Starting /dee2/code/volunteer_pipeline.sh ERR3317433 current disk space = 1525269311488 free memory = 1528542316 ERR3317433 SRAfilesize d727ea68b47c6f7cb236ea573125b7e1 ERR3317433.sra ERR3317433.sra file validated ERR3317433 is paired end ERR3317433 is conventional basespace ERR3317433 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317433_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.821 33.0 33.0 33.0 33.0 33.0 2 32.24975 33.0 33.0 33.0 33.0 33.0 3 32.376 33.0 33.0 33.0 33.0 33.0 4 32.65325 33.0 33.0 33.0 33.0 33.0 5 32.6125 33.0 33.0 33.0 33.0 33.0 6 36.1685 37.0 37.0 37.0 33.0 37.0 7 36.3855 37.0 37.0 37.0 37.0 37.0 8 36.42625 37.0 37.0 37.0 37.0 37.0 9 36.53025 37.0 37.0 37.0 37.0 37.0 10-11 36.424375 37.0 37.0 37.0 37.0 37.0 12-13 36.469875 37.0 37.0 37.0 37.0 37.0 14-15 36.435 37.0 37.0 37.0 37.0 37.0 16-17 36.3455 37.0 37.0 37.0 37.0 37.0 18-19 36.3855 37.0 37.0 37.0 37.0 37.0 20-21 36.37075 37.0 37.0 37.0 37.0 37.0 22-23 36.31175 37.0 37.0 37.0 37.0 37.0 24-25 36.342 37.0 37.0 37.0 37.0 37.0 26-27 36.238 37.0 37.0 37.0 37.0 37.0 28-29 36.234375 37.0 37.0 37.0 37.0 37.0 30-31 36.254125 37.0 37.0 37.0 37.0 37.0 32-33 36.360625 37.0 37.0 37.0 37.0 37.0 34-35 36.327875000000006 37.0 37.0 37.0 37.0 37.0 36-37 36.321 37.0 37.0 37.0 37.0 37.0 38-39 36.223124999999996 37.0 37.0 37.0 37.0 37.0 40-41 36.157875000000004 37.0 37.0 37.0 37.0 37.0 42-43 36.15875 37.0 37.0 37.0 37.0 37.0 44-45 36.092375000000004 37.0 37.0 37.0 37.0 37.0 46-47 35.963875 37.0 37.0 37.0 37.0 37.0 48-49 35.90925 37.0 37.0 37.0 35.0 37.0 50-51 36.012125 37.0 37.0 37.0 37.0 37.0 52-53 35.94675 37.0 37.0 37.0 37.0 37.0 54-55 35.940625 37.0 37.0 37.0 35.0 37.0 56-57 35.912 37.0 37.0 37.0 35.0 37.0 58-59 35.9465 37.0 37.0 37.0 35.0 37.0 60-61 35.849375 37.0 37.0 37.0 33.0 37.0 62-63 35.824 37.0 37.0 37.0 33.0 37.0 64-65 35.88875 37.0 37.0 37.0 35.0 37.0 66-67 35.86775 37.0 37.0 37.0 33.0 37.0 68-69 35.795625 37.0 37.0 37.0 33.0 37.0 70-71 35.817875 37.0 37.0 37.0 33.0 37.0 72-73 35.7215 37.0 37.0 37.0 33.0 37.0 74-75 35.676874999999995 37.0 37.0 37.0 33.0 37.0 76-77 35.602875 37.0 37.0 37.0 33.0 37.0 78-79 35.44825 37.0 37.0 37.0 33.0 37.0 80-81 35.452375 37.0 37.0 37.0 33.0 37.0 82-83 35.33075 37.0 37.0 37.0 33.0 37.0 84-85 35.246125 37.0 37.0 37.0 33.0 37.0 86-87 35.243624999999994 37.0 37.0 37.0 33.0 37.0 88-89 35.195125000000004 37.0 37.0 37.0 33.0 37.0 90-91 35.191375 37.0 37.0 37.0 33.0 37.0 92-93 35.16525 37.0 37.0 37.0 33.0 37.0 94-95 35.145250000000004 37.0 37.0 37.0 33.0 37.0 96-97 34.941 37.0 37.0 37.0 33.0 37.0 98-99 34.924 37.0 37.0 37.0 33.0 37.0 100-101 34.97825 37.0 37.0 37.0 33.0 37.0 102-103 34.917375 37.0 37.0 37.0 33.0 37.0 104-105 34.784125 37.0 37.0 37.0 33.0 37.0 106-107 34.672250000000005 37.0 37.0 37.0 33.0 37.0 108-109 34.595125 37.0 37.0 37.0 30.0 37.0 110-111 34.571875 37.0 37.0 37.0 30.0 37.0 112-113 34.51525 37.0 37.0 37.0 27.0 37.0 114-115 34.389250000000004 37.0 37.0 37.0 27.0 37.0 116-117 34.413250000000005 37.0 37.0 37.0 27.0 37.0 118-119 34.347375 37.0 37.0 37.0 30.0 37.0 120-121 34.0435 37.0 37.0 37.0 27.0 37.0 122-123 33.79625 37.0 37.0 37.0 27.0 37.0 124-125 31.76275 37.0 35.0 37.0 12.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 2.0 12 1.0 13 4.0 14 4.0 15 2.0 16 3.0 17 1.0 18 1.0 19 5.0 20 4.0 21 5.0 22 15.0 23 19.0 24 21.0 25 12.0 26 16.0 27 14.0 28 30.0 29 34.0 30 41.0 31 77.0 32 100.0 33 134.0 34 209.0 35 510.0 36 2732.