.5375 25.0 24.3 90-91 25.7125 26.1 25.137500000000003 23.05 92-93 24.1875 25.887500000000003 24.675 25.25 94-95 24.975 25.3 23.9125 25.8125 96-97 25.4875 25.474999999999998 24.675 24.3625 98-99 24.5625 24.775 25.5 25.162499999999998 100-101 25.8 24.837500000000002 24.9125 24.45 102-103 24.474999999999998 25.775 25.025 24.725 104-105 25.162499999999998 25.6 24.3625 24.875 106-107 24.575 26.087500000000002 24.625 24.712500000000002 108-109 24.3625 27.3375 23.9125 24.3875 110-111 25.0375 27.575 24.4125 22.975 112-113 23.6375 27.8875 24.462500000000002 24.0125 114-115 24.15 29.425 23.6625 22.7625 116-117 23.425 29.012500000000003 23.5625 24.0 118-119 23.474999999999998 28.825 23.2375 24.462500000000002 120-121 24.3125 28.199999999999996 24.0125 23.474999999999998 122-123 23.900789177001126 28.18489289740699 23.700363271952902 24.213954653638982 124-125 24.371010138941042 28.489172612341967 22.75628989861059 24.383527350106394 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 2.0 3 4.0 4 2.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 0.5 25 1.0 26 4.5 27 5.5 28 5.0 29 7.0 30 9.5 31 17.5 32 23.0 33 24.0 34 31.0 35 46.0 36 56.5 37 68.5 38 93.0 39 117.5 40 130.0 41 150.5 42 169.0 43 175.5 44 182.0 45 181.0 46 182.5 47 189.0 48 173.0 49 143.0 50 133.0 51 137.0 52 134.0 53 122.0 54 101.5 55 95.0 56 99.0 57 85.5 58 75.5 59 71.5 60 64.0 61 65.5 62 65.5 63 56.5 64 51.0 65 47.0 66 49.0 67 48.0 68 38.5 69 36.0 70 35.5 71 32.5 72 30.5 73 28.0 74 26.5 75 18.5 76 11.0 77 10.0 78 7.5 79 7.0 80 8.0 81 4.5 82 2.5 83 1.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.1875 42-43 0.65 44-45 1.4874999999999998 46-47 1.725 48-49 2.0125 50-51 2.3 52-53 2.15 54-55 0.8375 56-57 0.75 58-59 0.4875 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.21250000000000002 124-125 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.33076527991781 95.72500000000001 2 1.1813045711350796 2.3 3 0.30816640986132515 0.8999999999999999 4 0.025680534155110426 0.1 5 0.07704160246533129 0.375 6 0.0 0.0 7 0.025680534155110426 0.17500000000000002 8 0.025680534155110426 0.2 9 0.025680534155110426 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATG 9 0.22499999999999998 TruSeq Adapter, Index 8 (100% over 49bp) TATCCCCTGCTTCCCCGCTTCCTCTTCCTCCTCCCCCTCACTCCCCAAGC 8 0.2 No Hit TATGTACCTTTTTCACACGTTTGTTTCATGTTGTATTTATGCATGTGATC 7 0.17500000000000002 No Hit TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit TTGGGGATGATTCTGTATTACAATTTGGTGGAGGAACTTTAGGACATCCT 5 0.125 No Hit CCAGTCACCTCAGCGCCCTCCCTCCTTGTCCCCGATGGCCCGCACGAAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.25 0.0 0.0 0.0 0.0 2 0.275 0.0 0.0 0.0 0.0 3 0.35 0.0 0.0 0.0 0.0 4 0.45 0.0 0.0 0.0 0.0 5 0.85 0.0 0.0 0.0 0.0 6 1.45 0.0 0.0 0.0 0.0 7 3.25 0.0 0.0 0.0 0.0 8 4.25 0.0 0.0 0.0 0.0 9 4.525 0.0 0.0 0.0 0.0 10-11 4.5375 0.0 0.0 0.0 0.0 12-13 4.575 0.0 0.0 0.0 0.0 14-15 4.575 0.0 0.0 0.0 0.0 16-17 4.6 0.0 0.0 0.0 0.0 18-19 4.625 0.0 0.0 0.0 0.0 20-21 4.625 0.0 0.0 0.0 0.0 22-23 4.699999999999999 0.0 0.0 0.0 0.0 24-25 4.75 0.0 0.0 0.0 0.0 26-27 4.7625 0.0 0.0 0.0 0.0 28-29 4.7875 0.0 0.0 0.0 0.0 30-31 4.8125 0.0 0.0 0.0 0.0 32-33 4.8375 0.0 0.0 0.0 0.0 34-35 4.85 0.0 0.0 0.0 0.0 36-37 4.875 0.0 0.0 0.0 0.0 38-39 4.9 0.0 0.0 0.0 0.0 40-41 4.9125 0.0 0.0 0.0 0.0 42-43 4.987500000000001 0.0 0.0 0.0 0.0 44-45 5.050000000000001 0.0 0.0 0.0 0.0 46-47 5.0875 0.0 0.0 0.0 0.0 48-49 5.2 0.0 0.0 0.0 0.0 50-51 5.2375 0.0 0.0 0.0 0.0 52-53 5.3 0.0 0.0 0.0 0.0 54-55 5.375 0.0 0.0 0.0 0.0 56-57 5.475 0.0 0.0 0.0 0.0 58-59 5.6375 0.0 0.0 0.0 0.0 60-61 5.675 0.0 0.0 0.0 0.0 62-63 5.824999999999999 