Starting /dee2/code/volunteer_pipeline.sh ERR3317430 current disk space = 1525319413760 free memory = 1599157048 ERR3317430 SRAfilesize 8a6052ba313fa9a729e9aa4bb89c8d26 ERR3317430.sra ERR3317430.sra file validated ERR3317430 is paired end ERR3317430 is conventional basespace ERR3317430 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317430_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77875 33.0 33.0 33.0 33.0 33.0 2 32.78075 33.0 33.0 33.0 33.0 33.0 3 32.7975 33.0 33.0 33.0 33.0 33.0 4 32.8145 33.0 33.0 33.0 33.0 33.0 5 32.772 33.0 33.0 33.0 33.0 33.0 6 36.5775 37.0 37.0 37.0 37.0 37.0 7 36.665 37.0 37.0 37.0 37.0 37.0 8 36.69525 37.0 37.0 37.0 37.0 37.0 9 36.68875 37.0 37.0 37.0 37.0 37.0 10-11 36.729375000000005 37.0 37.0 37.0 37.0 37.0 12-13 36.734375 37.0 37.0 37.0 37.0 37.0 14-15 36.686875 37.0 37.0 37.0 37.0 37.0 16-17 36.721125 37.0 37.0 37.0 37.0 37.0 18-19 36.674625 37.0 37.0 37.0 37.0 37.0 20-21 36.687375 37.0 37.0 37.0 37.0 37.0 22-23 36.677625 37.0 37.0 37.0 37.0 37.0 24-25 36.650375 37.0 37.0 37.0 37.0 37.0 26-27 36.601625 37.0 37.0 37.0 37.0 37.0 28-29 36.534125 37.0 37.0 37.0 37.0 37.0 30-31 36.533125 37.0 37.0 37.0 37.0 37.0 32-33 36.507125 37.0 37.0 37.0 37.0 37.0 34-35 36.5145 37.0 37.0 37.0 37.0 37.0 36-37 36.491749999999996 37.0 37.0 37.0 37.0 37.0 38-39 36.434375 37.0 37.0 37.0 37.0 37.0 40-41 36.26625 37.0 37.0 37.0 37.0 37.0 42-43 35.975375 37.0 37.0 37.0 37.0 37.0 44-45 35.80825 37.0 37.0 37.0 37.0 37.0 46-47 35.5325 37.0 37.0 37.0 37.0 37.0 48-49 35.170375 37.0 37.0 37.0 35.0 37.0 50-51 35.270250000000004 37.0 37.0 37.0 37.0 37.0 52-53 35.434875 37.0 37.0 37.0 37.0 37.0 54-55 35.757000000000005 37.0 37.0 37.0 37.0 37.0 56-57 35.83425 37.0 37.0 37.0 37.0 37.0 58-59 35.8585 37.0 37.0 37.0 37.0 37.0 60-61 36.064 37.0 37.0 37.0 37.0 37.0 62-63 36.072 37.0 37.0 37.0 37.0 37.0 64-65 36.158125 37.0 37.0 37.0 37.0 37.0 66-67 36.06975 37.0 37.0 37.0 37.0 37.0 68-69 36.059125 37.0 37.0 37.0 37.0 37.0 70-71 36.035375 37.0 37.0 37.0 37.0 37.0 72-73 35.93475 37.0 37.0 37.0 37.0 37.0 74-75 35.855125 37.0 37.0 37.0 37.0 37.0 76-77 35.62425 37.0 37.0 37.0 37.0 37.0 78-79 35.44975 37.0 37.0 37.0 37.0 37.0 80-81 34.97875 37.0 37.0 37.0 33.0 37.0 82-83 33.936875 37.0 37.0 37.0 30.0 37.0 84-85 33.44775 37.0 37.0 37.0 20.5 37.0 86-87 33.3135 37.0 37.0 37.0 14.0 37.0 88-89 33.278000000000006 37.0 37.0 37.0 14.0 37.0 90-91 33.17175 37.0 37.0 37.0 14.0 37.0 92-93 33.192125000000004 37.0 37.0 37.0 14.0 37.0 94-95 33.128625 37.0 37.0 37.0 14.0 37.0 96-97 33.065124999999995 37.0 37.0 37.0 14.0 37.0 98-99 33.007374999999996 37.0 37.0 37.0 14.0 37.0 100-101 32.897625 37.0 37.0 37.0 14.0 37.0 102-103 32.886625 37.0 37.0 37.0 14.0 37.0 104-105 32.89475 37.0 37.0 37.0 14.0 37.0 106-107 32.832875 37.0 37.0 37.0 14.0 37.0 108-109 32.84975 37.0 37.0 37.0 8.0 37.0 110-111 32.766375 37.0 37.0 37.0 2.0 37.0 112-113 32.764875 37.0 37.0 37.0 2.0 37.0 114-115 32.692750000000004 37.0 37.0 37.0 2.0 37.0 116-117 32.649625 37.0 37.0 37.0 2.0 37.0 118-119 32.586749999999995 37.0 37.0 37.0 2.0 37.0 120-121 32.327749999999995 37.0 37.0 37.0 2.0 37.0 122-123 32.05875 37.0 37.0 37.0 2.0 37.0 124-125 30.995 37.0 35.0 37.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 3.0 6 3.0 7 4.0 8 5.0 9 5.0 10 3.0 11 1.0 12 4.0 13 2.0 14 5.0 15 1.0 16 3.0 17 6.0 18 10.0 19 9.0 20 10.0 21 13.0 22 37.0 23 82.0 24 143.0 25 16.0 26 12.0 27 17.0 28 22.0 29 20.0 30 37.0 31 68.0 32 65.0 33 57.0 34 101.0 35 187.0 36 3047.0 >>END_MODULE >>Per base sequence content pass #Base G A T C 1 24.818613960470355 24.44333249937453 21.341005754315738 29.39704778583938 2 25.2 22.875 20.3 31.624999999999996 3 23.95 23.724999999999998 22.925 29.4 4 26.8 21.2 21.85 30.15 5 28.999999999999996 20.925 19.15 30.925000000000004 6 28.799999999999997 23.825 21.475 25.900000000000002 7 23.925 27.05 25.275 23.75 8 25.35 26.3 29.075 19.275000000000002 9 24.5 28.825 28.799999999999997 17.875 10-11 25.6 26.55 27.525 20.325 12-13 26.650000000000002 26.687499999999996 25.4875 21.175 14-15 23.9875 28.1625 26.075 21.775 16-17 25.8 26.0125 25.4875 22.7 18-19 25.025 25.5125 25.275 24.1875 20-21 22.4875 26.137500000000003 26.05 25.324999999999996 22-23 24.125 25.3125 26.150000000000002 24.4125 24-25 24.6625 23.599999999999998 27.8875 23.849999999999998 26-27 23.775 23.4125 28.537499999999998 24.275 