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 25.152398621786375 24.410283593957065 19.560031804929764 30.877285979326796 2 24.775 23.1 20.0 32.125 3 25.7 24.4 20.8 29.099999999999998 4 28.000000000000004 22.900000000000002 20.45 28.65 5 31.525 21.349999999999998 17.925 29.2 6 28.825 24.375 21.275 25.525 7 26.275 23.25 23.3 27.175 8 27.975 24.8 27.125 20.1 9 28.65 28.15 25.25 17.95 10-11 29.312500000000004 25.912499999999998 25.3 19.475 12-13 27.6875 25.687500000000004 25.4375 21.1875 14-15 26.937499999999996 25.7 25.0125 22.35 16-17 26.2625 23.825 26.224999999999998 23.6875 18-19 25.974999999999998 25.1 25.387500000000003 23.5375 20-21 25.724999999999998 24.6875 26.0375 23.549999999999997 22-23 25.637500000000003 24.712500000000002 25.874999999999996 23.775 24-25 24.75 24.224999999999998 26.875 24.15 26-27 25.1 24.3875 26.437500000000004 24.075 28-29 26.025 24.15 25.95 23.875 30-31 25.2375 25.0625 26.1125 23.5875 32-33 25.7625 24.025 26.2625 23.95 34-35 24.45 24.762500000000003 25.775 25.0125 36-37 24.3875 24.9 26.6625 24.05 38-39 25.387500000000003 24.65 26.1 23.8625 40-41 25.124999999999996 25.025 25.575 24.275 42-43 25.2625 23.925 26.825 23.9875 44-45 24.8125 24.15 26.700000000000003 24.337500000000002 46-47 24.9875 24.325 25.974999999999998 24.712500000000002 48-49 25.1 23.525 26.987499999999997 24.3875 50-51 25.7125 23.962500000000002 26.937499999999996 23.3875 52-53 26.487500000000004 24.0 25.624999999999996 23.8875 54-55 25.6125 24.15 26.637499999999996 23.599999999999998 56-57 25.75 24.2 25.6 24.45 58-59 25.874999999999996 23.5 25.637500000000003 24.9875 60-61 23.974999999999998 24.925 26.8625 24.2375 62-63 24.75 24.175 26.35 24.725 64-65 25.2625 24.4375 26.400000000000002 23.9 66-67 24.7875 25.074999999999996 26.75 23.3875 68-69 25.6125 24.3 26.5625 23.525 70-71 24.6875 24.887500000000003 25.650000000000002 24.775 72-73 24.975 24.8 26.7625 23.4625 74-75 26.224999999999998 25.275 25.900000000000002 22.6 76-77 26.2125 25.275 25.0125 23.5 78-79 24.6875 25.45 26.0625 23.799999999999997 80-81 25.8625 23.95 26.9125 23.275000000000002 82-83 25.7125 25.174999999999997 25.662499999999998 23.45 84-85 25.275 24.75 26.55 23.425 86-87 25.4625 24.725 26.187500000000004 23.625 88-89 25.35 25.362499999999997 25.5625 23.724999999999998 90-91 25.174999999999997 24.962500000000002 26.125 23.7375 92-93 25.7375 24.575 25.4625 24.224999999999998 94-95 25.624999999999996 23.95 26.525 23.9 96-97 25.7 23.2875 27.462500000000002 23.549999999999997 98-99 26.450000000000003 24.425 25.2 23.925 100-101 26.6 24.5125 25.174999999999997 23.7125 102-103 26.387500000000003 25.112499999999997 25.6 22.900000000000002 104-105 24.95 24.637500000000003 25.974999999999998 24.4375 106-107 25.3 25.112499999999997 25.4875 24.099999999999998 108-109 24.725 25.4625 26.1 23.7125 110-111 25.5125 25.124999999999996 25.687500000000004 23.674999999999997 112-113 25.8625 25.85 24.975 23.3125 114-115 24.925 26.200000000000003 25.0625 23.8125 116-117 24.8625 25.424999999999997 24.825 24.887500000000003 118-119 25.624999999999996 25.5625 24.087500000000002 24.725 120-121 25.5625 25.4375 25.575 23.425 122-123 25.324999999999996 26.1 25.05 23.525 124-125 24.2625 25.937500000000004 24.75 25.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 2.0 22 2.0 23 1.5 24 1.5 25 2.5 26 4.5 27 3.0 28 4.0 29 8.0 30 8.0 31 10.5 32 17.0 33 22.5 34 28.0 35 35.5 36 47.5 37 66.5 38 79.0 39 93.0 40 113.0 41 147.5 42 177.5 43 170.0 44 174.5 45 195.0 46 186.0 47 189.5 48 199.0 49 179.0 50 160.5 51 151.5 52 133.0 53 126.0 54 131.0 55 104.5 56 85.0 57 76.5 58 71.5 59 76.5 60 67.5 61 56.0 62 58.5 63 55.5 64 48.5 65 49.5 66 50.0 67 50.0 68 43.0 69 37.5 70 33.0 71 30.5 72 34.0 73 28.0 74 17.5 75 11.0 76 9.0 77 9.0 78 6.0 79 5.0 80 5.0 81 2.5 82 1.5 83 1.5 84 1.5 85 1.5 86 0.