0.0 0.0 0.0 0.0 64-65 6.025 0.0 0.0 0.0 0.0 66-67 6.137499999999999 0.0 0.0 0.0 0.0 68-69 6.300000000000001 0.0 0.0 0.0 0.0 70-71 6.45 0.0 0.0 0.0 0.0 72-73 6.5625 0.0 0.0 0.0 0.0 74-75 6.8375 0.0 0.0 0.0 0.0 76-77 7.074999999999999 0.0 0.0 0.0 0.0 78-79 7.262499999999999 0.0 0.0 0.0 0.0 80-81 7.5125 0.0 0.0 0.0 0.0 82-83 7.7125 0.0 0.0 0.0 0.0 84-85 7.9 0.0 0.0 0.0 0.0 86-87 8.1875 0.0 0.0 0.0 0.0 88-89 8.399999999999999 0.0 0.0 0.0 0.0 90-91 8.7375 0.0 0.0 0.0 0.0 92-93 8.9875 0.0 0.0 0.0 0.0 94-95 9.3375 0.0 0.0 0.0 0.0 96-97 9.7625 0.0 0.0 0.0 0.0 98-99 10.1375 0.0 0.0 0.0 0.0 100-101 10.575 0.0 0.0 0.0 0.0 102-103 11.1 0.0 0.0 0.0 0.0 104-105 11.6875 0.0 0.0 0.0 0.0 106-107 12.1 0.0 0.0 0.0 0.0 108-109 12.5375 0.0 0.0 0.0 0.0 110-111 12.9125 0.0 0.0 0.0 0.0 112-113 13.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTGCT 30 2.773395E-7 59.5 62-63 CCGTCTT 30 2.773395E-7 59.5 56-57 TCTGCTT 30 2.773395E-7 59.5 62-63 GCTTGAA 30 2.773395E-7 59.5 66-67 CTGCTTG 30 2.773395E-7 59.5 64-65 CTTGAAA 30 2.773395E-7 59.5 66-67 CAGATCG 55 1.088876E-5 54.090908 6 AATCTCG 35 8.04519E-7 51.0 46-47 TGCCGTC 35 8.04519E-7 51.0 54-55 TATGCCG 35 8.04519E-7 51.0 52-53 GAAAAAA 35 8.04519E-7 51.0 70-71 TCTCGTA 35 8.04519E-7 51.0 48-49 ATGCCGT 35 8.04519E-7 51.0 54-55 GTCTTCT 35 8.04519E-7 51.0 58-59 GAATCTC 35 8.04519E-7 51.0 44-45 TTGAAAA 35 8.04519E-7 51.0 68-69 GCCGTCT 35 8.04519E-7 51.0 56-57 CGTCTTC 35 8.04519E-7 51.0 58-59 CTCGTAT 35 8.04519E-7 51.0 48-49 TGAAAAA 35 8.04519E-7 51.0 68-69 >>END_MODULE ERR3317429 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317429_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.618 33.0 33.0 33.0 33.0 33.0 2 32.568 33.0 33.0 33.0 33.0 33.0 3 32.62975 33.0 33.0 33.0 33.0 33.0 4 32.58425 33.0 33.0 33.0 33.0 33.0 5 32.55325 33.0 33.0 33.0 33.0 33.0 6 36.39 37.0 37.0 37.0 37.0 37.0 7 36.4115 37.0 37.0 37.0 37.0 37.0 8 36.37925 37.0 37.0 37.0 37.0 37.0 9 36.35875 37.0 37.0 37.0 37.0 37.0 10-11 36.4375 37.0 37.0 37.0 37.0 37.0 12-13 36.379875 37.0 37.0 37.0 37.0 37.0 14-15 36.334 37.0 37.0 37.0 37.0 37.0 16-17 36.338750000000005 37.0 37.0 37.0 37.0 37.0 18-19 36.315124999999995 37.0 37.0 37.0 37.0 37.0 20-21 36.33175 37.0 37.0 37.0 37.0 37.0 22-23 36.32575 37.0 37.0 37.0 37.0 37.0 24-25 36.36875 37.0 37.0 37.0 37.0 37.0 26-27 36.319125 37.0 37.0 37.0 37.0 37.0 28-29 36.377624999999995 37.0 37.0 37.0 37.0 37.0 30-31 36.375875 37.0 37.0 37.0 37.0 37.0 32-33 36.324749999999995 37.0 37.0 37.0 37.0 37.0 34-35 36.329 37.0 37.0 37.0 37.0 37.0 36-37 36.335375 37.0 37.0 37.0 37.0 37.0 38-39 36.350875 37.0 37.0 37.0 37.0 37.0 40-41 36.308499999999995 37.0 37.0 37.0 37.0 37.0 42-43 36.279625 37.0 37.0 37.0 37.0 37.0 44-45 36.34125 37.0 37.0 37.0 37.0 37.0 46-47 36.316874999999996 37.0 37.0 37.0 37.0 37.0 48-49 36.298875 37.0 37.0 37.0 37.0 37.0 50-51 36.307 37.0 37.0 37.0 37.0 37.0 52-53 36.284625 37.0 37.0 37.0 37.0 37.0 54-55 36.18275 37.0 37.0 37.0 37.0 37.0 56-57 36.1185 37.0 37.0 37.0 37.0 37.0 58-59 35.83825 37.0 37.0 37.0 37.0 37.0 60-61 35.850375 37.0 37.0 37.0 37.0 37.0 62-63 35.873125 37.0 37.0 37.0 37.0 37.0 64-65 36.096125 37.0 37.0 37.0 37.0 37.0 66-67 36.155 37.0 37.0 37.0 37.0 37.0 68-69 36.14325 37.0 37.0 37.0 37.0 37.0 70-71 36.08625 37.0 37.0 37.0 37.0 37.0 72-73 35.974625 37.0 37.0 37.0 37.0 37.0 74-75 35.383625 37.0 37.0 37.0 37.0 37.0 76-77 34.64425 37.0 37.0 37.0 37.0 37.0 78-79 34.529875000000004 37.0 37.0 37.0 35.0 37.0 80-81 34.520375 37.0 37.0 37.0 33.0 37.0 82-83 34.555875 37.0 37.0 37.0 35.0 37.0 84-85 34.527125 37.0 37.0 37.0 35.0 37.0 86-87 34.498000000000005 37.0 37.0 