Starting /dee2/code/volunteer_pipeline.sh ERR3317434 current disk space = 1525233709056 free memory = 1525694152 ERR3317434 SRAfilesize 2dc49d1acfa66f1156a86b6ad1190e25 ERR3317434.sra ERR3317434.sra file validated ERR3317434 is paired end ERR3317434 is conventional basespace ERR3317434 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317434_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.61325 33.0 33.0 33.0 27.0 33.0 2 32.23575 33.0 33.0 33.0 33.0 33.0 3 32.3565 33.0 33.0 33.0 33.0 33.0 4 32.5445 33.0 33.0 33.0 33.0 33.0 5 32.63325 33.0 33.0 33.0 33.0 33.0 6 36.175 37.0 37.0 37.0 37.0 37.0 7 36.25125 37.0 37.0 37.0 37.0 37.0 8 36.42475 37.0 37.0 37.0 37.0 37.0 9 36.41625 37.0 37.0 37.0 37.0 37.0 10-11 36.324125 37.0 37.0 37.0 37.0 37.0 12-13 36.37125 37.0 37.0 37.0 37.0 37.0 14-15 36.34525 37.0 37.0 37.0 37.0 37.0 16-17 36.33025 37.0 37.0 37.0 37.0 37.0 18-19 36.345375000000004 37.0 37.0 37.0 37.0 37.0 20-21 36.385625 37.0 37.0 37.0 37.0 37.0 22-23 36.328500000000005 37.0 37.0 37.0 37.0 37.0 24-25 36.325 37.0 37.0 37.0 37.0 37.0 26-27 36.18825 37.0 37.0 37.0 37.0 37.0 28-29 36.17275 37.0 37.0 37.0 37.0 37.0 30-31 36.210875 37.0 37.0 37.0 37.0 37.0 32-33 36.28975 37.0 37.0 37.0 37.0 37.0 34-35 36.27575 37.0 37.0 37.0 37.0 37.0 36-37 36.236374999999995 37.0 37.0 37.0 37.0 37.0 38-39 36.1415 37.0 37.0 37.0 37.0 37.0 40-41 36.06625 37.0 37.0 37.0 37.0 37.0 42-43 35.981 37.0 37.0 37.0 37.0 37.0 44-45 36.12075 37.0 37.0 37.0 37.0 37.0 46-47 35.934875000000005 37.0 37.0 37.0 35.0 37.0 48-49 35.983875 37.0 37.0 37.0 35.0 37.0 50-51 35.865875 37.0 37.0 37.0 33.0 37.0 52-53 35.85724999999999 37.0 37.0 37.0 33.0 37.0 54-55 35.856125 37.0 37.0 37.0 33.0 37.0 56-57 35.883875 37.0 37.0 37.0 35.0 37.0 58-59 35.740875 37.0 37.0 37.0 33.0 37.0 60-61 35.802375 37.0 37.0 37.0 33.0 37.0 62-63 35.784625 37.0 37.0 37.0 33.0 37.0 64-65 35.78675 37.0 37.0 37.0 33.0 37.0 66-67 35.761125 37.0 37.0 37.0 33.0 37.0 68-69 35.658625 37.0 37.0 37.0 33.0 37.0 70-71 35.615625 37.0 37.0 37.0 33.0 37.0 72-73 35.562 37.0 37.0 37.0 33.0 37.0 74-75 35.53 37.0 37.0 37.0 33.0 37.0 76-77 35.46575 37.0 37.0 37.0 33.0 37.0 78-79 35.345124999999996 37.0 37.0 37.0 33.0 37.0 80-81 35.386125 37.0 37.0 37.0 33.0 37.0 82-83 35.264875 37.0 37.0 37.0 33.0 37.0 84-85 35.320125000000004 37.0 37.0 37.0 33.0 37.0 86-87 35.222 37.0 37.0 37.0 33.0 37.0 88-89 35.227875 37.0 37.0 37.0 33.0 37.0 90-91 35.123875 37.0 37.0 37.0 33.0 37.0 92-93 35.00212500000001 37.0 37.0 37.0 33.0 37.0 94-95 35.09325 37.0 37.0 37.0 33.0 37.0 96-97 34.8945 37.0 37.0 37.0 33.0 37.0 98-99 34.880875 37.0 37.0 37.0 33.0 37.0 100-101 34.926249999999996 37.0 37.0 37.0 33.0 37.0 102-103 34.754999999999995 37.0 37.0 37.0 30.0 37.0 104-105 34.68925 37.0 37.0 37.0 33.0 37.0 106-107 34.724375 37.0 37.0 37.0 30.0 37.0 108-109 34.43925 37.0 37.0 37.0 27.0 37.0 110-111 34.330625 37.0 37.0 37.0 27.0 37.0 112-113 34.318125 37.0 37.0 37.0 27.0 37.0 114-115 34.312875 37.0 37.0 37.0 27.0 37.0 116-117 34.299375 37.0 37.0 37.0 27.0 37.0 118-119 34.153625 37.0 37.0 37.0 27.0 37.0 120-121 34.062875000000005 37.0 37.0 37.0 27.0 37.0 122-123 33.65175 37.0 37.0 37.0 24.5 37.0 124-125 31.4825 37.0 35.0 37.0 12.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 1.0 5 0.0 6 3.0 7 0.0 8 0.0 9 0.0 10 0.0 11 2.0 12 2.0 13 4.0 14 0.0 15 0.0 16 2.0 17 2.0 18 1.0 19 9.0 20 6.0 21 5.0 22 7.0 23 13.0 24 19.0 25 16.0 26 12.0 27 29.0 28 30.0 29 33.0 30 37.0 31 72.0 32 117.0 33 143.0 34 274.0 35 568.0 36 2589.