28-29 25.387500000000003 27.05 24.962500000000002 22.6 30-31 22.55 26.6625 26.2875 24.5 32-33 22.6 24.15 27.487499999999997 25.7625 34-35 24.825 24.175 24.9 26.1 36-37 24.525 24.5625 27.737499999999997 23.175 38-39 23.3 24.9125 26.35 25.4375 40-41 25.24454477050414 24.680210684725356 25.470278404815648 24.604966139954854 42-43 25.063067608476285 25.466700302724522 27.0686175580222 22.401614530776992 44-45 22.655159284173116 25.802766848584845 27.0465795151669 24.495494352075138 46-47 25.818367086995288 25.30887784995542 26.366068016813145 22.50668704623615 48-49 23.79310344827586 24.802043422733078 28.13537675606641 23.26947637292465 50-51 24.111382009495703 23.187475939946108 27.563197741562938 25.13794430899525 52-53 26.036866359447004 23.361495135688685 27.24014336917563 23.361495135688685 54-55 24.086945532667762 24.541893087324656 28.358397573613043 23.01276380639454 56-57 25.77020202020202 22.765151515151516 27.15909090909091 24.305555555555554 58-59 25.094434651221352 23.155376479476203 25.86250314782171 25.887685721480736 60-61 23.7875 23.5125 29.012500000000003 23.6875 62-63 22.3875 23.325000000000003 30.2625 24.025 64-65 23.425 23.2875 28.212500000000002 25.074999999999996 66-67 25.2375 23.5625 27.5625 23.6375 68-69 24.025 24.7875 28.599999999999998 22.5875 70-71 24.9375 27.575 25.7875 21.7 72-73 24.875 29.65 24.587500000000002 20.8875 74-75 23.25 30.425 25.1 21.224999999999998 76-77 22.8375 30.7125 24.05 22.400000000000002 78-79 23.225 31.0375 24.325 21.4125 80-81 22.8875 30.825000000000003 24.462500000000002 21.825 82-83 22.8 30.3 24.6625 22.237499999999997 84-85 22.425 30.612499999999997 24.725 22.237499999999997 86-87 23.724999999999998 29.475 24.1375 22.662499999999998 88-89 22.85 28.875 25.0375 23.2375 90-91 23.0125 28.825 25.5625 22.6 92-93 23.1 27.675 25.0 24.224999999999998 94-95 23.45 27.1 25.112499999999997 24.337500000000002 96-97 24.5 26.8375 25.174999999999997 23.4875 98-99 23.724999999999998 26.025 26.9125 23.3375 100-101 23.474999999999998 26.3625 26.0375 24.125 102-103 22.8625 26.737499999999997 25.624999999999996 24.775 104-105 23.8125 28.0625 24.675 23.45 106-107 23.674999999999997 27.650000000000002 24.75 23.925 108-109 23.425 30.325000000000003 23.875 22.375 110-111 22.7375 31.15 24.125 21.987499999999997 112-113 23.0125 31.075000000000003 23.4875 22.425 114-115 23.2625 32.0125 22.650000000000002 22.075 116-117 21.9 32.5625 23.5 22.037499999999998 118-119 23.5125 31.3125 22.7 22.475 120-121 22.5 32.6 22.95 21.95 122-123 23.02582100777137 31.511657056906493 22.248683880671845 23.21383805465029 124-125 23.349617938118502 31.028435425278715 23.011399223349617 22.610547413253162 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 18.0 1 14.5 2 9.5 3 7.5 4 5.0 5 4.0 6 3.5 7 1.5 8 1.0 9 0.5 10 0.5 11 0.5 12 0.0 13 1.0 14 1.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.5 22 2.5 23 1.5 24 1.0 25 5.5 26 7.5 27 7.5 28 9.0 29 10.5 30 11.5 31 14.0 32 24.5 33 28.5 34 34.5 35 44.5 36 53.5 37 77.5 38 100.0 39 119.5 40 150.0 41 175.5 42 186.5 43 186.0 44 187.5 45 191.0 46 186.5 47 180.5 48 160.5 49 155.5 50 159.5 51 149.5 52 132.5 53 116.5 54 109.0 55 96.5 56 82.5 57 74.5 58 62.5 59 56.0 60 60.0 61 57.0 62 48.5 63 41.0 64 38.0 65 37.5 66 37.5 67 34.0 68 30.5 69 35.0 70 30.5 71 19.5 72 25.0 73 22.0 74 15.0 75 15.0 76 11.5 77 9.0 78 6.5 79 4.5 80 3.5 81 2.5 82 1.0 83 0.0 84 0.5 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.325 42-43 0.8999999999999999 44-45 1.5125 46-47 1.8624999999999998 48-49 2.125 50-51 2.5875 52-53 2.35 54-55 1.0875 56-57 1.0 58-59 0.7250000000000001 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.27499999999999997 124-125 0.21250000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.825 #Duplication Level Percentage of deduplicated Percentage of total 1 98.16679576555642 95.05 2 1.4200877872450297 2.75 3 0.2581977794990963 0.75 4 0.0 0.0 5 0.02581977794990963 0.125 6 0.02581977794990963 0.15 7 0.02581977794990963 0.17500000000000002 8 0.0 0.0 9 0.02581977794990963 0.22499999999999998 >10 0.05163955589981926 0.775 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATG 20 0.5 TruSeq Adapter, Index 9 (100% over 49bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 11 0.27499999999999997 No Hit CCAGTCACCTCAGCGCCCTCCCTCCTTGTCCCCGATGGCCCGCACGAAGC 9 0.22499999999999998 