37.0 33.0 37.0 88-89 34.415499999999994 37.0 37.0 37.0 33.0 37.0 90-91 34.41875 37.0 37.0 37.0 33.0 37.0 92-93 34.387125 37.0 37.0 37.0 33.0 37.0 94-95 34.330125 37.0 37.0 37.0 33.0 37.0 96-97 34.3475 37.0 37.0 37.0 33.0 37.0 98-99 34.3155 37.0 37.0 37.0 33.0 37.0 100-101 34.239 37.0 37.0 37.0 33.0 37.0 102-103 34.269125 37.0 37.0 37.0 33.0 37.0 104-105 34.248999999999995 37.0 37.0 37.0 33.0 37.0 106-107 34.187 37.0 37.0 37.0 33.0 37.0 108-109 34.270624999999995 37.0 37.0 37.0 33.0 37.0 110-111 34.162625 37.0 37.0 37.0 33.0 37.0 112-113 34.11725 37.0 37.0 37.0 33.0 37.0 114-115 34.003 37.0 37.0 37.0 33.0 37.0 116-117 33.947874999999996 37.0 37.0 37.0 33.0 37.0 118-119 33.912875 37.0 37.0 37.0 33.0 37.0 120-121 33.807125 37.0 37.0 37.0 27.0 37.0 122-123 33.740750000000006 37.0 37.0 37.0 30.0 37.0 124-125 32.4285 37.0 35.0 37.0 14.5 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 4.0 4 4.0 5 1.0 6 3.0 7 4.0 8 1.0 9 3.0 10 0.0 11 3.0 12 3.0 13 2.0 14 0.0 15 3.0 16 2.0 17 2.0 18 4.0 19 2.0 20 11.0 21 22.0 22 141.0 23 16.0 24 6.0 25 9.0 26 20.0 27 10.0 28 10.0 29 12.0 30 23.0 31 18.0 32 35.0 33 53.0 34 85.0 35 177.0 36 3295.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.6 16.25 25.525 25.624999999999996 2 30.782695673918482 13.85346336584146 22.50562640660165 32.85821455363841 3 26.426426426426424 14.664664664664665 24.524524524524523 34.38438438438439 4 26.589884827240862 12.944416624937405 25.863795693540307 34.60190285428143 5 31.096644967451176 15.12268402603906 20.43064596895343 33.350025037556335 6 33.400100150225335 16.825237856785176 25.43815723585378 24.336504757135703 7 26.81522283425138 26.114171256885328 31.59739609414121 15.473209814722082 8 20.28042063094642 27.165748622934398 34.702053079619425 17.85177766649975 9 26.195842724768344 29.226145755071375 27.923866766841975 16.654144753318306 10-11 24.123685528292437 25.61342013019529 30.220330495743614 20.04256384576865 12-13 21.657486229344016 25.363044566850274 29.006009013520277 23.97346019028543 14-15 20.943915873810717 26.777666499749625 28.918377566349523 23.360040060090135 16-17 21.344516775162745 26.664997496244368 26.27691537305959 25.7135703555333 18-19 25.187781672508763 25.488232348522782 23.685528292438658 25.63845768652979 20-21 21.519779669504256 27.378567851777667 27.879318978467705 23.222333500250375 22-23 21.72008012018027 23.87330996494742 28.092138207310967 26.314471707561342 24-25 23.773159739609415 25.863795693540307 26.514772158237353 23.84827240861292 26-27 22.721582373560338 26.664997496244368 25.38808212318478 25.225338007010517 28-29 26.8018018018018 25.13763763763764 22.835335335335337 25.225225225225223 30-31 24.0180135101326 28.121090818113586 25.093820365273956 22.76707530647986 32-33 23.767825869402053 29.071803852889666 23.492619464598448 23.667750813109834 34-35 23.802376485303313 27.229518449030643 23.439649781113197 25.528455284552848 36-37 22.961480740370185 25.625312656328163 26.80090045022511 24.61230615307654 38-39 23.665458182272783 25.853231653956744 26.403300412551566 24.0780097512189 40-41 23.150000000000002 26.4625 23.75 26.637499999999996 42-43 22.95 28.9375 24.3625 23.75 44-45 23.1125 25.525 25.525 25.837500000000002 46-47 23.799999999999997 25.162499999999998 24.2 26.8375 48-49 25.0375 26.974999999999998 24.3125 23.674999999999997 50-51 24.9 25.75 24.675 24.675 52-53 23.0875 25.687500000000004 24.4375 26.787499999999998 54-55 23.007518796992482 27.00501253132832 24.598997493734338 25.38847117794486 56-57 23.552317548046727 24.996859690993595 24.758196206506717 26.692626554452957 58-59 23.077895801719777 