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 23.314681588062882 25.686117772448707 20.783373301358914 30.215827338129497 2 24.075 24.15 19.775000000000002 32.0 3 26.0 25.05 19.6 29.349999999999998 4 28.225 23.65 18.875 29.25 5 29.849999999999998 22.575 17.299999999999997 30.275000000000002 6 30.2 24.625 19.05 26.125 7 26.25 24.075 22.525000000000002 27.150000000000002 8 29.475 24.349999999999998 26.150000000000002 20.025000000000002 9 30.85 25.8 25.5 17.849999999999998 10-11 29.625 25.7375 25.2 19.4375 12-13 27.325 25.924999999999997 25.775 20.974999999999998 14-15 26.75 25.362499999999997 26.025 21.8625 16-17 25.2125 24.2375 26.8125 23.7375 18-19 25.8625 25.9875 25.7875 22.3625 20-21 25.5125 24.4375 26.387500000000003 23.6625 22-23 25.912499999999998 23.799999999999997 25.8 24.4875 24-25 25.174999999999997 23.9 26.4625 24.462500000000002 26-27 24.762500000000003 24.962500000000002 26.424999999999997 23.849999999999998 28-29 25.937500000000004 23.962500000000002 25.4 24.7 30-31 25.424999999999997 23.7875 26.937499999999996 23.849999999999998 32-33 25.337500000000002 24.625 26.174999999999997 23.8625 34-35 25.0375 24.1875 25.624999999999996 25.15 36-37 25.5375 24.462500000000002 26.224999999999998 23.775 38-39 25.525 24.975 26.2625 23.2375 40-41 25.4625 24.1625 25.6125 24.762500000000003 42-43 25.412499999999998 25.687500000000004 25.2625 23.6375 44-45 26.237500000000004 25.0 25.637500000000003 23.125 46-47 26.924999999999997 24.8 24.425 23.849999999999998 48-49 25.7125 24.2625 26.724999999999998 23.3 50-51 26.575 24.9 24.837500000000002 23.6875 52-53 26.025 24.4 25.6125 23.962500000000002 54-55 25.974999999999998 24.887500000000003 26.05 23.0875 56-57 24.95 24.875 25.874999999999996 24.3 58-59 25.662499999999998 24.462500000000002 26.1125 23.7625 60-61 25.75 23.625 26.924999999999997 23.7 62-63 24.85 24.3625 26.825 23.962500000000002 64-65 26.437500000000004 24.337500000000002 25.8125 23.4125 66-67 24.712500000000002 25.0125 25.650000000000002 24.625 68-69 25.775 25.1 25.474999999999998 23.65 70-71 25.55 24.474999999999998 26.2875 23.6875 72-73 26.150000000000002 24.8125 24.675 24.3625 74-75 26.05 25.05 26.2625 22.6375 76-77 27.487499999999997 25.15 24.8125 22.55 78-79 26.424999999999997 24.925 25.112499999999997 23.5375 80-81 25.387500000000003 25.837500000000002 25.7125 23.0625 82-83 25.2875 24.575 25.900000000000002 24.2375 84-85 25.412499999999998 24.712500000000002 26.8 23.075000000000003 86-87 25.174999999999997 24.9125 25.7 24.212500000000002 88-89 25.575 24.8125 25.25 24.3625 90-91 25.525 25.7625 25.275 23.4375 92-93 25.074999999999996 26.200000000000003 25.6 23.125 94-95 25.7125 24.3125 25.85 24.125 96-97 27.1125 24.6125 25.687500000000004 22.5875 98-99 26.2625 24.712500000000002 25.45 23.575 100-101 25.387500000000003 25.4 25.275 23.9375 102-103 25.9875 24.575 26.25 23.1875 104-105 26.219054763690924 25.30632658164541 25.006251562890725 23.468367091772944 106-107 26.515814476809602 24.57807225903238 24.94061757719715 23.96549568696087 108-109 25.478184773096636 25.465683210401302 25.328166020752597 23.72796599574947 110-111 24.98436913842691 25.734650493935224 24.684256596223584 24.59672377141428 112-113 25.853231653956744 25.928241030128767 24.990623827978496 23.22790348793599 114-115 25.84396099024756 25.893973493373345 24.756189047261813 23.50587646911728 116-117 26.078259782472806 25.328166020752597 24.553069133641706 24.04050506313289 118-119 25.153144143017876 25.165645705713214 24.52806600825103 25.153144143017876 120-121 25.890736342042754 25.028128516064506 25.30316289536192 23.777972246530815 122-123 25.775 25.5125 25.5125 23.200000000000003 124-125 26.3 25.1875 24.349999999999998 24.1625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 1.5 4 1.