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 7 0.17500000000000002 No Hit TATCCCCTGCTTCCCCGCTTCCTCTTCCTCCTCCCCCTCACTCCCCAAGC 6 0.15 No Hit ACTAAATCTCACACAGCCCATAGATCGGAAGAGCACACGTCTGAACTCCA 5 0.125 Illumina Multiplexing PCR Primer 2.01 (100% over 29bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.525 0.0 0.0 0.0 0.0 2 0.675 0.0 0.0 0.0 0.0 3 0.8 0.0 0.0 0.0 0.0 4 1.025 0.0 0.0 0.0 0.0 5 1.75 0.0 0.0 0.0 0.0 6 2.9 0.0 0.0 0.0 0.0 7 5.35 0.0 0.0 0.0 0.0 8 6.95 0.0 0.0 0.0 0.0 9 7.35 0.0 0.0 0.0 0.0 10-11 7.45 0.0 0.0 0.0 0.0 12-13 7.5 0.0 0.0 0.0 0.0 14-15 7.525 0.0 0.0 0.0 0.0 16-17 7.5625 0.0 0.0 0.0 0.0 18-19 7.6 0.0 0.0 0.0 0.0 20-21 7.725 0.0 0.0 0.0 0.0 22-23 7.9 0.0 0.0 0.0 0.0 24-25 7.975 0.0 0.0 0.0 0.0 26-27 8.0125 0.0 0.0 0.0 0.0 28-29 8.1375 0.0 0.0 0.0 0.0 30-31 8.15 0.0 0.0 0.0 0.0 32-33 8.175 0.0 0.0 0.0 0.0 34-35 8.25 0.0 0.0 0.0 0.0 36-37 8.462499999999999 0.0 0.0 0.0 0.0 38-39 8.5 0.0 0.0 0.0 0.0 40-41 8.6125 0.0 0.0 0.0 0.0 42-43 8.7625 0.0 0.0 0.0 0.0 44-45 8.9125 0.0 0.0 0.0 0.0 46-47 9.0375 0.0 0.0 0.0 0.0 48-49 9.175 0.0 0.0 0.0 0.0 50-51 9.3375 0.0 0.0 0.0 0.0 52-53 9.4875 0.0 0.0 0.0 0.0 54-55 9.5625 0.0 0.0 0.0 0.0 56-57 9.7 0.0 0.0 0.0 0.0 58-59 9.837499999999999 0.0 0.0 0.0 0.0 60-61 9.9375 0.0 0.0 0.0 0.0 62-63 10.2375 0.0 0.0 0.0 0.0 64-65 10.5375 0.0 0.0 0.0 0.0 66-67 10.75 0.0 0.0 0.0 0.0 68-69 10.962499999999999 0.0 0.0 0.0 0.0 70-71 11.125 0.0 0.0 0.0 0.0 72-73 11.4375 0.0 0.0 0.0 0.0 74-75 11.7 0.0 0.0 0.0 0.0 76-77 12.0125 0.0 0.0 0.0 0.0 78-79 12.1625 0.0 0.0 0.0 0.0 80-81 12.5125 0.0 0.0 0.0 0.0 82-83 12.9375 0.0 0.0 0.0 0.0 84-85 13.3875 0.0 0.0 0.0 0.0 86-87 13.75 0.0 0.0 0.0 0.0 88-89 14.1875 0.0 0.0 0.0 0.0 90-91 14.600000000000001 0.0 0.0 0.0 0.0 92-93 15.0125 0.0 0.0 0.0 0.0 94-95 15.425 0.0 0.0 0.0 0.0 96-97 15.950000000000001 0.0 0.0 0.0 0.0 98-99 16.375 0.0 0.0 0.0 0.0 100-101 16.825000000000003 0.0 0.0 0.0 0.0 102-103 17.3875 0.0 0.0 0.0 0.0 104-105 17.9875 0.0 0.0 0.0 0.0 106-107 18.675 0.0 0.0 0.0 0.0 108-109 19.3 0.0 0.0 0.0 0.0 110-111 20.012500000000003 0.0 0.0 0.0 0.0 112-113 20.737499999999997 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317430 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317430_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4335 33.0 33.0 33.0 33.0 33.0 2 32.47475 33.0 33.0 33.0 33.0 33.0 3 32.42375 33.0 33.0 33.0 33.0 33.0 4 32.45925 33.0 33.0 33.0 33.0 33.0 5 32.43 33.0 33.0 33.0 33.0 33.0 6 36.21575 37.0 37.0 37.0 37.0 37.0 7 36.22475 37.0 37.0 37.0 37.0 37.0 8 36.227 37.0 37.0 37.0 37.0 37.0 9 36.25575 37.0 37.0 37.0 37.0 37.0 10-11 36.268375 37.0 37.0 37.0 37.0 37.0 12-13 36.237624999999994 37.0 37.0 37.0 37.0 37.0 14-15 36.159625000000005 37.0 37.0 37.0 37.0 37.0 16-17 36.194 37.0 37.0 37.0 37.0 37.0 18-19 36.212125 37.0 37.0 37.0 37.0 37.0 20-21 36.213375 37.0 37.0 37.0 37.0 37.0 22-23 36.23525 37.0 37.0 37.0 37.0 37.0 24-25 36.24975 37.0 37.0 37.0 37.0 37.0 26-27 36.229625 37.0 37.0 37.0 37.0 37.0 28-29 36.261375 37.0 37.0 37.0 37.0 37.0 30-31 36.29875 37.0 37.0 37.0 37.0 37.0 32-33 36.3575 37.0 37.0 37.0 37.0 37.0 34-35 36.322874999999996 37.0 37.0 37.0 37.0 37.0 36-37 36.366125 37.0 37.0 37.0 37.0 37.0 38-39 36.34525 37.0 37.0 37.0 37.0 37.0 40-41 36.33325 37.0 37.0 37.0 37.0 37.0 42-43 36.328 37.0 37.0 37.0 37.0 37.0 44-45 36.348625 37.0 37.0 37.0 37.0 37.0 46-47 36.331 37.0 37.0 37.0 37.0 37.0 48-49 36.351375000000004 37.0 37.0 37.0 37.0 37.0 50-51 36.34675 37.0 37.0 37.0 37.0 37.0 52-53 36.313375 37.0 37.0 37.0 37.0 37.0 54-55 36.223124999999996 37.0 37.0 37.0 37.0 37.0 56-57 36.07325 37.0 37.0 37.0 37.0 37.0 58-59 35.9055 37.0 37.0 37.0 37.0 37.0 60-61 35.8975 37.0 37.0 37.0 37.0 37.0 62-63 35.941625 37.0 37.0 37.0 37.0 37.0 64-65 36.12625 37.0 37.0 37.0 37.0 37.0 66-67 36.188875 37.0 37.0 37.0 37.0 37.0 68-69 36.22275 37.0 37.0 37.0 37.0 37.0 70-71 35.9935 37.0 37.0 37.0 37.0 37.0 72-73 35.72975 37.0 37.0 37.0 37.0 37.0 74-75 34.77575 37.0 37.0 37.0 35.0 37.0 76-77 33.66975 37.0 37.0 37.0 27.0 37.0 78-79 33.57175 37.0 37.0 37.0 24.5 37.0 80-81 33.52525 37.0 37.0 37.0 24.5 37.0 82-83 33.471875 37.0 37.0 37.0 22.0 37.0 84-85 33.438125 37.0 37.0 37.0 18.0 37.0 86-87 33.3315 37.0 37.0 37.0 14.0 37.0 88-89 33.254999999999995 37.0 37.0 37.0 14.0 37.0 90-91 33.203125 37.0 37.0 37.0 14.0 37.0 92-93 33.109875 37.0 37.0 37.0 14.0 37.0 