27.187658067779463 25.341426403641883 24.393019726858878 60-61 22.89430483646925 26.40484909710822 25.533526960474806 25.167319105947723 62-63 21.892744479495267 28.277602523659308 25.148264984227133 24.681388012618296 64-65 22.95471603702777 27.370527895921942 25.23142356767576 24.44333249937453 66-67 21.536728819922413 30.697034163433862 24.62770616944062 23.138530847203103 68-69 22.237499999999997 29.75 23.7125 24.3 70-71 22.975 30.362499999999997 22.7 23.962500000000002 72-73 22.540317539692463 30.41630203775472 23.177897237154642 23.865483185398176 74-75 22.230557639409852 29.882470617654416 22.943235808952238 24.943735933983497 76-77 23.007631677718006 30.038783935943954 22.619792318278495 24.33379206805955 78-79 22.913277437116754 29.620823426354647 23.739206607433363 23.726692529095235 80-81 23.773159739609415 28.43014521782674 23.5978968452679 24.198798197295943 82-83 23.685528292438658 28.993490235353033 22.44616925388082 24.87481221832749 84-85 23.488168273444344 28.596469262551643 23.237761362213597 24.677601101790408 86-87 24.36764337590784 28.875532181317304 22.915101427498122 23.841723015276735 88-89 23.725416510083928 27.896780658900163 23.625203557559814 24.752599273456095 90-91 23.885828743114672 28.768152228342515 23.748122183274912 23.5978968452679 92-93 24.257983719474012 27.501565435190983 23.98246712586099 24.257983719474012 94-95 24.248873309964946 27.32849273910866 23.28492739108663 25.137706559839764 96-97 24.815324902967323 27.507199198697883 23.77613622135971 23.901339676975084 98-99 25.375563345017525 27.854281422133198 22.8092138207311 23.960941412118178 100-101 25.112669003505257 26.752628943415125 22.57135703555333 25.56334501752629 102-103 24.86229344016024 27.353530295443164 23.5728592889334 24.211316975463195 104-105 25.450676014021035 27.466199298948425 23.660490736104155 23.42263395092639 106-107 24.636955433149723 27.42864296444667 23.15973960941412 24.774661992989483 108-109 25.08758758758759 26.401401401401404 23.736236236236234 24.774774774774773 110-111 25.040670754598928 27.943936929045176 23.513953197347014 23.501439119008886 112-113 24.433879644689103 27.874390091329914 23.74577755536094 23.94595270862004 114-115 24.352720450281424 28.567854909318324 23.452157598499063 23.627267041901188 116-117 26.319739804853644 26.619964973730298 23.129847385539154 23.930447835876908 118-119 24.81240620310155 27.00100050025013 23.54927463731866 24.637318659329665 120-121 24.74059257407176 28.42855356919615 23.91548943617952 22.91536442055257 122-123 25.365670708838607 28.89111138892362 22.402800350043755 23.340417552194022 124-125 25.8125 27.925 23.4375 22.825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.0 22 1.0 23 2.5 24 2.0 25 4.5 26 8.0 27 7.0 28 9.5 29 12.5 30 12.5 31 18.5 32 21.5 33 23.0 34 37.5 35 57.5 36 69.5 37 91.0 38 114.0 39 119.0 40 130.5 41 158.5 42 185.5 43 197.5 44 190.0 45 191.5 46 179.5 47 164.5 48 165.0 49 150.0 50 152.0 51 143.0 52 130.0 53 122.5 54 99.5 55 85.5 56 87.0 57 93.0 58 81.5 59 64.5 60 63.5 61 61.0 62 51.0 63 49.5 64 45.0 65 42.5 66 41.0 67 33.5 68 31.0 69 28.0 70 23.0 71 21.5 72 24.5 73 21.5 74 13.5 75 13.0 76 16.5 77 10.5 78 5.5 79 4.5 80 2.5 81 3.0 82 2.