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.5 26 3.0 27 3.0 28 6.5 29 7.0 30 9.5 31 12.0 32 10.0 33 16.5 34 28.0 35 36.5 36 45.5 37 62.5 38 81.0 39 98.0 40 121.5 41 133.0 42 151.0 43 185.5 44 182.0 45 182.5 46 214.0 47 216.5 48 198.0 49 176.5 50 156.5 51 138.5 52 126.5 53 130.5 54 119.0 55 89.5 56 83.5 57 81.0 58 65.5 59 56.0 60 64.5 61 71.0 62 64.5 63 60.5 64 60.0 65 56.5 66 53.5 67 54.0 68 43.0 69 33.5 70 29.5 71 28.5 72 30.5 73 27.0 74 19.0 75 20.0 76 18.5 77 9.0 78 6.0 79 4.5 80 2.5 81 2.5 82 3.0 83 1.5 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.025 106-107 0.0125 108-109 0.0125 110-111 0.0375 112-113 0.0125 114-115 0.025 116-117 0.0125 118-119 0.0125 120-121 0.0125 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.225 #Duplication Level Percentage of deduplicated Percentage of total 1 97.99434301877089 95.275 2 1.5170995114425303 2.9499999999999997 3 0.35998971457958345 1.05 4 0.05142710208279763 0.2 5 0.025713551041398816 0.125 6 0.025713551041398816 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025713551041398816 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCACGCACACCAGAGCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCA 10 0.25 No Hit TATCCCCTGCTTCCCCGCTTCCTCTTCCTCCTCCCCCTCACTCCCCAAGC 6 0.15 No Hit TGCTCGTGAAGGTAATGAAATTATCCGAGCAGCTTGCAAATGGAGTCCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.225 0.0 0.0 0.0 0.0 7 0.45 0.0 0.0 0.0 0.0 8 0.575 0.0 0.0 0.0 0.0 9 0.6 0.0 0.0 0.0 0.0 10-11 0.6 0.0 0.0 0.0 0.0 12-13 0.6125 0.0 0.0 0.0 0.0 14-15 0.625 0.0 0.0 0.0 0.0 16-17 0.6375 0.0 0.0 0.0 0.0 18-19 0.65 0.0 0.0 0.0 0.0 20-21 0.65 0.0 0.0 0.0 0.0 22-23 0.6625000000000001 0.0 0.0 0.0 0.0 24-25 0.6875 0.0 0.0 0.0 0.0 26-27 0.7 0.0 0.0 0.0 0.0 28-29 0.7 0.0 0.0 0.0 0.0 30-31 0.7 0.0 0.0 0.0 0.0 32-33 0.725 0.0 0.0 0.0 0.0 34-35 0.7375 0.0 0.0 0.0 0.0 36-37 0.75 0.0 0.0 0.0 0.0 38-39 0.75 0.0 0.0 0.0 0.0 40-41 0.775 0.0 0.0 0.0 0.0 42-43 0.775 0.0 0.0 0.0 0.0 44-45 0.775 0.0 0.0 0.0 0.0 46-47 0.8 0.0 0.0 0.0 0.0 48-49 0.825 0.0 0.0 0.0 0.0 50-51 0.85 0.0 0.0 0.0 0.0 52-53 0.8625 0.0 0.0 0.0 0.0 54-55 0.925 0.0 0.0 0.0 0.0 56-57 0.95 0.0 0.0 0.0 0.0 58-59 1.0125 0.0 0.0 0.0 0.0 60-61 1.1125 0.0 0.0 0.0 0.0 62-63 1.1875 0.0 0.0 0.0 0.0 64-65 1.2625000000000002 0.0 0.0 0.0 0.0 66-67 1.45 0.0 0.0 0.0 0.0 68-69 1.7 0.0 0.0 0.0 0.0 70-71 1.8125 0.0 0.0 0.0 0.0 72-73 1.9125 0.0 0.0 0.0 0.0 74-75 2.075 0.0 0.0 0.0 0.0 76-77 2.2 0.0 0.0 0.0 0.0 78-79 2.4625 0.0 0.0 0.0 0.0 80-81 2.6500000000000004 0.0 0.0 0.0 0.0 82-83 3.0 0.0 0.0 0.0 0.0 84-85 3.3125 0.0 0.0 0.0 0.0 86-87 3.5125 0.0 0.0 0.0 0.0 88-89 3.8375000000000004 0.0 0.0 0.0 0.0 90-91 4.2625 0.0 0.0 0.0 0.0 92-93 4.7125 0.0 0.0 0.0 0.0 94-95 5.05 0.0 0.0 0.0 0.0 96-97 5.3125 0.0 0.0 0.0 0.0 98-99 5.612500000000001 0.0 0.0 0.0 0.0 100-101 6.175000000000001 0.0 0.0 0.0 0.0 102-103 6.6875 0.0 0.0 0.0 0.0 104-105 7.05 0.0 0.0 0.0 0.0 106-107 7.425 0.0 0.0 0.0 0.0 108-109 7.7625 0.0 0.0 0.0 0.0 110-111 8.3875 0.0 0.0 0.0 0.0 112-113 8.787500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317434 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317434_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.02525 33.0 33.0 33.0 33.0 33.0 2 32.029 33.0 33.0 33.0 33.0 33.0 3 32.06775 33.0 33.0 33.0 33.0 33.0 4 32.0625 33.0 33.0 33.0 33.0 33.0 5 32.06025 33.0 33.0 33.0 33.0 33.0 6 35.754 37.0 37.0 37.0 37.0 37.0 7 35.725 37.0 37.0 37.0 37.0 37.0 8 35.7245 37.0 37.0 37.0 37.0 37.0 9 35.59675 37.0 37.0 37.0 37.0 37.0 10-11 35.689 37.0 37.0 37.0 37.0 37.0 12-13 35.760000000000005 37.0 37.0 37.0 37.0 37.0 14-15 35.648875000000004 37.0 37.0 37.0 37.0 37.0 16-17 35.605374999999995 37.0 37.0 37.0 37.0 37.0 18-19 35.54475 37.0 37.0 37.0 37.0 37.0 20-21 35.573 37.0 37.0 37.0 37.0 37.0 22-23 35.556375 37.0 37.0 37.0 37.0 