94-95 33.11325 37.0 37.0 37.0 14.0 37.0 96-97 33.044124999999994 37.0 37.0 37.0 14.0 37.0 98-99 33.076375 37.0 37.0 37.0 14.0 37.0 100-101 33.085499999999996 37.0 37.0 37.0 14.0 37.0 102-103 33.014250000000004 37.0 37.0 37.0 14.0 37.0 104-105 32.9275 37.0 37.0 37.0 2.0 37.0 106-107 32.94425 37.0 37.0 37.0 2.0 37.0 108-109 32.86575 37.0 37.0 37.0 2.0 37.0 110-111 32.81325 37.0 37.0 37.0 2.0 37.0 112-113 32.720375000000004 37.0 37.0 37.0 2.0 37.0 114-115 32.650375 37.0 37.0 37.0 2.0 37.0 116-117 32.6255 37.0 37.0 37.0 2.0 37.0 118-119 32.45525 37.0 37.0 37.0 2.0 37.0 120-121 32.422375 37.0 37.0 37.0 2.0 37.0 122-123 32.3315 37.0 37.0 37.0 2.0 37.0 124-125 30.875625 37.0 35.0 37.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 2.0 4 1.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 0.0 11 2.0 12 0.0 13 1.0 14 4.0 15 5.0 16 3.0 17 3.0 18 1.0 19 6.0 20 25.0 21 40.0 22 227.0 23 33.0 24 22.0 25 9.0 26 24.0 27 13.0 28 25.0 29 22.0 30 22.0 31 29.0 32 45.0 33 42.0 34 93.0 35 122.0 36 3157.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.05 18.925 24.7 25.324999999999996 2 29.732433108277068 15.753938484621155 21.80545136284071 32.70817704426106 3 25.882352941176475 15.944931163954942 23.554443053817273 34.618272841051315 4 27.973954420235415 14.750813924367643 25.244177310293015 32.03105434510393 5 31.254695717505637 15.82769847232657 19.233658903080393 33.6839469070874 6 34.813142713819914 16.679207424128418 26.33559066967645 22.172059192375222 7 29.320290945573113 26.36067218459995 29.771758214196137 14.5472786556308 8 19.46325558063707 27.389014296463504 36.89490845247053 16.252821670428894 9 29.27747114902158 28.424485699949827 27.09483191169092 15.203211239337683 10-11 24.73994234866525 25.805238751723277 29.464845218699086 19.989973680912396 12-13 20.190500062664494 25.88043614488031 29.101391151773402 24.82767264068179 14-15 19.804339646306286 27.505330490405118 29.61244199172206 23.07788787156654 16-17 20.74501442367992 26.48940173084159 26.226012793176974 26.53957105230152 18-19 26.765332998871187 25.93753919478239 21.873824156528283 25.423303649818134 20-21 20.66976044149003 28.91007149128308 29.11074877712279 21.3094192901041 22-23 20.60112711333751 23.218534752661242 28.653725735754538 27.526612398246712 24-25 24.232936756418283 26.46211646837821 26.70006261740764 22.60488415779587 26-27 23.879288755321813 27.02228900576008 24.555472076133235 24.542950162784873 28-29 27.64014014014014 25.713213213213216 23.473473473473476 23.173173173173172 30-31 25.25644233174881 29.059294470853143 25.13134851138354 20.55291468601451 32-33 24.031007751937985 30.29507376844211 24.33108277069267 21.342835708927232 34-35 25.1937984496124 28.569642410602654 22.693173293323333 23.543385846461614 36-37 23.268317079269817 26.36909227306827 27.294323580895224 23.068267066766694 38-39 22.95286910863858 26.02825353169146 28.66608326040755 22.352794099262407 40-41 22.9375 27.925 24.2375 24.9 42-43 23.724999999999998 29.0875 24.962500000000002 22.225 44-45 22.650000000000002 26.025 25.412499999999998 25.912499999999998 46-47 24.474999999999998 26.5 24.8125 24.212500000000002 48-49 26.075 26.6125 24.25 23.0625 50-51 26.8375 25.5125 23.5125 24.1375 52-53 24.65 25.575 25.4625 24.3125 54-55 23.845960863020572 26.517812343201204 24.14701455092825 25.489212242849973 56-57 23.23970273334173 27.45937775538481 24.499307217533694 24.801612293739765 58-59 22.313631185925832 28.312871788381216 25.54107075053791 23.832426275155044 60-61 20.386998861768056 27.87403566460099 26.59668648033388 25.14227899329708 62-63 21.805081532043992 29.756035899380613 25.357097712046517 23.081784856528884 64-65 21.581383710746906 29.48830226448142 25.822594770424125 23.107719254347554 66-67 20.54074352234322 32.644886719238954 23.60746025785455 23.206909500563274 68-69 21.6875 34.0125 21.925 22.375 70-71 21.25 33.0625 22.325 23.3625 72-73 21.302662832854107 33.61670208776097 22.665333166645834 22.415301912739093 74-75 22.643160790197552 33.13328332083021 22.643160790197552 21.580395098774694 76-77 23.070186413111475 32.25322156887277 22.407106217940697 22.269485800075064 78-79 22.408612919379067 32.58637956935403 22.684026039058587 22.320981472208313 80-81 21.8922305764411 31.879699248120303 22.807017543859647 23.42105263157895 82-83 22.447955856533735 31.48984198645598 