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.1 4 0.15 5 0.15 6 0.15 7 0.15 8 0.15 9 0.17500000000000002 10-11 0.15 12-13 0.15 14-15 0.15 16-17 0.15 18-19 0.15 20-21 0.15 22-23 0.15 24-25 0.15 26-27 0.15 28-29 0.1 30-31 0.075 32-33 0.075 34-35 0.0625 36-37 0.05 38-39 0.0125 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.25 56-57 0.4875 58-59 1.15 60-61 1.0125 62-63 0.9375 64-65 0.075 66-67 0.11249999999999999 68-69 0.0 70-71 0.0 72-73 0.0125 74-75 0.025 76-77 0.08750000000000001 78-79 0.11249999999999999 80-81 0.15 82-83 0.15 84-85 0.1625 86-87 0.17500000000000002 88-89 0.21250000000000002 90-91 0.15 92-93 0.1875 94-95 0.15 96-97 0.1625 98-99 0.15 100-101 0.15 102-103 0.15 104-105 0.15 106-107 0.15 108-109 0.1 110-111 0.11249999999999999 112-113 0.08750000000000001 114-115 0.0625 116-117 0.075 118-119 0.05 120-121 0.0125 122-123 0.0125 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.175 #Duplication Level Percentage of deduplicated Percentage of total 1 98.7012987012987 96.89999999999999 2 1.06951871657754 2.1 3 0.15278838808250572 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.025464731347084286 0.15 7 0.025464731347084286 0.17500000000000002 8 0.0 0.0 9 0.025464731347084286 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCC 9 0.22499999999999998 Illumina Single End PCR Primer 1 (100% over 50bp) TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 7 0.17500000000000002 No Hit TCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.25 0.0 0.0 0.0 0.0 2 0.275 0.0 0.0 0.0 0.0 3 0.375 0.0 0.0 0.0 0.0 4 0.475 0.0 0.0 0.0 0.0 5 0.875 0.0 0.0 0.0 0.0 6 1.525 0.0 0.0 0.0 0.0 7 3.3 0.0 0.0 0.0 0.0 8 4.375 0.0 0.0 0.0 0.0 9 4.675 0.0 0.0 0.0 0.0 10-11 4.6875 0.0 0.0 0.0 0.0 12-13 4.725 0.0 0.0 0.0 0.0 14-15 4.725 0.0 0.0 0.0 0.0 16-17 4.75 0.0 0.0 0.0 0.0 18-19 4.75 0.0 0.0 0.0 0.0 20-21 4.75 0.0 0.0 0.0 0.0 22-23 4.824999999999999 0.0 0.0 0.0 0.0 24-25 4.85 0.0 0.0 0.0 0.0 26-27 4.8625 0.0 0.0 0.0 0.0 28-29 4.8875 0.0 0.0 0.0 0.0 30-31 4.925000000000001 0.0 0.0 0.0 0.0 32-33 4.9625 0.0 0.0 0.0 0.0 34-35 4.975 0.0 0.0 0.0 0.0 36-37 4.9875 0.0 0.0 0.0 0.0 38-39 5.0 0.0 0.0 0.0 0.0 40-41 5.0125 0.0 0.0 0.0 0.0 42-43 5.0875 0.0 0.0 0.0 0.0 44-45 5.15 0.0 0.0 0.0 0.0 46-47 5.199999999999999 0.0 0.0 0.0 0.0 48-49 5.325 0.0 0.0 0.0 0.0 50-51 5.375 0.0 0.0 0.0 0.0 52-53 5.45 0.0 0.0 0.0 0.0 54-55 5.525 0.0 0.0 0.0 0.0 56-57 5.612500000000001 0.0 0.0 0.0 0.0 58-59 5.7625 0.0 0.0 0.0 0.0 60-61 5.825 0.0 0.0 0.0 0.0 62-63 5.949999999999999 0.0 0.0 0.0 0.0 64-65 6.1125 0.0 0.0 0.0 0.0 66-67 6.2125 0.0 0.0 0.0 0.0 68-69 6.35 0.0 0.0 0.0 0.0 70-71 6.5 0.0 0.0 0.0 0.0 72-73 6.637499999999999 0.0 0.0 0.0 0.0 74-75 6.875 0.0 0.0 0.0 0.0 76-77 7.1 0.0 0.0 0.0 0.0 78-79 7.275 0.0 0.0 0.0 0.0 80-81 7.5 0.0 0.0 0.0 0.0 82-83 7.6875 0.0 0.0 0.0 0.0 84-85 7.875 0.0 0.0 0.0 0.0 86-87 8.162500000000001 0.0 0.0 0.0 0.0 88-89 8.4375 0.0 0.0 0.0 0.0 90-91 8.774999999999999 0.0 0.0 0.0 0.0 92-93 9.05 0.0 0.0 0.0 0.0 94-95 9.399999999999999 0.0 0.0 0.0 0.0 96-97 9.85 0.0 0.0 0.0 0.0 98-99 10.25 0.0 0.0 0.0 0.0 100-101 10.65 0.0 0.0 0.0 0.0 102-103 11.1375 0.0 0.0 0.0 0.0 104-105 11.7625 0.0 0.0 0.0 0.0 106-107 12.1875 0.0 0.0 0.0 0.0 108-109 12.625 0.0 0.0 0.0 0.0 110-111 12.95 0.0 0.0 0.0 0.0 112-113 13.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTGCT 50 0.0 108.17089 7 TGTGCTC 50 0.0 108.17089 8 GTGCTCT 50 0.0 108.17089 9 GGTGTGC 35 5.3660187E-9 103.01989 6 GGGTGTG 25 0.0018340836 72.11392 5 GAGATCG 30 0.0037792213 60.09494 6 GTATCAT 30 2.8242903E-7 59.343754 56-57 CATTAAA 30 2.8242903E-7 59.343754 60-61 ATTAAAA 30 2.8242903E-7 59.343754 62-63 TATCATT 30 2.8242903E-7 59.343754 58-59 ATCATTA 30 2.8242903E-7 59.343754 58-59 TCATTAA 30 2.8242903E-7 59.343754 60-61 CGATCTT 15 0.0041273823 59.343754 18-19 CGATCTG 15 0.0041273823 59.343754 18-19 TTCCGAT 50 5.4569682E-11 53.40937 14-15 TGCTCTT 50 5.4569682E-11 53.40937 10-11 GCTCTTC 50 5.4569682E-11 53.40937 10-11 TCCGATC 50 5.4569682E-11 53.40937 16-17 CCGATCT 50 