37.0 24-25 35.52675 37.0 37.0 37.0 37.0 37.0 26-27 35.48475 37.0 37.0 37.0 37.0 37.0 28-29 35.539375 37.0 37.0 37.0 37.0 37.0 30-31 35.47175 37.0 37.0 37.0 37.0 37.0 32-33 35.432500000000005 37.0 37.0 37.0 37.0 37.0 34-35 35.469375 37.0 37.0 37.0 37.0 37.0 36-37 35.473375000000004 37.0 37.0 37.0 37.0 37.0 38-39 35.358000000000004 37.0 37.0 37.0 37.0 37.0 40-41 35.405625 37.0 37.0 37.0 35.0 37.0 42-43 35.322875 37.0 37.0 37.0 35.0 37.0 44-45 35.311499999999995 37.0 37.0 37.0 33.0 37.0 46-47 35.276375 37.0 37.0 37.0 33.0 37.0 48-49 35.362 37.0 37.0 37.0 35.0 37.0 50-51 35.3225 37.0 37.0 37.0 35.0 37.0 52-53 35.235875 37.0 37.0 37.0 33.0 37.0 54-55 35.254625000000004 37.0 37.0 37.0 33.0 37.0 56-57 35.297875000000005 37.0 37.0 37.0 33.0 37.0 58-59 35.271625 37.0 37.0 37.0 33.0 37.0 60-61 35.283375 37.0 37.0 37.0 33.0 37.0 62-63 35.185125 37.0 37.0 37.0 33.0 37.0 64-65 35.196875 37.0 37.0 37.0 33.0 37.0 66-67 35.157250000000005 37.0 37.0 37.0 33.0 37.0 68-69 35.095875 37.0 37.0 37.0 33.0 37.0 70-71 35.141625000000005 37.0 37.0 37.0 33.0 37.0 72-73 34.994749999999996 37.0 37.0 37.0 33.0 37.0 74-75 34.95275 37.0 37.0 37.0 33.0 37.0 76-77 34.782624999999996 37.0 37.0 37.0 33.0 37.0 78-79 34.82575 37.0 37.0 37.0 33.0 37.0 80-81 34.815375 37.0 37.0 37.0 33.0 37.0 82-83 34.758125 37.0 37.0 37.0 33.0 37.0 84-85 34.7285 37.0 37.0 37.0 33.0 37.0 86-87 34.739875 37.0 37.0 37.0 33.0 37.0 88-89 34.518874999999994 37.0 37.0 37.0 33.0 37.0 90-91 34.127875 37.0 37.0 37.0 27.0 37.0 92-93 33.892125 37.0 37.0 37.0 27.0 37.0 94-95 33.354124999999996 37.0 37.0 37.0 22.0 37.0 96-97 33.122125 37.0 37.0 37.0 18.0 37.0 98-99 32.993 37.0 37.0 37.0 14.0 37.0 100-101 32.705124999999995 37.0 37.0 37.0 8.0 37.0 102-103 32.144000000000005 37.0 37.0 37.0 2.0 37.0 104-105 31.768375 37.0 37.0 37.0 2.0 37.0 106-107 31.6525 37.0 37.0 37.0 2.0 37.0 108-109 30.99275 37.0 35.0 37.0 2.0 37.0 110-111 30.924875 37.0 37.0 37.0 2.0 37.0 112-113 30.698999999999998 37.0 35.0 37.0 2.0 37.0 114-115 30.43425 37.0 33.0 37.0 2.0 37.0 116-117 30.288375000000002 37.0 33.0 37.0 2.0 37.0 118-119 30.1605 37.0 33.0 37.0 2.0 37.0 120-121 30.00725 37.0 33.0 37.0 2.0 37.0 122-123 29.626875 37.0 33.0 37.0 2.0 37.0 124-125 28.05475 37.0 17.5 37.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 60.0 3 6.0 4 4.0 5 5.0 6 3.0 7 4.0 8 6.0 9 2.0 10 2.0 11 2.0 12 3.0 13 3.0 14 3.0 15 3.0 16 2.0 17 3.0 18 3.0 19 3.0 20 14.0 21 18.0 22 26.0 23 15.0 24 21.0 25 30.0 26 71.0 27 92.0 28 82.0 29 96.0 30 89.0 31 83.0 32 118.0 33 78.0 34 154.0 35 312.0 36 2584.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.1 12.35 26.3 30.25 2 26.05 12.275 24.349999999999998 37.325 3 24.975 12.75 27.675 34.599999999999994 4 25.724999999999998 13.200000000000001 26.3 34.775 5 27.400000000000002 15.85 22.0 34.75 6 27.575 19.175 28.15 25.1 7 20.275000000000002 27.0 35.55 17.175 8 18.65 28.325 32.824999999999996 20.200000000000003 9 18.875 30.925000000000004 31.674999999999997 18.525 10-11 20.0875 28.975 30.5375 20.4 12-13 20.549999999999997 29.2 29.037499999999998 21.212500000000002 14-15 20.674999999999997 27.462500000000002 28.825 23.0375 16-17 21.625 27.962500000000002 26.8625 23.549999999999997 18-19 20.8875 28.4125 26.7625 23.9375 20-21 22.05 28.037499999999998 25.974999999999998 23.9375 22-23 21.675 26.900000000000002 26.075 25.35 24-25 21.4875 28.3625 26.0375 24.1125 26-27 21.875 28.287499999999998 25.2125 24.625 28-29 22.5625 27.1375 23.7625 26.5375 30-31 21.45 28.725 25.7375 24.087500000000002 32-33 22.4625 28.4 24.775 24.3625 34-35 21.2625 28.237499999999997 24.637500000000003 25.8625 36-37 22.287499999999998 27.05 25.2875 25.374999999999996 38-39 21.1375 27.800000000000004 