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.875 #Duplication Level Percentage of deduplicated Percentage of total 1 97.93548387096774 94.875 2 1.5225806451612902 2.9499999999999997 3 0.3096774193548387 0.8999999999999999 4 0.1032258064516129 0.4 5 0.05161290322580645 0.25 6 0.0 0.0 7 0.05161290322580645 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.025806451612903226 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCACGCACACCAGAGCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCA 11 0.27499999999999997 No Hit ACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCA 7 0.17500000000000002 No Hit TGCTCGTGAAGGTAATGAAATTATCCGAGCAGCTTGCAAATGGAGTCCTG 7 0.17500000000000002 No Hit TATCCCCTGCTTCCCCGCTTCCTCTTCCTCCTCCCCCTCACTCCCCAAGC 5 0.125 No Hit ATGGCCGTTCTTAGTTGGTGGAGCGATTTGTCTGGTTAATTCCGTTAACG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.175 0.0 0.0 0.0 0.0 4 0.2 0.0 0.0 0.0 0.0 5 0.275 0.0 0.0 0.0 0.0 6 0.4 0.0 0.0 0.0 0.0 7 0.7 0.0 0.0 0.0 0.0 8 1.0 0.0 0.0 0.0 0.0 9 1.0 0.0 0.0 0.0 0.0 10-11 1.0 0.0 0.0 0.0 0.0 12-13 1.0 0.0 0.0 0.0 0.0 14-15 1.0 0.0 0.0 0.0 0.0 16-17 1.0 0.0 0.0 0.0 0.0 18-19 1.0 0.0 0.0 0.0 0.0 20-21 1.0 0.0 0.0 0.0 0.0 22-23 1.0 0.0 0.0 0.0 0.0 24-25 1.0125 0.0 0.0 0.0 0.0 26-27 1.025 0.0 0.0 0.0 0.0 28-29 1.025 0.0 0.0 0.0 0.0 30-31 1.05 0.0 0.0 0.0 0.0 32-33 1.05 0.0 0.0 0.0 0.0 34-35 1.075 0.0 0.0 0.0 0.0 36-37 1.075 0.0 0.0 0.0 0.0 38-39 1.1125 0.0 0.0 0.0 0.0 40-41 1.125 0.0 0.0 0.0 0.0 42-43 1.125 0.0 0.0 0.0 0.0 44-45 1.15 0.0 0.0 0.0 0.0 46-47 1.225 0.0 0.0 0.0 0.0 48-49 1.35 0.0 0.0 0.0 0.0 50-51 1.375 0.0 0.0 0.0 0.0 52-53 1.3875 0.0 0.0 0.0 0.0 54-55 1.425 0.0 0.0 0.0 0.0 56-57 1.475 0.0 0.0 0.0 0.0 58-59 1.6125 0.0 0.0 0.0 0.0 60-61 1.85 0.0 0.0 0.0 0.0 62-63 1.9500000000000002 0.0 0.0 0.0 0.0 64-65 2.0375 0.0 0.0 0.0 0.0 66-67 2.2125 0.0 0.0 0.0 0.0 68-69 2.3 0.0 0.0 0.0 0.0 70-71 2.4000000000000004 0.0 0.0 0.0 0.0 72-73 2.6 0.0 0.0 0.0 0.0 74-75 2.725 0.0 0.0 0.0 0.0 76-77 3.05 0.0 0.0 0.0 0.0 78-79 3.2875 0.0 0.0 0.0 0.0 80-81 3.4875 0.0 0.0 0.0 0.0 82-83 3.675 0.0 0.0 0.0 0.0 84-85 4.0375 0.0 0.0 0.0 0.0 86-87 4.375 0.0 0.0 0.0 0.0 88-89 4.5875 0.0 0.0 0.0 0.0 90-91 4.975 0.0 0.0 0.0 0.0 92-93 5.425 0.0 0.0 0.0 0.0 94-95 5.775 0.0 0.0 0.0 0.0 96-97 6.0 0.0 0.0 0.0 0.0 98-99 6.55 0.0 0.0 0.0 0.0 100-101 6.975 0.0 0.0 0.0 0.0 102-103 7.4 0.0 0.0 0.0 0.0 104-105 7.8875 0.0 0.0 0.0 0.0 106-107 8.45 0.0 0.0 0.0 0.0 108-109 8.9375 0.0 0.0 0.0 0.0 110-111 9.5125 0.0 0.0 0.0 0.0 112-113 10.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317433 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317433_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.88475 33.0 33.0 33.0 33.0 33.0 2 31.8055 33.0 33.0 33.0 33.0 33.0 3 31.752 33.0 33.0 33.0 33.0 33.0 4 31.8035 33.0 33.0 33.0 33.0 33.0 5 31.822 33.0 33.0 33.0 33.0 33.0 6 35.3965 37.0 37.0 37.0 33.0 37.0 7 35.426 37.0 37.0 37.0 37.0 37.0 8 35.46775 37.0 37.0 37.0 37.0 37.0 9 35.31325 37.0 37.0 37.0 33.0 37.0 10-11 35.347875 37.0 37.0 37.0 33.0 37.0 12-13 35.3945 37.0 37.0 37.0 37.0 37.0 14-15 35.372 37.0 37.0 37.0 37.0 37.0 16-17 35.354875 37.0 37.0 37.0 35.0 37.0 18-19 35.322874999999996 37.0 37.0 37.0 37.0 37.0 20-21 35.34375 37.0 37.0 37.0 37.0 37.0 22-23 35.29625 37.0 37.0 37.0 35.0 37.0 24-25 35.321749999999994 37.0 37.0 37.0 35.0 37.0 26-27 35.31625 37.0 37.0 37.0 37.0 37.0 28-29 