Starting /dee2/code/volunteer_pipeline.sh ERR3317435 current disk space = 1525239894016 free memory = 1443011436 ERR3317435 SRAfilesize b653567c7a724aded83989bfe10a440f ERR3317435.sra ERR3317435.sra file validated ERR3317435 is paired end ERR3317435 is conventional basespace ERR3317435 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317435_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.98725 33.0 33.0 33.0 33.0 33.0 2 32.3475 33.0 33.0 33.0 33.0 33.0 3 32.4185 33.0 33.0 33.0 33.0 33.0 4 32.59325 33.0 33.0 33.0 33.0 33.0 5 32.63 33.0 33.0 33.0 33.0 33.0 6 36.243 37.0 37.0 37.0 37.0 37.0 7 36.33725 37.0 37.0 37.0 37.0 37.0 8 36.3905 37.0 37.0 37.0 37.0 37.0 9 36.45025 37.0 37.0 37.0 37.0 37.0 10-11 36.485875 37.0 37.0 37.0 37.0 37.0 12-13 36.392125 37.0 37.0 37.0 37.0 37.0 14-15 36.41974999999999 37.0 37.0 37.0 37.0 37.0 16-17 36.40325 37.0 37.0 37.0 37.0 37.0 18-19 36.376625000000004 37.0 37.0 37.0 37.0 37.0 20-21 36.342625 37.0 37.0 37.0 37.0 37.0 22-23 36.35075 37.0 37.0 37.0 37.0 37.0 24-25 36.2665 37.0 37.0 37.0 37.0 37.0 26-27 36.26775 37.0 37.0 37.0 37.0 37.0 28-29 36.231875 37.0 37.0 37.0 37.0 37.0 30-31 36.181625 37.0 37.0 37.0 37.0 37.0 32-33 36.288375 37.0 37.0 37.0 37.0 37.0 34-35 36.21175 37.0 37.0 37.0 37.0 37.0 36-37 36.241125 37.0 37.0 37.0 37.0 37.0 38-39 36.137 37.0 37.0 37.0 37.0 37.0 40-41 36.045 37.0 37.0 37.0 37.0 37.0 42-43 36.02875 37.0 37.0 37.0 37.0 37.0 44-45 35.98625 37.0 37.0 37.0 37.0 37.0 46-47 35.898625 37.0 37.0 37.0 35.0 37.0 48-49 35.8245 37.0 37.0 37.0 35.0 37.0 50-51 35.906000000000006 37.0 37.0 37.0 35.0 37.0 52-53 35.808625 37.0 37.0 37.0 33.0 37.0 54-55 35.799125000000004 37.0 37.0 37.0 33.0 37.0 56-57 35.827 37.0 37.0 37.0 33.0 37.0 58-59 35.783125 37.0 37.0 37.0 33.0 37.0 60-61 35.787625000000006 37.0 37.0 37.0 33.0 37.0 62-63 35.768125 37.0 37.0 37.0 33.0 37.0 64-65 35.78425 37.0 37.0 37.0 33.0 37.0 66-67 35.719 37.0 37.0 37.0 33.0 37.0 68-69 35.60675 37.0 37.0 37.0 33.0 37.0 70-71 35.652375 37.0 37.0 37.0 33.0 37.0 72-73 35.541624999999996 37.0 37.0 37.0 33.0 37.0 74-75 35.5625 37.0 37.0 37.0 33.0 37.0 76-77 35.504374999999996 37.0 37.0 37.0 33.0 37.0 78-79 35.35725 37.0 37.0 37.0 33.0 37.0 80-81 35.243750000000006 37.0 37.0 37.0 33.0 37.0 82-83 35.155125 37.0 37.0 37.0 33.0 37.0 84-85 35.2115 37.0 37.0 37.0 33.0 37.0 86-87 35.203125 37.0 37.0 37.0 33.0 37.0 88-89 35.105000000000004 37.0 37.0 37.0 33.0 37.0 90-91 35.117875 37.0 37.0 37.0 33.0 37.0 92-93 35.017125 37.0 37.0 37.0 33.0 37.0 94-95 34.984 37.0 37.0 37.0 33.0 37.0 96-97 34.827 37.0 37.0 37.0 33.0 37.0 98-99 34.8985 37.0 37.0 37.0 33.0 37.0 100-101 34.865625 37.0 37.0 37.0 33.0 37.0 102-103 34.71175 37.0 37.0 37.0 30.0 37.0 104-105 34.707 37.0 37.0 37.0 33.0 37.0 106-107 34.62975 37.0 37.0 37.0 30.0 37.0 108-109 34.405375 37.0 37.0 37.0 27.0 37.0 110-111 34.393874999999994 37.0 37.0 37.0 27.0 37.0 112-113 34.460750000000004 37.0 37.0 37.0 27.0 37.0 114-115 34.311 37.0 37.0 37.0 27.0 37.0 116-117 34.23175 37.0 37.0 37.0 27.0 37.0 118-119 34.14375 37.0 37.0 37.0 27.0 37.0 120-121 33.9755 37.0 37.0 37.0 27.0 37.0 122-123 33.662499999999994 37.0 37.0 37.0 27.0 37.0 124-125 31.521625 37.0 35.0 37.0 12.