25.912499999999998 25.15 40-41 22.6 27.187499999999996 23.3875 26.825 42-43 22.45 27.5625 24.337500000000002 25.650000000000002 44-45 23.425 27.325 24.087500000000002 25.162499999999998 46-47 22.402800350043755 27.090886360795096 23.92799099887486 26.578322290286287 48-49 21.627703462932867 28.741092636579573 25.765720715089387 23.865483185398176 50-51 23.0 26.450000000000003 25.7625 24.7875 52-53 23.0625 26.8 24.6 25.5375 54-55 22.0125 27.750000000000004 25.0125 25.224999999999998 56-57 22.025 27.8375 25.7375 24.4 58-59 21.8625 27.462500000000002 24.637500000000003 26.0375 60-61 21.637500000000003 27.437499999999996 25.837500000000002 25.087500000000002 62-63 22.4375 27.4125 24.7 25.45 64-65 23.075000000000003 27.1375 24.575 25.2125 66-67 21.9375 28.000000000000004 25.4875 24.575 68-69 21.7875 27.950000000000003 23.4875 26.775 70-71 21.425 28.4 24.8 25.374999999999996 72-73 22.025 27.950000000000003 25.2375 24.7875 74-75 23.549999999999997 27.4125 23.9125 25.124999999999996 76-77 23.35 27.6125 22.7625 26.275 78-79 23.0875 28.012500000000003 23.8125 25.087500000000002 80-81 23.125 28.037499999999998 24.7875 24.05 82-83 22.4375 26.0375 24.6875 26.8375 84-85 24.087500000000002 27.1375 24.3125 24.462500000000002 86-87 24.3625 26.7625 23.9875 24.887500000000003 88-89 23.756281407035175 26.0929648241206 23.919597989949747 26.231155778894472 90-91 23.12460468058191 28.57685009487666 23.731815306767867 24.56672991777356 92-93 23.29046224372851 26.652234814720487 25.187826308417165 24.869476633133832 94-95 23.641551030994684 26.741019323045002 23.991700168590324 25.62572947736999 96-97 24.466701352757543 25.910509885535898 25.520291363163373 24.102497398543186 98-99 23.400078523753436 27.601099332548095 22.85041224970554 26.148409893992934 100-101 23.570765353495158 26.76747579254543 23.968696113542908 25.6930627404165 102-103 24.236334405144692 27.30439442658092 23.311897106109324 25.147374062165056 104-105 24.319566689234936 26.811103588354772 24.928909952606634 23.940419769803654 106-107 24.563540397888755 25.592096359453244 25.104885640817432 24.739477601840573 108-109 23.72318339100346 27.43252595155709 24.262975778546714 24.581314878892734 110-111 25.520474286502136 27.36798566110575 23.60402592030884 23.507514132083276 112-113 24.682040531097137 26.750524109014673 23.81551362683438 24.75192173305381 114-115 23.96008993816751 27.065767284991573 23.833614390106803 25.14052838673412 116-117 24.724892046245994 25.351720295305753 24.91990527928681 25.003482379161447 118-119 25.787680953732618 26.55407323304002 23.38915696849276 24.2690888447346 120-121 24.163253777715013 27.157181189097585 24.954102527891543 23.725462505295862 122-123 24.685423441255477 27.69687544182101 23.625053018521136 23.992648098402373 124-125 25.042158516020237 25.955593029792016 24.578414839797638 24.423833614390105 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 0.0 23 1.0 24 4.0 25 6.0 26 4.5 27 5.0 28 5.5 29 6.5 30 15.0 31 24.5 32 34.5 33 40.5 34 42.5 35 57.5 36 83.0 37 99.5 38 115.0 39 139.0 40 156.0 41 179.0 42 202.5 43 179.0 44 182.5 45 208.0 46 193.5 47 189.5 48 169.5 49 148.0 50 146.5 51 141.0 52 123.5 53 107.5 54 99.5 55 79.5 56 72.0 57 73.5 58 65.5 59 58.5 60 53.0 61 47.5 62 41.0 63 36.5 64 35.0 65 35.5 66 40.5 67 39.5 68 32.0 69 23.0 70 19.5 71 26.0 72 22.0 73 18.5 74 19.0 75 10.0 76 5.5 77 9.5 78 8.0 79 3.0 80 2.5 81 1.5 82 1.0 83 1.5 84 1.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0125 48-49 0.0125 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.5 90-91 1.1875 92-93 1.8375 94-95 3.6125 96-97 3.9 98-99 4.4875 100-101 5.7625 102-103 6.7 104-105 7.6875 106-107 7.6375 108-109 9.6875 110-111 9.3375 112-113 10.5625 114-115 11.05 116-117 10.2625 118-119 11.924999999999999 120-121 11.4875 122-123 11.5875 124-125 11.