5.4569682E-11 53.40937 16-17 CCGTATC 35 8.192528E-7 50.866074 54-55 >>END_MODULE Read 1070306 spots for ERR3317429.sra Written 1070306 spots for ERR3317429.sra Read 1070306 spots for ERR3317429.sra Written 1070306 spots for ERR3317429.sra Read 1070306 spots for ERR3317429.sra Written 1070306 spots for ERR3317429.sra Read 1070306 spots for ERR3317429.sra Written 1070306 spots for ERR3317429.sra Read 1070306 spots for ERR3317429.sra Written 1070306 spots for ERR3317429.sra Read 1070306 spots for ERR3317429.sra Written 1070306 spots for ERR3317429.sra Read 1070306 spots for ERR3317429.sra Written 1070306 spots for ERR3317429.sra Read 1070306 spots for ERR3317429.sra Written 1070306 spots for ERR3317429.sra Read 1070306 spots for ERR3317429.sra Written 1070306 spots for ERR3317429.sra Read 1070306 spots for ERR3317429.sra Written 1070306 spots for ERR3317429.sra Read 1070306 spots for ERR3317429.sra Written 1070306 spots for ERR3317429.sra Read 1070306 spots for ERR3317429.sra Written 1070306 spots for ERR3317429.sra Read 1070306 spots for ERR3317429.sra Written 1070306 spots for ERR3317429.sra Read 1070306 spots for ERR3317429.sra Written 1070306 spots for ERR3317429.sra Read 1070306 spots for ERR3317429.sra Written 1070306 spots for ERR3317429.sra Read 1070306 spots for ERR3317429.sra Written 1070306 spots for ERR3317429.sra Read 1070318 spots for ERR3317429.sra Written 1070318 spots for ERR3317429.sra Read 1070306 spots for ERR3317429.sra Written 1070306 spots for ERR3317429.sra Read 1070306 spots for ERR3317429.sra Written 1070306 spots for ERR3317429.sra Read 1070306 spots for ERR3317429.sra Written 1070306 spots for ERR3317429.sra SRR ids: ['ERR3317429.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dsm2bkh3 ERR3317429.sra spots: 21406132 blocks: [[1, 1070306], [1070307, 2140612], [2140613, 3210918], [3210919, 4281224], [4281225, 5351530], [5351531, 6421836], [6421837, 7492142], [7492143, 8562448], [8562449, 9632754], [9632755, 10703060], [10703061, 11773366], [11773367, 12843672], [12843673, 13913978], [13913979, 14984284], [14984285, 16054590], [16054591, 17124896], [17124897, 18195202], [18195203, 19265508], [19265509, 20335814], [20335815, 21406132]] ERR3317429 file size 6145105 ERR3317429 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317429 ERR3317429_1.fastq ERR3317429_2.fastq Input file: ERR3317429_1.fastq Paired file: ERR3317429_2.fastq trimmed: ERR3317429-trimmed-pair1.fastq, ERR3317429-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:07:00 2024 >> started Tue Dec 10 09:07:23 2024 >> done (23.287s) 21406132 read pairs processed; of these: 874678 ( 4.09%) short read pairs filtered out after trimming by size control 189832 ( 0.89%) empty read pairs filtered out after trimming by size control 20341622 (95.03%) read pairs available; of these: 5710082 (28.07%) trimmed read pairs available after processing 14631540 (71.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1277 0.01% 19 6091 0.03% 20 6152 0.03% 21 12341 0.06% 22 4268 0.02% 23 4188 0.02% 24 1682 0.01% 25 1958 0.01% 26 2184 0.01% 27 2474 0.01% 28 2309 0.01% 29 2008 0.01% 30 1751 0.01% 31 2229 0.01% 32 2385 0.01% 33 2721 0.01% 34 4057 0.02% 35 7529 0.04% 36 3438 0.02% 37 3294 0.02% 38 3708 0.02% 39 4480 0.02% 40 4403 0.02% 41 4593 0.02% 42 4948 0.02% 43 6114 0.03% 44 7195 0.04% 45 6586 0.03% 46 6901 0.03% 47 6783 0.03% 48 6886 0.03% 49 7126 0.04% 50 7711 0.04% 51 7999 0.04% 52 8706 0.04% 53 8789 0.04% 54 9733 0.05% 55 9686 0.05% 56 10110 0.05% 57 10766 0.05% 58 11086 0.05% 59 12182 0.06% 60 14043 0.07% 61 13219 0.06% 62 14098 0.07% 63 