35.282 37.0 37.0 37.0 37.0 37.0 30-31 35.171499999999995 37.0 37.0 37.0 33.0 37.0 32-33 35.218875 37.0 37.0 37.0 35.0 37.0 34-35 35.2685 37.0 37.0 37.0 35.0 37.0 36-37 35.2255 37.0 37.0 37.0 33.0 37.0 38-39 35.193875 37.0 37.0 37.0 33.0 37.0 40-41 35.207499999999996 37.0 37.0 37.0 33.0 37.0 42-43 35.229 37.0 37.0 37.0 33.0 37.0 44-45 35.072874999999996 37.0 37.0 37.0 33.0 37.0 46-47 35.1165 37.0 37.0 37.0 33.0 37.0 48-49 35.089625 37.0 37.0 37.0 33.0 37.0 50-51 35.13175 37.0 37.0 37.0 33.0 37.0 52-53 35.123125 37.0 37.0 37.0 33.0 37.0 54-55 35.118875 37.0 37.0 37.0 33.0 37.0 56-57 35.0355 37.0 37.0 37.0 33.0 37.0 58-59 35.0355 37.0 37.0 37.0 33.0 37.0 60-61 34.982625 37.0 37.0 37.0 33.0 37.0 62-63 34.937875 37.0 37.0 37.0 33.0 37.0 64-65 35.006375000000006 37.0 37.0 37.0 33.0 37.0 66-67 35.028125 37.0 37.0 37.0 33.0 37.0 68-69 34.97825 37.0 37.0 37.0 33.0 37.0 70-71 34.8905 37.0 37.0 37.0 33.0 37.0 72-73 34.7855 37.0 37.0 37.0 33.0 37.0 74-75 34.763999999999996 37.0 37.0 37.0 33.0 37.0 76-77 34.465375 37.0 37.0 37.0 33.0 37.0 78-79 34.446875000000006 37.0 37.0 37.0 33.0 37.0 80-81 34.479124999999996 37.0 37.0 37.0 33.0 37.0 82-83 34.3525 37.0 37.0 37.0 30.0 37.0 84-85 34.480000000000004 37.0 37.0 37.0 33.0 37.0 86-87 34.394999999999996 37.0 37.0 37.0 33.0 37.0 88-89 34.233375 37.0 37.0 37.0 30.0 37.0 90-91 33.843 37.0 37.0 37.0 27.0 37.0 92-93 33.64925 37.0 37.0 37.0 27.0 37.0 94-95 33.239374999999995 37.0 37.0 37.0 14.0 37.0 96-97 32.818875000000006 37.0 37.0 37.0 14.0 37.0 98-99 32.721000000000004 37.0 37.0 37.0 14.0 37.0 100-101 32.442625 37.0 37.0 37.0 8.0 37.0 102-103 31.978624999999997 37.0 37.0 37.0 2.0 37.0 104-105 31.666249999999998 37.0 37.0 37.0 2.0 37.0 106-107 31.6675 37.0 37.0 37.0 2.0 37.0 108-109 31.063375 37.0 35.0 37.0 2.0 37.0 110-111 30.922 37.0 33.0 37.0 2.0 37.0 112-113 30.677999999999997 37.0 33.0 37.0 2.0 37.0 114-115 30.284125 37.0 33.0 37.0 2.0 37.0 116-117 30.091250000000002 37.0 33.0 37.0 2.0 37.0 118-119 29.9315 37.0 33.0 37.0 2.0 37.0 120-121 29.9055 37.0 33.0 37.0 2.0 37.0 122-123 29.728875000000002 37.0 33.0 37.0 2.0 37.0 124-125 28.02975 37.0 17.5 37.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 81.0 3 5.0 4 8.0 5 4.0 6 4.0 7 1.0 8 1.0 9 3.0 10 3.0 11 2.0 12 1.0 13 5.0 14 3.0 15 4.0 16 5.0 17 5.0 18 4.0 19 3.0 20 11.0 21 16.0 22 37.0 23 15.0 24 13.0 25 24.0 26 90.0 27 85.0 28 72.0 29 107.0 30 65.0 31 74.0 32 124.0 33 112.0 34 169.0 35 301.0 36 2543.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.2 13.100000000000001 25.724999999999998 27.975 2 29.45 12.1 22.875 35.575 3 24.8 14.799999999999999 26.724999999999998 33.675 4 26.150000000000002 14.399999999999999 25.025 34.425 5 29.425 15.775 21.25 33.550000000000004 6 27.975 18.525 27.425 26.075 7 20.825 26.724999999999998 35.675000000000004 16.775000000000002 8 19.375 27.125 32.125 21.375 9 19.825 30.525000000000002 30.425 19.225 10-11 20.6625 28.475 29.5 21.3625 12-13 20.962500000000002 28.65 28.5875 21.8 14-15 20.5625 28.1375 28.037499999999998 23.2625 16-17 21.1875 27.875 26.6125 24.325 18-19 21.7375 28.449999999999996 26.4125 23.400000000000002 20-21 21.4 27.675 26.1625 24.762500000000003 22-23 21.912499999999998 25.775 26.5875 25.724999999999998 24-25 21.525 28.6875 25.575 24.212500000000002 26-27 21.7 27.987499999999997 24.925 25.387500000000003 28-29 23.0 27.737499999999997 24.4875 24.775 30-31 22.162499999999998 28.225 24.975 24.637500000000003 32-33 21.987499999999997 28.625 24.875 24.5125 34-35 22.0125 26.487500000000004 25.0 26.5 36-37 22.05 27.725 25.7125 