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.125 #Duplication Level Percentage of deduplicated Percentage of total 1 98.92993630573248 97.075 2 0.8407643312101911 1.6500000000000001 3 0.025477707006369425 0.075 4 0.05095541401273885 0.2 5 0.07643312101910828 0.375 6 0.025477707006369425 0.15 7 0.0 0.0 8 0.0 0.0 9 0.025477707006369425 0.22499999999999998 >10 0.025477707006369425 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 10 0.25 No Hit TCTTCGTATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 9 0.22499999999999998 No Hit CGGGGTCAGCCGAGAGCCCGGCGGTGTCCCACCCGTAATCGCCGGGGAAC 6 0.15 No Hit TCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAAT 5 0.125 No Hit CCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGG 5 0.125 No Hit TCTTCTTATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.225 0.0 0.0 0.0 0.0 7 0.45 0.0 0.0 0.0 0.0 8 0.575 0.0 0.0 0.0 0.0 9 0.6 0.0 0.0 0.0 0.0 10-11 0.6 0.0 0.0 0.0 0.0 12-13 0.6125 0.0 0.0 0.0 0.0 14-15 0.625 0.0 0.0 0.0 0.0 16-17 0.6375 0.0 0.0 0.0 0.0 18-19 0.65 0.0 0.0 0.0 0.0 20-21 0.65 0.0 0.0 0.0 0.0 22-23 0.65 0.0 0.0 0.0 0.0 24-25 0.6625000000000001 0.0 0.0 0.0 0.0 26-27 0.675 0.0 0.0 0.0 0.0 28-29 0.675 0.0 0.0 0.0 0.0 30-31 0.675 0.0 0.0 0.0 0.0 32-33 0.675 0.0 0.0 0.0 0.0 34-35 0.6875 0.0 0.0 0.0 0.0 36-37 0.7 0.0 0.0 0.0 0.0 38-39 0.7 0.0 0.0 0.0 0.0 40-41 0.725 0.0 0.0 0.0 0.0 42-43 0.725 0.0 0.0 0.0 0.0 44-45 0.725 0.0 0.0 0.0 0.0 46-47 0.775 0.0 0.0 0.0 0.0 48-49 0.8 0.0 0.0 0.0 0.0 50-51 0.825 0.0 0.0 0.0 0.0 52-53 0.8374999999999999 0.0 0.0 0.0 0.0 54-55 0.9 0.0 0.0 0.0 0.0 56-57 0.95 0.0 0.0 0.0 0.0 58-59 1.0125 0.0 0.0 0.0 0.0 60-61 1.1125 0.0 0.0 0.0 0.0 62-63 1.1875 0.0 0.0 0.0 0.0 64-65 1.25 0.0 0.0 0.0 0.0 66-67 1.4125 0.0 0.0 0.0 0.0 68-69 1.65 0.0 0.0 0.0 0.0 70-71 1.7625 0.0 0.0 0.0 0.0 72-73 1.8375 0.0 0.0 0.0 0.0 74-75 1.9874999999999998 0.0 0.0 0.0 0.0 76-77 2.0875000000000004 0.0 0.0 0.0 0.0 78-79 2.3499999999999996 0.0 0.0 0.0 0.0 80-81 2.5 0.0 0.0 0.0 0.0 82-83 2.8375 0.0 0.0 0.0 0.0 84-85 3.125 0.0 0.0 0.0 0.0 86-87 3.3 0.0 0.0 0.0 0.0 88-89 3.6125 0.0 0.0 0.0 0.0 90-91 4.05 0.0 0.0 0.0 0.0 92-93 4.5 0.0 0.0 0.0 0.0 94-95 4.8125 0.0 0.0 0.0 0.0 96-97 5.05 0.0 0.0 0.0 0.0 98-99 5.325 0.0 0.0 0.0 0.0 100-101 5.7875 0.0 0.0 0.0 0.0 102-103 6.237500000000001 0.0 0.0 0.0 0.0 104-105 6.550000000000001 0.0 0.0 0.0 0.0 106-107 6.875 0.0 0.0 0.0 0.0 108-109 7.1875 0.0 0.0 0.0 0.0 110-111 7.7125 0.0 0.0 0.0 0.0 112-113 8.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTAGTT 20 5.881984E-6 115.287506 9 TATTTAG 25 1.7829216E-5 92.23 7 ATTTAGT 30 4.4065353E-5 76.85834 8 GATAATT 15 0.002561785 66.833336 118-119 TCGGATA 15 0.002561785 66.833336 116-117 GGATAAT 15 0.002561785 66.833336 118-119 GCTGCTC 15 0.002561785 66.833336 110-111 TGCTCGG 15 0.002561785 66.833336 112-113 CTGCTCG 15 0.002561785 66.833336 112-113 CATTTGC 15 0.0027923689 65.41135 102-103 GGACTCC 15 0.0030380797 64.048615 96-97 CTCCATT 15 0.0030380797 64.048615 98-99 ACTCCAT 15 0.0030380797 64.048615 98-99 CCATTTG 15 0.0030380797 64.048615 100-101 TCCATTT 15 0.0030380797 64.048615 100-101 AGGACTC 15 0.003210605 63.171234 94-95 CAGGACT 15 0.003210605 63.171234 94-95 TCAGGAC 15 0.0033903278 62.317566 92-93 AGTTCAG 15 0.0035774426 61.486668 90-91 TAGTTCA 15 0.0037721456 60.67763 88-89 >>END_MODULE Read 2244116 spots for ERR3317434.sra Written 2244116 spots for ERR3317434.sra Read 2244116 spots for ERR3317434.sra Written 2244116 spots for ERR3317434.sra Read 2244116 spots for ERR3317434.sra Written 2244116 spots for ERR3317434.sra Read 2244116 