15051 0.07% 64 17348 0.09% 65 15423 0.08% 66 16205 0.08% 67 16800 0.08% 68 17339 0.09% 69 18092 0.09% 70 18731 0.09% 71 22373 0.11% 72 24404 0.12% 73 27265 0.13% 74 27845 0.14% 75 27812 0.14% 76 28253 0.14% 77 29291 0.14% 78 29493 0.14% 79 28870 0.14% 80 30948 0.15% 81 30352 0.15% 82 30085 0.15% 83 32034 0.16% 84 32515 0.16% 85 34355 0.17% 86 34677 0.17% 87 35031 0.17% 88 36766 0.18% 89 39393 0.19% 90 38128 0.19% 91 36811 0.18% 92 38394 0.19% 93 38312 0.19% 94 39885 0.20% 95 41184 0.20% 96 43443 0.21% 97 45135 0.22% 98 47149 0.23% 99 49357 0.24% 100 51034 0.25% 101 52032 0.26% 102 48611 0.24% 103 47708 0.23% 104 48401 0.24% 105 49937 0.25% 106 49332 0.24% 107 52324 0.26% 108 52087 0.26% 109 54019 0.27% 110 54941 0.27% 111 56999 0.28% 112 61292 0.30% 113 61840 0.30% 114 63341 0.31% 115 67319 0.33% 116 69676 0.34% 117 75304 0.37% 118 80946 0.40% 119 90913 0.45% 120 105123 0.52% 121 129458 0.64% 122 178569 0.88% 123 332454 1.63% 124 2359686 11.60% 125 14631540 71.93% 20341622 reads passed initial QC criterion=sequence-density sequence-density=1.50 sequence-density-rank=1 fanout-score=60.99 fanout-score-rank=2 prefix-density=1.68 prefix-fanout=54.7 sequence=AGATCGGAAGAGCACACC criterion=fanout-score sequence-density=0.13 sequence-density-rank=21 fanout-score=134.03 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=18.0 sequence=CGCCGCCGCCGC criterion=sequence-density sequence-density=8.27 sequence-density-rank=1 fanout-score=35.58 fanout-score-rank=3 prefix-density=8.42 prefix-fanout=34.9 sequence=GGTGTGCTCTTCCGATCT criterion=fanout-score sequence-density=0.67 sequence-density-rank=20 fanout-score=44.73 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=44.7 sequence=CCGTGTGCTCTTC Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACC -y GGTGTGCTCTTCCGATCT -o ERR3317429 ERR3317429_1.fastq ERR3317429_2.fastq Input file: ERR3317429_1.fastq Paired file: ERR3317429_2.fastq trimmed: ERR3317429-trimmed-pair1.fastq, ERR3317429-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACC -- paired 3' end adapter sequence (-y): GGTGTGCTCTTCCGATCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:09:15 2024 >> started Tue Dec 10 09:09:29 2024 >> done (14.179s) 13561081 read pairs processed; of these: 3422 ( 0.03%) short read pairs filtered out after trimming by size control 2166 ( 0.02%) empty read pairs filtered out after trimming by size control 13555493 (99.96%) read pairs available; of these: 3175 ( 0.02%) trimmed read pairs available after processing 13552318 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 882 0.01% 19 4106 0.03% 20 4125 0.03% 21 8326 0.06% 22 2829 0.02% 23 2127 0.02% 24 1122 0.01% 25 1286 0.01% 26 1487 0.01% 27 1698 0.01% 28 1697 0.01% 29 1346 0.01% 30 1198 0.01% 31 1496 0.01% 32 1587 0.01% 33 1838 0.01% 34 2709 0.02% 35 5085 0.04% 36 2303 0.02% 37 2149 0.02% 38 2469 0.02% 39 2996 0.02% 40 2913 0.02% 41 3087 0.02% 42 3307 0.02% 43 4127 0.03% 44 4747 0.04% 45 4368 0.03% 46 4456 0.03% 47 4544 0.03% 48 4604 0.03% 49 4778 0.04% 50 5119 0.04% 51 5351 0.04% 52 5796 0.04% 53 5850 0.04% 54 6486 0.05% 55 6460 0.05% 56 6802 0.05% 57 7205 0.05% 58 7445 0.05% 59 8132 0.06% 60 9417 0.07% 61 8755 0.06% 62 9321 0.07% 63 10044 0.07% 64 11581 0.09% 65 10153 0.07% 66 10730 0.08% 67 11208 0.08% 68 11605 0.09% 69 12037 0.09% 70 12592 0.09% 71 14919 0.11% 72 16480 0.12% 73 18155 0.13% 74 18525 0.14% 75 18580 0.14% 76 18941 0.14% 77 19482 0.14% 78 19661 0.15% 79 19264 0.14% 80 20758 0.15% 81 20155 0.15% 82 20024 0.15% 83 21373 0.16% 84 21595 0.16% 85 22862 0.17% 86 23146 0.17% 87 23466 0.17% 88 24618 0.18% 89 26285 0.19% 90 