24.5125 38-39 23.4125 27.037499999999998 24.8 24.75 40-41 22.55 26.687499999999996 24.2375 26.525 42-43 23.2375 26.75 25.25 24.762500000000003 44-45 23.175 27.6125 24.5 24.712500000000002 46-47 22.877859732466558 26.428303537942245 24.390548818602326 26.303287910988875 48-49 23.093273318329583 27.769442360590148 25.18129532383096 23.95598899724931 50-51 22.968242060515127 27.494373593398347 24.381095273818453 25.156289072268066 52-53 22.15 26.7625 24.1375 26.950000000000003 54-55 21.85 27.487499999999997 25.2875 25.374999999999996 56-57 22.85 26.5375 25.9875 24.625 58-59 22.8875 26.575 25.087500000000002 25.45 60-61 22.55 28.15 24.5625 24.7375 62-63 22.7 27.8875 23.962500000000002 25.45 64-65 22.8375 27.175 24.2625 25.724999999999998 66-67 22.3625 29.125 24.85 23.6625 68-69 22.3625 28.325 23.6625 25.650000000000002 70-71 22.9625 28.449999999999996 23.275000000000002 25.3125 72-73 22.175 28.299999999999997 23.962500000000002 25.5625 74-75 23.175 28.025 23.275000000000002 25.525 76-77 24.125 28.1375 23.525 24.212500000000002 78-79 22.8125 28.3875 23.425 25.374999999999996 80-81 23.7625 27.6125 24.224999999999998 24.4 82-83 24.375 27.224999999999998 22.912499999999998 25.4875 84-85 23.6375 27.5875 23.9125 24.8625 86-87 24.6125 26.775 24.7875 23.825 88-89 24.679567730585575 26.024126664991204 23.598894194521236 25.69741140990199 90-91 23.870967741935484 28.184693232131565 23.997469955724224 23.946869070208727 92-93 24.207712867506682 27.19867633956981 23.609520173094054 24.984090619829452 94-95 23.372093023255815 26.395348837209305 24.521963824289404 25.710594315245476 96-97 24.150453955901426 26.977950713359274 24.928664072632944 23.942931258106356 98-99 24.905463554570346 26.45716521058808 23.053853175120615 25.583518059720955 100-101 25.373529022874518 25.889197408435805 24.34219225175195 24.395081316937723 102-103 24.552975713904456 26.95489725113424 24.259407526020816 24.232719508940487 104-105 24.6160064672595 26.54271085960658 24.27917003503099 24.56211263810294 106-107 25.22898706896552 25.22898706896552 24.16487068965517 25.377155172413797 108-109 24.732510288065843 27.722908093278463 23.429355281207133 24.115226337448558 110-111 24.703476482617585 27.389229720518067 23.558282208588956 24.349011588275392 112-113 24.293237250554323 27.258869179600886 23.21230598669623 25.23558758314856 114-115 24.340544312630843 27.313328681088628 23.614794138171668 24.73133286810886 116-117 25.36922015182885 26.873706004140786 23.65769496204279 24.099378881987576 118-119 26.18678687139034 27.158754754190735 22.707423580786028 23.947034793632906 120-121 25.75119348497613 27.393990452120192 23.88374052232519 22.97107554057849 122-123 24.929854096520764 28.745791245791246 22.65712682379349 23.6672278338945 124-125 25.11874825370215 27.451802179379715 23.079072366582846 24.350377200335288 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 1.0 22 2.0 23 3.5 24 6.5 25 5.0 26 2.5 27 5.5 28 7.5 29 11.0 30 16.5 31 20.0 32 28.0 33 42.0 34 47.0 35 50.0 36 58.0 37 79.0 38 116.5 39 139.5 40 144.5 41 161.5 42 189.5 43 194.0 44 194.0 45 196.0 46 185.0 47 175.5 48 170.5 49 165.0 50 152.0 51 148.0 52 138.5 53 115.5 54 96.5 55 91.0 56 82.5 57 72.5 58 72.5 59 62.0 60 56.0 61 53.5 62 48.0 63 38.0 64 35.5 65 38.5 66 32.5 67 33.5 68 37.5 69 33.0 70 24.0 71 19.0 72 18.5 73 14.0 74 12.5 75 12.0 76 10.0 77 10.5 78 8.5 79 5.5 80 2.5 81 1.5 82 1.