22.172059192375222 23.890142964635064 84-85 23.595082789764174 31.083793276467635 22.553938785750123 22.76718514801806 86-87 22.96788760662318 31.57300551931761 23.14350225790266 22.31560461615655 88-89 23.462986198243414 30.602258469259723 23.099121706398996 22.835633626097867 90-91 24.77420973406924 29.89212242849975 22.729553437029605 22.604114400401404 92-93 23.82685069008783 30.250941028858218 23.174404015056464 22.74780426599749 94-95 24.83381412266399 29.02295246456792 23.504327103975918 22.638906308792173 96-97 24.96236828901154 29.352734570998496 22.729553437029605 22.955343702960363 98-99 24.333124608641203 28.566061365059486 23.068252974326864 24.032561051972447 100-101 24.63313683682428 29.23617208077261 22.87721058572683 23.253480496676282 102-103 24.724310776942357 29.24812030075188 22.932330827067666 23.095238095238095 104-105 24.893563736538944 30.265464562985223 22.539444027047335 22.301527673428502 106-107 24.129727022289003 29.489105935386927 22.96518908089156 23.415977961432507 108-109 23.92991239048811 29.737171464330416 23.178973717146434 23.153942428035045 110-111 23.9389007136597 30.787529735820705 22.22361337172906 23.049956178790534 112-113 23.876861469152797 31.347766237016643 22.17494681516706 22.600425478663496 114-115 24.193548387096776 30.682670667666915 22.793198299574893 22.330582645661416 116-117 24.381095273818453 30.75768942235559 22.53063265816454 22.330582645661416 118-119 23.718429607401852 31.032758189547387 22.13053263315829 23.118279569892472 120-121 23.92799099887486 31.141392674084262 23.015376922115262 21.915239404925615 122-123 24.8906113264158 30.391298912364046 22.7903487935992 21.927740967620952 124-125 24.75 30.25 22.8625 22.1375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 14.0 1 10.0 2 5.0 3 2.5 4 2.0 5 2.5 6 1.5 7 1.5 8 2.0 9 1.0 10 0.5 11 1.0 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 1.5 18 3.0 19 1.5 20 0.5 21 2.5 22 3.0 23 3.0 24 5.5 25 6.0 26 6.5 27 6.5 28 7.0 29 9.0 30 14.0 31 21.0 32 29.0 33 38.0 34 48.0 35 64.0 36 88.5 37 98.0 38 112.0 39 145.5 40 160.0 41 164.0 42 177.5 43 196.0 44 178.0 45 154.0 46 168.5 47 161.5 48 150.0 49 158.0 50 161.5 51 148.5 52 127.0 53 113.0 54 105.5 55 111.5 56 100.0 57 81.5 58 75.5 59 68.5 60 56.0 61 44.5 62 43.0 63 45.0 64 44.5 65 32.0 66 24.5 67 25.0 68 20.5 69 22.5 70 21.0 71 21.5 72 19.5 73 12.0 74 14.0 75 14.0 76 11.0 77 8.0 78 4.5 79 1.5 80 0.0 81 0.5 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.125 4 0.17500000000000002 5 0.17500000000000002 6 0.325 7 0.325 8 0.325 9 0.35000000000000003 10-11 0.2625 12-13 0.2625 14-15 0.3375 16-17 0.3375 18-19 0.3375 20-21 0.3375 22-23 0.1875 24-25 0.1875 26-27 0.17500000000000002 28-29 0.1 30-31 0.075 32-33 0.025 34-35 0.025 36-37 0.025 38-39 0.0125 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.35000000000000003 56-57 0.7625 58-59 1.2375 60-61 1.1625 62-63 1.1125 64-65 0.08750000000000001 66-67 0.13749999999999998 68-69 0.0 70-71 0.0 72-73 0.0125 74-75 0.025 76-77 0.08750000000000001 78-79 0.15 80-81 0.25 82-83 0.325 84-85 0.35000000000000003 86-87 0.35000000000000003 88-89 0.375 90-91 0.35000000000000003 92-93 0.375 94-95 0.3375 96-97 0.35000000000000003 98-99 0.1875 100-101 0.3375 102-103 0.25 104-105 0.17500000000000002 106-107 0.17500000000000002 108-109 0.125 110-111 0.1625 112-113 0.11249999999999999 114-115 0.025 116-117 0.025 118-119 0.025 120-121 0.0125 122-123 0.0125 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.48717948717949 96.025 2 1.2307692307692308 2.4 3 0.15384615384615385 0.44999999999999996 4 0.02564102564102564 0.1 5 0.05128205128205128 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02564102564102564 0.22499999999999998 >10 0.02564102564102564 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCC 22 0.5499999999999999 Illumina Single End PCR Primer 1 (100% over 50bp) AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 9 0.22499999999999998 No Hit TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit ATGGGCTGTGTGAGATTTAGTAGATCGGAAGAGCGTCGTGTAGGGAAAGA 5 0.125 Illumina Single End PCR Primer 1 (100% over 29bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.55 0.0 0.0 0.0 0.0 2 0.7 0.0 0.0 0.0 0.0 3 0.85 0.0 0.0 0.0 0.0 4 1.075 0.0 0.0 0.0 0.0 5 1.8 0.0 0.0 0.0 0.0 6 2.95 0.0 0.0 0.0 0.0 7 5.5 0.0 0.0 0.0 0.0 8 7.175 0.0 0.0 0.0 0.0 9 