spots for ERR3317434.sra Written 2244116 spots for ERR3317434.sra Read 2244116 spots for ERR3317434.sra Written 2244116 spots for ERR3317434.sra Read 2244116 spots for ERR3317434.sra Written 2244116 spots for ERR3317434.sra Read 2244116 spots for ERR3317434.sra Written 2244116 spots for ERR3317434.sra Read 2244116 spots for ERR3317434.sra Written 2244116 spots for ERR3317434.sra Read 2244116 spots for ERR3317434.sra Written 2244116 spots for ERR3317434.sra Read 2244116 spots for ERR3317434.sra Written 2244116 spots for ERR3317434.sra Read 2244116 spots for ERR3317434.sra Written 2244116 spots for ERR3317434.sra Read 2244116 spots for ERR3317434.sra Written 2244116 spots for ERR3317434.sra Read 2244116 spots for ERR3317434.sra Written 2244116 spots for ERR3317434.sra Read 2244116 spots for ERR3317434.sra Written 2244116 spots for ERR3317434.sra Read 2244116 spots for ERR3317434.sra Written 2244116 spots for ERR3317434.sra Read 2244116 spots for ERR3317434.sra Written 2244116 spots for ERR3317434.sra Read 2244134 spots for ERR3317434.sra Written 2244134 spots for ERR3317434.sra Read 2244116 spots for ERR3317434.sra Written 2244116 spots for ERR3317434.sra Read 2244116 spots for ERR3317434.sra Written 2244116 spots for ERR3317434.sra Read 2244116 spots for ERR3317434.sra Written 2244116 spots for ERR3317434.sra SRR ids: ['ERR3317434.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__zcxr77j ERR3317434.sra spots: 44882338 blocks: [[1, 2244116], [2244117, 4488232], [4488233, 6732348], [6732349, 8976464], [8976465, 11220580], [11220581, 13464696], [13464697, 15708812], [15708813, 17952928], [17952929, 20197044], [20197045, 22441160], [22441161, 24685276], [24685277, 26929392], [26929393, 29173508], [29173509, 31417624], [31417625, 33661740], [33661741, 35905856], [35905857, 38149972], [38149973, 40394088], [40394089, 42638204], [42638205, 44882338]] ERR3317434 file size 12908270 ERR3317434 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317434 ERR3317434_1.fastq ERR3317434_2.fastq Input file: ERR3317434_1.fastq Paired file: ERR3317434_2.fastq trimmed: ERR3317434-trimmed-pair1.fastq, ERR3317434-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:21:14 2024 >> started Tue Dec 10 09:22:03 2024 >> done (48.236s) 44882338 read pairs processed; of these: 641251 ( 1.43%) short read pairs filtered out after trimming by size control 578470 ( 1.29%) empty read pairs filtered out after trimming by size control 43662617 (97.28%) read pairs available; of these: 14347862 (32.86%) trimmed read pairs available after processing 29314755 (67.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 399 0.00% 19 1184 0.00% 20 1223 0.00% 21 2272 0.01% 22 1041 0.00% 23 1148 0.00% 24 888 0.00% 25 952 0.00% 26 1045 0.00% 27 1289 0.00% 28 1292 0.00% 29 1426 0.00% 30 1433 0.00% 31 2283 0.01% 32 1822 0.00% 33 2110 0.00% 34 2705 0.01% 35 3521 0.01% 36 2949 0.01% 37 3071 0.01% 38 3591 0.01% 39 3997 0.01% 40 4274 0.01% 41 4635 0.01% 42 5334 0.01% 43 5873 0.01% 44 6725 0.02% 45 7007 0.02% 46 7110 0.02% 47 8092 0.02% 48 8828 0.02% 49 9281 0.02% 50 10379 0.02% 51 11064 0.03% 52 11575 0.03% 53 13036 0.03% 54 14109 0.03% 55 15105 0.03% 56 16132 0.04% 57 17133 0.04% 58 18404 0.04% 59 19729 0.05% 60 24694 0.06% 61 22958 0.05% 62 24202 0.06% 63 25826 0.06% 64 29149 0.07% 65 29127 0.07% 66 32007 0.07% 67 32713 0.07% 68 34616 0.08% 69 37620 0.09% 70 40382 0.09% 71 51884 0.12% 72 58534 0.13% 73 62174 0.14% 74 62951 0.14% 75 63839 0.15% 76 65342 0.15% 77 67202 0.15% 78 70000 0.16% 79 71403 0.16% 80 73931 0.17% 81 74652 0.17% 82 77108 0.18% 83 79715 0.18% 84 82939 0.19% 85 87644 0.20% 86 91580 0.21% 87 93381 0.21% 88 93573 0.21% 89 103574 