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0125 48-49 0.025 50-51 0.025 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.525 90-91 1.1875 92-93 1.7874999999999999 94-95 3.25 96-97 3.6249999999999996 98-99 4.1375 100-101 5.4625 102-103 6.325 104-105 7.225 106-107 7.199999999999999 108-109 8.875 110-111 8.3125 112-113 9.8 114-115 10.4375 116-117 9.4375 118-119 11.262500000000001 120-121 10.975 122-123 10.9 124-125 10.525 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.125 #Duplication Level Percentage of deduplicated Percentage of total 1 98.77707006369427 96.925 2 0.9426751592356688 1.8499999999999999 3 0.15286624203821655 0.44999999999999996 4 0.025477707006369425 0.1 5 0.05095541401273885 0.25 6 0.0 0.0 7 0.025477707006369425 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025477707006369425 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 10 0.25 No Hit CCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGG 7 0.17500000000000002 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 5 0.125 No Hit TCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.175 0.0 0.0 0.0 0.0 4 0.2 0.0 0.0 0.0 0.0 5 0.275 0.0 0.0 0.0 0.0 6 0.4 0.0 0.0 0.0 0.0 7 0.7 0.0 0.0 0.0 0.0 8 0.975 0.0 0.0 0.0 0.0 9 0.975 0.0 0.0 0.0 0.0 10-11 0.975 0.0 0.0 0.0 0.0 12-13 0.975 0.0 0.0 0.0 0.0 14-15 0.975 0.0 0.0 0.0 0.0 16-17 0.975 0.0 0.0 0.0 0.0 18-19 0.975 0.0 0.0 0.0 0.0 20-21 0.975 0.0 0.0 0.0 0.0 22-23 0.975 0.0 0.0 0.0 0.0 24-25 0.9875 0.0 0.0 0.0 0.0 26-27 1.0 0.0 0.0 0.0 0.0 28-29 1.0 0.0 0.0 0.0 0.0 30-31 1.025 0.0 0.0 0.0 0.0 32-33 1.025 0.0 0.0 0.0 0.0 34-35 1.05 0.0 0.0 0.0 0.0 36-37 1.05 0.0 0.0 0.0 0.0 38-39 1.0625 0.0 0.0 0.0 0.0 40-41 1.075 0.0 0.0 0.0 0.0 42-43 1.075 0.0 0.0 0.0 0.0 44-45 1.1 0.0 0.0 0.0 0.0 46-47 1.1749999999999998 0.0 0.0 0.0 0.0 48-49 1.275 0.0 0.0 0.0 0.0 50-51 1.3 0.0 0.0 0.0 0.0 52-53 1.3375 0.0 0.0 0.0 0.0 54-55 1.375 0.0 0.0 0.0 0.0 56-57 1.425 0.0 0.0 0.0 0.0 58-59 1.5375 0.0 0.0 0.0 0.0 60-61 1.775 0.0 0.0 0.0 0.0 62-63 1.875 0.0 0.0 0.0 0.0 64-65 1.9625 0.0 0.0 0.0 0.0 66-67 2.1125 0.0 0.0 0.0 0.0 68-69 2.225 0.0 0.0 0.0 0.0 70-71 2.3125 0.0 0.0 0.0 0.0 72-73 2.4875 0.0 0.0 0.0 0.0 74-75 2.625 0.0 0.0 0.0 0.0 76-77 2.9749999999999996 0.0 0.0 0.0 0.0 78-79 3.2125 0.0 0.0 0.0 0.0 80-81 3.3875 0.0 0.0 0.0 0.0 82-83 3.6 0.0 0.0 0.0 0.0 84-85 3.9875 0.0 0.0 0.0 0.0 86-87 4.325 0.0 0.0 0.0 0.0 88-89 4.5375 0.0 0.0 0.0 0.0 90-91 4.85 0.0 0.0 0.0 0.0 92-93 5.1875 0.0 0.0 0.0 0.0 94-95 5.55 0.0 0.0 0.0 0.0 96-97 5.8 0.0 0.0 0.0 0.0 98-99 6.2875 0.0 0.0 0.0 0.0 100-101 6.6875 0.0 0.0 0.0 0.0 102-103 7.012499999999999 0.0 0.0 0.0 0.0 104-105 7.375 0.0 0.0 0.0 0.0 106-107 7.8625 0.0 0.0 0.0 0.0 108-109 8.337499999999999 0.0 0.0 0.0 0.0 110-111 8.775 0.0 0.0 0.0 0.0 112-113 9.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGATCTA 15 0.004513471 58.018753 18-19 GTGTGCT 45 3.1755693E-4 51.572224 7 GTGCTCT 45 3.1755693E-4 51.572224 9 TGTGCTC 55 8.54536E-4 42.195454 8 >>END_MODULE Read 2424366 spots for ERR3317433.sra Written 2424366 spots for ERR3317433.sra Read 2424366 spots for ERR3317433.sra Written 2424366 spots for ERR3317433.sra Read 2424366 spots for ERR3317433.sra Written 2424366 spots for ERR3317433.sra Read 2424366 spots for ERR3317433.sra Written 2424366 spots for ERR3317433.sra Read 2424366 spots for ERR3317433.sra Written 2424366 spots for ERR3317433.sra Read 2424366 spots for ERR3317433.sra Written 2424366 spots for ERR3317433.sra Read 2424366 spots for ERR3317433.sra Written 2424366 spots for ERR3317433.sra Read 2424366 spots for ERR3317433.sra Written 2424366 spots for ERR3317433.sra Read 2424366 spots for ERR3317433.sra Written 2424366 spots for