7.575 0.0 0.0 0.0 0.0 10-11 7.675 0.0 0.0 0.0 0.0 12-13 7.725 0.0 0.0 0.0 0.0 14-15 7.75 0.0 0.0 0.0 0.0 16-17 7.7875 0.0 0.0 0.0 0.0 18-19 7.825 0.0 0.0 0.0 0.0 20-21 7.95 0.0 0.0 0.0 0.0 22-23 8.125 0.0 0.0 0.0 0.0 24-25 8.2 0.0 0.0 0.0 0.0 26-27 8.2 0.0 0.0 0.0 0.0 28-29 8.325 0.0 0.0 0.0 0.0 30-31 8.35 0.0 0.0 0.0 0.0 32-33 8.3625 0.0 0.0 0.0 0.0 34-35 8.425 0.0 0.0 0.0 0.0 36-37 8.6375 0.0 0.0 0.0 0.0 38-39 8.662500000000001 0.0 0.0 0.0 0.0 40-41 8.75 0.0 0.0 0.0 0.0 42-43 8.825 0.0 0.0 0.0 0.0 44-45 8.899999999999999 0.0 0.0 0.0 0.0 46-47 8.975 0.0 0.0 0.0 0.0 48-49 9.075 0.0 0.0 0.0 0.0 50-51 9.225000000000001 0.0 0.0 0.0 0.0 52-53 9.3 0.0 0.0 0.0 0.0 54-55 9.337499999999999 0.0 0.0 0.0 0.0 56-57 9.4625 0.0 0.0 0.0 0.0 58-59 9.587499999999999 0.0 0.0 0.0 0.0 60-61 9.6625 0.0 0.0 0.0 0.0 62-63 9.95 0.0 0.0 0.0 0.0 64-65 10.2625 0.0 0.0 0.0 0.0 66-67 10.4375 0.0 0.0 0.0 0.0 68-69 10.6125 0.0 0.0 0.0 0.0 70-71 10.774999999999999 0.0 0.0 0.0 0.0 72-73 11.0 0.0 0.0 0.0 0.0 74-75 11.2875 0.0 0.0 0.0 0.0 76-77 11.524999999999999 0.0 0.0 0.0 0.0 78-79 11.6875 0.0 0.0 0.0 0.0 80-81 11.9375 0.0 0.0 0.0 0.0 82-83 12.2375 0.0 0.0 0.0 0.0 84-85 12.6 0.0 0.0 0.0 0.0 86-87 12.95 0.0 0.0 0.0 0.0 88-89 13.287500000000001 0.0 0.0 0.0 0.0 90-91 13.6625 0.0 0.0 0.0 0.0 92-93 13.9625 0.0 0.0 0.0 0.0 94-95 14.3625 0.0 0.0 0.0 0.0 96-97 14.787500000000001 0.0 0.0 0.0 0.0 98-99 15.175 0.0 0.0 0.0 0.0 100-101 15.4875 0.0 0.0 0.0 0.0 102-103 15.95 0.0 0.0 0.0 0.0 104-105 16.575 0.0 0.0 0.0 0.0 106-107 17.200000000000003 0.0 0.0 0.0 0.0 108-109 17.725 0.0 0.0 0.0 0.0 110-111 18.25 0.0 0.0 0.0 0.0 112-113 18.862499999999997 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGTGTG 15 2.5068579E-4 119.0 5 GTGTGCT 50 6.8675945E-8 71.4 7 TGTGCTC 50 6.8675945E-8 71.4 8 GTGCTCT 50 6.8675945E-8 71.4 9 GGTGTGC 45 3.310257E-6 66.11111 6 CCGATCT 20 1.667234E-4 59.499996 16-17 TTCCGAT 25 5.01952E-4 47.6 14-15 TCCGATC 25 5.01952E-4 47.6 16-17 CTTCCGA 25 5.01952E-4 47.6 14-15 GCTCTTC 50 1.8790342E-7 41.649998 10-11 CTCTTCC 40 1.09446126E-4 37.1875 12-13 TCTTCCG 40 1.09446126E-4 37.1875 12-13 TGCTCTT 50 9.365898E-6 35.7 10-11 >>END_MODULE Read 1116711 spots for ERR3317430.sra Written 1116711 spots for ERR3317430.sra Read 1116711 spots for ERR3317430.sra Written 1116711 spots for ERR3317430.sra Read 1116711 spots for ERR3317430.sra Written 1116711 spots for ERR3317430.sra Read 1116711 spots for ERR3317430.sra Written 1116711 spots for ERR3317430.sra Read 1116711 spots for ERR3317430.sra Written 1116711 spots for ERR3317430.sra Read 1116711 spots for ERR3317430.sra Written 1116711 spots for ERR3317430.sra Read 1116711 spots for ERR3317430.sra Written 1116711 spots for ERR3317430.sra Read 1116711 spots for ERR3317430.sra Written 1116711 spots for ERR3317430.sra Read 1116711 spots for ERR3317430.sra Written 1116711 spots for ERR3317430.sra Read 1116711 spots for ERR3317430.sra Written 1116711 spots for ERR3317430.sra Read 1116711 spots for ERR3317430.sra Written 1116711 spots for ERR3317430.sra Read 1116711 spots for ERR3317430.sra Written 1116711 spots for ERR3317430.sra Read 1116711 spots for ERR3317430.sra Written 1116711 spots for ERR3317430.sra Read 1116711 spots for ERR3317430.sra Written 1116711 spots for ERR3317430.sra Read 1116711 spots for ERR3317430.sra Written 1116711 spots for ERR3317430.sra Read 1116711 spots for ERR3317430.sra Written 1116711 spots for ERR3317430.sra Read 1116711 spots for ERR3317430.sra Written 1116711 spots for ERR3317430.sra Read 1116716 spots for ERR3317430.sra Written 1116716 spots for ERR3317430.sra Read 1116711 spots for ERR3317430.sra Written 1116711 spots for ERR3317430.sra Read 1116711 spots for ERR3317430.sra Written 1116711 spots for ERR3317430.sra SRR ids: ['ERR3317430.