25468 0.19% 91 24415 0.18% 92 25644 0.19% 93 25556 0.19% 94 26454 0.20% 95 27308 0.20% 96 28814 0.21% 97 30067 0.22% 98 31549 0.23% 99 32764 0.24% 100 34040 0.25% 101 34493 0.25% 102 32252 0.24% 103 31825 0.23% 104 32413 0.24% 105 33308 0.25% 106 32846 0.24% 107 34955 0.26% 108 34807 0.26% 109 35868 0.26% 110 36547 0.27% 111 37871 0.28% 112 40828 0.30% 113 41365 0.31% 114 42029 0.31% 115 44778 0.33% 116 46634 0.34% 117 50213 0.37% 118 53945 0.40% 119 60738 0.45% 120 69858 0.52% 121 86223 0.64% 122 119193 0.88% 123 221875 1.64% 124 1571717 11.59% 125 9750663 71.93% criterion=sequence-density sequence-density=1.54 sequence-density-rank=1 fanout-score=61.03 fanout-score-rank=2 prefix-density=1.71 prefix-fanout=54.7 sequence=AGATCGGAAGAGCACACC criterion=fanout-score sequence-density=0.13 sequence-density-rank=23 fanout-score=141.59 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=18.6 sequence=CGCCGCCGCCGC criterion=sequence-density sequence-density=8.22 sequence-density-rank=1 fanout-score=35.71 fanout-score-rank=2 prefix-density=8.38 prefix-fanout=35.0 sequence=GGTGTGCTCTTCCGATCT criterion=fanout-score sequence-density=0.67 sequence-density-rank=19 fanout-score=43.43 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=43.4 sequence=CCGTGTGCTCTTC ERR3317429 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:10:52 Started mapping on | Dec 10 09:10:54 Finished on | Dec 10 09:11:58 Mapping speed, Million of reads per hour | 1143.90 Number of input reads | 20336034 Average input read length | 228 UNIQUE READS: Uniquely mapped reads number | 16471140 Uniquely mapped reads % | 80.99% Average mapped length | 229.83 Number of splices: Total | 11092344 Number of splices: Annotated (sjdb) | 10516166 Number of splices: GT/AG | 10917259 Number of splices: GC/AG | 141961 Number of splices: AT/AC | 9402 Number of splices: Non-canonical | 23722 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.00% Deletion average length | 1.24 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1032929 % of reads mapped to multiple loci | 5.08% Number of reads mapped to too many loci | 80776 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.43% % of reads unmapped: other | 2.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2865508 2865508 2865508 N_multimapping 1032929 1032929 1032929 N_noFeature 610283 3713277 13017429 N_ambiguous 573929 211000 63452 UnstrandedReadsAssigned:15286928 PositiveStrandReadsAssigned:12546863 NegativeStrandReadsAssigned:3390259 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 ERR3317429 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317429-trimmed-pair1.fastq ERR3317429-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,336,034 reads, 18,640,109 reads pseudoaligned [quant] estimated average fragment length: 234.019 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,199 rounds 52973 ERR3317429.ke.tsv 35125 ERR3317429.se.tsv 88098 total ==> ERR3317429.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 703.444 23.8695 2.41716 PNS24247 1044 810.981 9.58063 0.841538 PNS24249 1928 1694.98 106.293 4.46715 PNS24246 1044 810.981 9.58063 0.841538 PNS24248 1044 810.981 9.58063 0.841538 PNS24244 1471 1237.98 257.096 14.7935 PNS24243 293 116.765 2 1.22014 KQK14069 1603 1369.98 1394.53 72.5107 KQK14071 474 262.187 2.51857 0.684279 ==> ERR3317429.se.tsv <== BRADI_1g14170v3 1284 BRADI_1g53295v3 38 BRADI_1g59795v3 224 BRADI_1g07683v3 0 BRADI_1g00485v3 71 BRADI_1g20270v3 2591 BRADI_1g74790v3 163 BRADI_1g09890v3 0 BRADI_1g77505v3 170 BRADI_1g48960v3 0 ERR3317429 completed mapping pipeline successfully