ERR3317433.sra Read 2424366 spots for ERR3317433.sra Written 2424366 spots for ERR3317433.sra Read 2424366 spots for ERR3317433.sra Written 2424366 spots for ERR3317433.sra Read 2424366 spots for ERR3317433.sra Written 2424366 spots for ERR3317433.sra Read 2424366 spots for ERR3317433.sra Written 2424366 spots for ERR3317433.sra Read 2424366 spots for ERR3317433.sra Written 2424366 spots for ERR3317433.sra Read 2424366 spots for ERR3317433.sra Written 2424366 spots for ERR3317433.sra Read 2424366 spots for ERR3317433.sra Written 2424366 spots for ERR3317433.sra Read 2424366 spots for ERR3317433.sra Written 2424366 spots for ERR3317433.sra Read 2424369 spots for ERR3317433.sra Written 2424369 spots for ERR3317433.sra Read 2424366 spots for ERR3317433.sra Written 2424366 spots for ERR3317433.sra Read 2424366 spots for ERR3317433.sra Written 2424366 spots for ERR3317433.sra SRR ids: ['ERR3317433.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s4h138jb ERR3317433.sra spots: 48487323 blocks: [[1, 2424366], [2424367, 4848732], [4848733, 7273098], [7273099, 9697464], [9697465, 12121830], [12121831, 14546196], [14546197, 16970562], [16970563, 19394928], [19394929, 21819294], [21819295, 24243660], [24243661, 26668026], [26668027, 29092392], [29092393, 31516758], [31516759, 33941124], [33941125, 36365490], [36365491, 38789856], [38789857, 41214222], [41214223, 43638588], [43638589, 46062954], [46062955, 48487323]] ERR3317433 file size 13946815 ERR3317433 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317433 ERR3317433_1.fastq ERR3317433_2.fastq Input file: ERR3317433_1.fastq Paired file: ERR3317433_2.fastq trimmed: ERR3317433-trimmed-pair1.fastq, ERR3317433-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:19:12 2024 >> started Tue Dec 10 09:20:02 2024 >> done (50.296s) 48487323 read pairs processed; of these: 708395 ( 1.46%) short read pairs filtered out after trimming by size control 719805 ( 1.48%) empty read pairs filtered out after trimming by size control 47059123 (97.05%) read pairs available; of these: 15644325 (33.24%) trimmed read pairs available after processing 31414798 (66.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 613 0.00% 19 1802 0.00% 20 1800 0.00% 21 3233 0.01% 22 1562 0.00% 23 1620 0.00% 24 1271 0.00% 25 1424 0.00% 26 1609 0.00% 27 1997 0.00% 28 1911 0.00% 29 1987 0.00% 30 2139 0.00% 31 3901 0.01% 32 2852 0.01% 33 3183 0.01% 34 3845 0.01% 35 4888 0.01% 36 4108 0.01% 37 4358 0.01% 38 5142 0.01% 39 5736 0.01% 40 5789 0.01% 41 6813 0.01% 42 8023 0.02% 43 8177 0.02% 44 8942 0.02% 45 9370 0.02% 46 9636 0.02% 47 10961 0.02% 48 11767 0.03% 49 12303 0.03% 50 13672 0.03% 51 14528 0.03% 52 15111 0.03% 53 16401 0.03% 54 18173 0.04% 55 18732 0.04% 56 19857 0.04% 57 21113 0.04% 58 22909 0.05% 59 24540 0.05% 60 30996 0.07% 61 28743 0.06% 62 29058 0.06% 63 31102 0.07% 64 36202 0.08% 65 34502 0.07% 66 38859 0.08% 67 38613 0.08% 68 40730 0.09% 69 44589 0.09% 70 46824 0.10% 71 60262 0.13% 72 67589 0.14% 73 72162 0.15% 74 73084 0.16% 75 73360 0.16% 76 75077 0.16% 77 77515 0.16% 78 79933 0.17% 79 80519 0.17% 80 84430 0.18% 81 85221 0.18% 82 87140 0.19% 83 91492 0.19% 84 93569 0.20% 85 98959 0.21% 86 102877 0.22% 87 105141 0.22% 88 105106 0.22% 89 118483 0.25% 90 110096 0.23% 91 110746 0.24% 92 115562 0.25% 93 115051 0.24% 94 122870 0.26% 95 125593 0.27% 96 130812 0.28% 97 132248 0.28% 98 132509 0.28% 99 138340 0.29% 100 138579 0.29% 101 148002 0.31% 102 148527 0.32% 103 152270 0.32% 104 158210 0.34% 105 165724 0.35% 106 164553 0.35% 107 