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dqjt4bh6 ERR3317430.sra spots: 22334225 blocks: [[1, 1116711], [1116712, 2233422], [2233423, 3350133], [3350134, 4466844], [4466845, 5583555], [5583556, 6700266], [6700267, 7816977], [7816978, 8933688], [8933689, 10050399], [10050400, 11167110], [11167111, 12283821], [12283822, 13400532], [13400533, 14517243], [14517244, 15633954], [15633955, 16750665], [16750666, 17867376], [17867377, 18984087], [18984088, 20100798], [20100799, 21217509], [21217510, 22334225]] ERR3317430 file size 6412475 ERR3317430 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317430 ERR3317430_1.fastq ERR3317430_2.fastq Input file: ERR3317430_1.fastq Paired file: ERR3317430_2.fastq trimmed: ERR3317430-trimmed-pair1.fastq, ERR3317430-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:07:53 2024 >> started Tue Dec 10 09:08:14 2024 >> done (21.103s) 22334225 read pairs processed; of these: 1555831 ( 6.97%) short read pairs filtered out after trimming by size control 237708 ( 1.06%) empty read pairs filtered out after trimming by size control 20540686 (91.97%) read pairs available; of these: 6786704 (33.04%) trimmed read pairs available after processing 13753982 (66.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3417 0.02% 19 16978 0.08% 20 18850 0.09% 21 37128 0.18% 22 13149 0.06% 23 12037 0.06% 24 4237 0.02% 25 5473 0.03% 26 5867 0.03% 27 7313 0.04% 28 6292 0.03% 29 4801 0.02% 30 3332 0.02% 31 3356 0.02% 32 3872 0.02% 33 4369 0.02% 34 7357 0.04% 35 22424 0.11% 36 5963 0.03% 37 4947 0.02% 38 5761 0.03% 39 7872 0.04% 40 8574 0.04% 41 7589 0.04% 42 9122 0.04% 43 14672 0.07% 44 17947 0.09% 45 12904 0.06% 46 12942 0.06% 47 10416 0.05% 48 10803 0.05% 49 11192 0.05% 50 11768 0.06% 51 11760 0.06% 52 12357 0.06% 53 12450 0.06% 54 13605 0.07% 55 14681 0.07% 56 14130 0.07% 57 16216 0.08% 58 16756 0.08% 59 16908 0.08% 60 19041 0.09% 61 19266 0.09% 62 20311 0.10% 63 22611 0.11% 64 24621 0.12% 65 22932 0.11% 66 25483 0.12% 67 26604 0.13% 68 26304 0.13% 69 27255 0.13% 70 27779 0.14% 71 30987 0.15% 72 34829 0.17% 73 38215 0.19% 74 38986 0.19% 75 38313 0.19% 76 39810 0.19% 77 40658 0.20% 78 42603 0.21% 79 42740 0.21% 80 44192 0.22% 81 43952 0.21% 82 43627 0.21% 83 46281 0.23% 84 47752 0.23% 85 49532 0.24% 86 52831 0.26% 87 51688 0.25% 88 54774 0.27% 89 59277 0.29% 90 56957 0.28% 91 54312 0.26% 92 55236 0.27% 93 55499 0.27% 94 58124 0.28% 95 61108 0.30% 96 62956 0.31% 97 65655 0.32% 98 67438 0.33% 99 71809 0.35% 100 72194 0.35% 101 73330 0.36% 102 69504 0.34% 103 70586 0.34% 104 72201 0.35% 105 75903 0.37% 106 75817 0.37% 107 77032 0.38% 108 76635 0.37% 109 79054 0.38% 110 79614 0.39% 111 81936 0.40% 112 87790 0.43% 113 87473 0.43% 114 88328 0.43% 115 94038 0.46% 116 95464 0.46% 117 101273 0.49% 118 103832 0.51% 119 112691 0.55% 120 125628 0.61% 121 150266 0.73% 122 187012 0.91% 123 307110 1.50% 124 2168058 10.55% 125 13753982 66.96% 20540686 reads passed initial QC criterion=sequence-density sequence-density=3.78 sequence-density-rank=1 fanout-score=60.83 fanout-score-rank=1 prefix-density=4.14 prefix-fanout=55.5 sequence=AGATCGGAAGAGCACACC criterion=fanout-score sequence-density=3.78 sequence-density-rank=1 fanout-score=60.83 fanout-score-rank=1 prefix-density=4.14 prefix-fanout=55.5 sequence=AGATCGGAAGAGCACACC criterion=sequence-density sequence-density=11.75 sequence-density-rank=1 fanout-score=36.31 fanout-score-rank=2 prefix-density=11.99 prefix-fanout=35.6 sequence=GGTGTGCTCTTCCGATCT criterion=fanout-score sequence-density=0.98 sequence-density-rank=19 fanout-score=49.85 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=48.8 sequence=CCGTGTGCTCTTC Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACC -y GGTGTGCTCTTCCGATCT -o ERR3317430 ERR3317430_1.fastq ERR3317430_2.fastq Input file: ERR3317430_1.fastq Paired file: ERR3317430_2.fastq trimmed: ERR3317430-trimmed-pair1.fastq, ERR3317430-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACC -- paired 3' end adapter sequence (-y): GGTGTGCTCTTCCGATCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:09:50 2024 >> started Tue Dec 10 09:10:05 2024 >> done (14.646s) 15405515 read pairs processed; of these: 5663 ( 0.04%) short read pairs filtered out after trimming by size control 6986 ( 0.05%) empty read pairs filtered out after trimming by size control 15392866 (99.92%) read pairs available; of these: 6261 ( 0.04%) trimmed read pairs available after processing 15386605 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2612 0.02% 19 12782 0.08% 20 14191 0.09% 21 28014 0.18% 22 9739 0.06% 23 6810 0.04% 24 3071 0.02% 25 4092 0.03% 26 4381 0.03% 27 5528 0.04% 28 4907 0.03% 29 3624 0.02% 30 2510 0.02% 31 2494 0.02% 32 2924 0.02% 33 3256 0.02% 34 5570 0.04% 35 16896 0.11% 36 4512 0.03% 37 3690 0.02% 38 4451 0.03% 39 5934 0.04% 40 6398 0.04% 41 5690 0.04% 42 6931 0.05% 43 11053 0.07% 44 13277 0.09% 45 9316 0.06% 46 8787 