0.24% 90 97973 0.22% 91 98807 0.23% 92 103404 0.24% 93 103371 0.24% 94 109937 0.25% 95 112165 0.26% 96 119570 0.27% 97 120317 0.28% 98 120415 0.28% 99 125321 0.29% 100 125728 0.29% 101 135438 0.31% 102 136476 0.31% 103 138849 0.32% 104 142589 0.33% 105 150040 0.34% 106 150046 0.34% 107 158488 0.36% 108 163418 0.37% 109 180287 0.41% 110 175967 0.40% 111 181608 0.42% 112 192403 0.44% 113 198008 0.45% 114 207097 0.47% 115 218767 0.50% 116 230428 0.53% 117 247445 0.57% 118 269883 0.62% 119 303771 0.70% 120 352913 0.81% 121 440276 1.01% 122 614384 1.41% 123 1104008 2.53% 124 4998079 11.45% 125 29314755 67.14% 43662617 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=36.73 fanout-score-rank=6 prefix-density=0.34 prefix-fanout=36.7 sequence=AGATCGGAAGAGCACACC criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=164.51 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=20.4 sequence=CGCCGCCGCCGC criterion=sequence-density sequence-density=1.15 sequence-density-rank=1 fanout-score=33.16 fanout-score-rank=3 prefix-density=1.17 prefix-fanout=32.6 sequence=GGTGTGCTCTTCCGATCT criterion=fanout-score sequence-density=0.12 sequence-density-rank=14 fanout-score=91.78 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=16.1 sequence=CAGCAGCAGCAG ERR3317434 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:22:49 Started mapping on | Dec 10 09:22:50 Finished on | Dec 10 09:25:11 Mapping speed, Million of reads per hour | 1114.79 Number of input reads | 43662617 Average input read length | 240 UNIQUE READS: Uniquely mapped reads number | 39144735 Uniquely mapped reads % | 89.65% Average mapped length | 239.45 Number of splices: Total | 25224197 Number of splices: Annotated (sjdb) | 23902731 Number of splices: GT/AG | 24861455 Number of splices: GC/AG | 314397 Number of splices: AT/AC | 21296 Number of splices: Non-canonical | 27049 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.00% Deletion average length | 1.23 Insertion rate per base | 0.00% Insertion average length | 1.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 3118168 % of reads mapped to multiple loci | 7.14% Number of reads mapped to too many loci | 196125 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.61% % of reads unmapped: other | 2.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1458201 1458201 1458201 N_multimapping 3118168 3118168 3118168 N_noFeature 1574237 3937143 35940160 N_ambiguous 1283902 509348 50425 UnstrandedReadsAssigned:36286596 PositiveStrandReadsAssigned:34698244 NegativeStrandReadsAssigned:3154150 Dataset is classified positive stranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 ERR3317434 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317434-trimmed-pair1.fastq ERR3317434-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 43,662,617 reads, 37,370,623 reads pseudoaligned [quant] estimated average fragment length: 224.735 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,336 rounds 52973 ERR3317434.ke.tsv 35125 ERR3317434.se.tsv 88098 total ==> ERR3317434.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 712.688 0 0 PNS24247 1044 820.265 30.4207 1.38466 PNS24249 1928 1704.27 221.549 4.85356 PNS24246 1044 820.265 30.4207 1.38466 PNS24248 1044 820.265 30.4207 1.38466 PNS24244 1471 1247.27 295.188 8.83624 PNS24243 293 116.376 1 0.320822 KQK14069 1603 1379.27 7464.39 202.057 KQK14071 474 265.661 24.8015 3.48559 ==> ERR3317434.se.tsv <== BRADI_1g14170v3 8117 BRADI_1g53295v3 62 BRADI_1g59795v3 789 BRADI_1g07683v3 0 BRADI_1g00485v3 61 BRADI_1g20270v3 5309 BRADI_1g74790v3 215 BRADI_1g09890v3 1 BRADI_1g77505v3 408 BRADI_1g48960v3 0 ERR3317434 completed mapping pipeline successfully