173628 0.37% 108 178566 0.38% 109 197669 0.42% 110 192562 0.41% 111 196632 0.42% 112 209950 0.45% 113 215311 0.46% 114 224644 0.48% 115 236777 0.50% 116 251325 0.53% 117 266796 0.57% 118 290601 0.62% 119 328285 0.70% 120 380433 0.81% 121 470913 1.00% 122 650875 1.38% 123 1165466 2.48% 124 5334265 11.34% 125 31414798 66.76% 47059123 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=41.02 fanout-score-rank=5 prefix-density=0.44 prefix-fanout=39.5 sequence=AGATCGGAAGAGCACACC criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=122.50 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=18.8 sequence=GCCGCCGCCGCCA criterion=sequence-density sequence-density=1.38 sequence-density-rank=1 fanout-score=32.58 fanout-score-rank=3 prefix-density=1.41 prefix-fanout=31.9 sequence=GGTGTGCTCTTCCGATCT criterion=fanout-score sequence-density=0.13 sequence-density-rank=15 fanout-score=87.88 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=15.1 sequence=CAGCAGCAGCAGTAATTTGACCGTATGGATCGATCTCAGGCAGGGGTAGTACAAAAAAGAGGAACACATAATATTACTTGAGCATTTCATTCAAGCTCGCTCGCACAGCAGCAACCAAATCGATGCACGATAAGATCCATGGAGCTTAGAGAGATTATGATATCAT ERR3317433 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:20:42 Started mapping on | Dec 10 09:20:42 Finished on | Dec 10 09:22:50 Mapping speed, Million of reads per hour | 1323.54 Number of input reads | 47059123 Average input read length | 240 UNIQUE READS: Uniquely mapped reads number | 42059365 Uniquely mapped reads % | 89.38% Average mapped length | 238.89 Number of splices: Total | 26937019 Number of splices: Annotated (sjdb) | 25497082 Number of splices: GT/AG | 26569488 Number of splices: GC/AG | 313511 Number of splices: AT/AC | 24782 Number of splices: Non-canonical | 29238 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.00% Deletion average length | 1.23 Insertion rate per base | 0.00% Insertion average length | 1.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 3555111 % of reads mapped to multiple loci | 7.55% Number of reads mapped to too many loci | 201905 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.62% % of reads unmapped: other | 2.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1511786 1511786 1511786 N_multimapping 3555111 3555111 3555111 N_noFeature 1675226 4753139 38137370 N_ambiguous 1284386 494216 60233 UnstrandedReadsAssigned:39099753 PositiveStrandReadsAssigned:36812010 NegativeStrandReadsAssigned:3861762 Dataset is classified positive stranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 ERR3317433 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317433-trimmed-pair1.fastq ERR3317433-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 47,059,123 reads, 39,817,321 reads pseudoaligned [quant] estimated average fragment length: 221.92 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,256 rounds 52973 ERR3317433.ke.tsv 35125 ERR3317433.se.tsv 88098 total ==> ERR3317433.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 715.472 0 0 PNS24247 1044 823.08 91.3331 3.94757 PNS24249 1928 1707.08 130.132 2.71191 PNS24246 1044 823.08 91.3331 3.94757 PNS24248 1044 823.08 91.3331 3.94757 PNS24244 1471 1250.08 291.869 8.30604 PNS24243 293 117.926 0 0 KQK14069 1603 1382.08 470.886 12.1207 KQK14071 474 268.389 7.09216 0.940067 ==> ERR3317433.se.tsv <== BRADI_1g14170v3 547 BRADI_1g53295v3 158 BRADI_1g59795v3 966 BRADI_1g07683v3 0 BRADI_1g00485v3 93 BRADI_1g20270v3 4133 BRADI_1g74790v3 142 BRADI_1g09890v3 2 BRADI_1g77505v3 491 BRADI_1g48960v3 1 ERR3317433 completed mapping pipeline successfully