0.06% 47 7747 0.05% 48 8186 0.05% 49 8438 0.05% 50 8809 0.06% 51 8867 0.06% 52 9341 0.06% 53 9329 0.06% 54 10293 0.07% 55 11079 0.07% 56 10580 0.07% 57 12209 0.08% 58 12667 0.08% 59 12712 0.08% 60 14394 0.09% 61 14482 0.09% 62 15227 0.10% 63 16885 0.11% 64 18523 0.12% 65 17158 0.11% 66 19027 0.12% 67 19772 0.13% 68 19505 0.13% 69 20221 0.13% 70 20695 0.13% 71 23239 0.15% 72 26213 0.17% 73 28509 0.19% 74 29279 0.19% 75 28695 0.19% 76 29911 0.19% 77 30298 0.20% 78 32096 0.21% 79 32199 0.21% 80 32993 0.21% 81 33084 0.21% 82 32567 0.21% 83 34553 0.22% 84 35862 0.23% 85 37042 0.24% 86 39680 0.26% 87 38770 0.25% 88 41193 0.27% 89 44506 0.29% 90 42565 0.28% 91 40628 0.26% 92 41234 0.27% 93 41708 0.27% 94 43444 0.28% 95 45613 0.30% 96 47291 0.31% 97 49140 0.32% 98 50279 0.33% 99 53636 0.35% 100 54111 0.35% 101 54904 0.36% 102 52026 0.34% 103 52897 0.34% 104 54067 0.35% 105 56833 0.37% 106 56868 0.37% 107 57587 0.37% 108 57427 0.37% 109 59354 0.39% 110 59828 0.39% 111 61188 0.40% 112 65705 0.43% 113 65601 0.43% 114 66188 0.43% 115 70466 0.46% 116 71265 0.46% 117 75909 0.49% 118 77590 0.50% 119 84267 0.55% 120 94231 0.61% 121 112590 0.73% 122 140344 0.91% 123 231363 1.50% 124 1623429 10.55% 125 10311015 66.99% criterion=sequence-density sequence-density=3.78 sequence-density-rank=1 fanout-score=60.91 fanout-score-rank=1 prefix-density=4.14 prefix-fanout=55.6 sequence=AGATCGGAAGAGCACACC criterion=fanout-score sequence-density=3.78 sequence-density-rank=1 fanout-score=60.91 fanout-score-rank=1 prefix-density=4.14 prefix-fanout=55.6 sequence=AGATCGGAAGAGCACACC criterion=sequence-density sequence-density=11.61 sequence-density-rank=1 fanout-score=36.22 fanout-score-rank=3 prefix-density=11.86 prefix-fanout=35.5 sequence=GGTGTGCTCTTCCGATCT criterion=fanout-score sequence-density=0.97 sequence-density-rank=19 fanout-score=48.64 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=48.0 sequence=CCGTGTGCTCTTC ERR3317430 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:11:15 Started mapping on | Dec 10 09:11:15 Finished on | Dec 10 09:12:41 Mapping speed, Million of reads per hour | 859.31 Number of input reads | 20528037 Average input read length | 228 UNIQUE READS: Uniquely mapped reads number | 15132203 Uniquely mapped reads % | 73.71% Average mapped length | 230.51 Number of splices: Total | 8282377 Number of splices: Annotated (sjdb) | 7765916 Number of splices: GT/AG | 8124483 Number of splices: GC/AG | 125607 Number of splices: AT/AC | 7198 Number of splices: Non-canonical | 25089 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 1.26 Insertion rate per base | 0.00% Insertion average length | 1.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1252851 % of reads mapped to multiple loci | 6.10% Number of reads mapped to too many loci | 118926 % of reads mapped to too many loci | 0.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 17.01% % of reads unmapped: other | 2.59% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4170617 4170617 4170617 N_multimapping 1252851 1252851 1252851 N_noFeature 741423 3885604 11612144 N_ambiguous 591342 213290 71859 UnstrandedReadsAssigned:13799438 PositiveStrandReadsAssigned:11033309 NegativeStrandReadsAssigned:3448200 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=123 echo kmer=119 ERR3317430 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317430-trimmed-pair1.fastq ERR3317430-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,528,037 reads, 18,170,005 reads pseudoaligned [quant] estimated average fragment length: 200.222 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,128 rounds 52973 ERR3317430.ke.tsv 35125 ERR3317430.se.tsv 88098 total ==> ERR3317430.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 737.123 0 0 PNS24247 1044 844.778 38.5726 3.24192 PNS24249 1928 1728.78 17.8108 0.731495 PNS24246 1044 844.778 38.5726 3.24192 PNS24248 1044 844.778 38.5726 3.24192 PNS24244 1471 1271.78 269.472 15.0442 PNS24243 293 129.013 3 1.65103 KQK14069 1603 1403.78 26060.1 1318.09 KQK14071 474 285.955 13.5197 3.35688 ==> ERR3317430.se.tsv <== BRADI_1g14170v3 21778 BRADI_1g53295v3 36 BRADI_1g59795v3 243 BRADI_1g07683v3 0 BRADI_1g00485v3 148 BRADI_1g20270v3 904 BRADI_1g74790v3 227 BRADI_1g09890v3 0 BRADI_1g77505v3 257 BRADI_1g48960v3 0 ERR3317430 completed mapping pipeline successfully