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 0.0 7 2.0 8 5.0 9 1.0 10 1.0 11 5.0 12 2.0 13 1.0 14 2.0 15 3.0 16 5.0 17 5.0 18 4.0 19 7.0 20 0.0 21 6.0 22 13.0 23 27.0 24 3.0 25 6.0 26 19.0 27 29.0 28 30.0 29 39.0 30 50.0 31 76.0 32 85.0 33 135.0 34 231.0 35 478.0 36 2728.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 25.270092226613965 23.952569169960476 20.55335968379447 30.223978919631094 2 23.549999999999997 24.4 19.925 32.125 3 25.7 25.45 20.875 27.975 4 28.425 23.625 19.7 28.249999999999996 5 31.45 21.55 16.950000000000003 30.049999999999997 6 28.475 23.925 20.75 26.85 7 26.450000000000003 22.825 23.275000000000002 27.450000000000003 8 28.475 25.5 26.375 19.650000000000002 9 28.999999999999996 27.1 26.275 17.625 10-11 30.525000000000002 26.325 23.9375 19.2125 12-13 28.1125 25.55 26.424999999999997 19.9125 14-15 25.75 25.55 26.337500000000002 22.3625 16-17 25.8625 25.112499999999997 24.887500000000003 24.1375 18-19 25.650000000000002 25.974999999999998 26.2875 22.0875 20-21 24.925 25.4 26.55 23.125 22-23 25.0625 25.7625 25.85 23.325000000000003 24-25 25.412499999999998 24.85 27.025 22.7125 26-27 24.0125 24.925 27.3375 23.724999999999998 28-29 25.474999999999998 24.637500000000003 26.174999999999997 23.7125 30-31 25.25 24.837500000000002 27.425 22.4875 32-33 25.112499999999997 24.4875 26.575 23.825 34-35 26.087500000000002 24.6 25.95 23.3625 36-37 24.087500000000002 24.462500000000002 27.6875 23.7625 38-39 24.3625 25.275 26.787499999999998 23.575 40-41 25.674999999999997 24.887500000000003 25.575 23.8625 42-43 25.724999999999998 24.3625 26.137500000000003 23.775 44-45 25.7875 24.65 26.450000000000003 23.1125 46-47 25.362499999999997 24.0375 26.275 24.325 48-49 25.0125 24.2875 26.900000000000002 23.799999999999997 50-51 24.95 25.2875 26.5875 23.175 52-53 25.650000000000002 24.2875 26.325 23.7375 54-55 25.724999999999998 25.15 26.700000000000003 22.425 56-57 24.725 24.75 26.450000000000003 24.075 58-59 25.624999999999996 24.15 26.3 23.925 60-61 24.462500000000002 24.9125 27.950000000000003 22.675 62-63 25.674999999999997 24.85 26.1625 23.3125 64-65 26.0375 24.337500000000002 26.2125 23.4125 66-67 24.6 25.8 26.674999999999997 22.925 68-69 25.2 25.2 26.974999999999998 22.625 70-71 26.137500000000003 24.825 25.5 23.5375 72-73 24.6875 25.4875 25.924999999999997 23.9 74-75 25.4375 25.0375 26.6625 22.8625 76-77 25.7625 25.2625 25.474999999999998 23.5 78-79 25.1 25.374999999999996 25.974999999999998 23.549999999999997 80-81 24.712500000000002 25.074999999999996 26.650000000000002 23.5625 82-83 26.1 25.162499999999998 25.637500000000003 23.1 84-85 24.825 24.75 26.887499999999996 23.5375 86-87 26.075 24.9125 25.874999999999996 23.1375 88-89 25.4625 25.2625 26.2125 23.0625 90-91 24.65 25.825 26.950000000000003 22.575 92-93 25.35 25.35 26.3125 22.9875 94-95 25.1875 25.3 25.900000000000002 23.6125 96-97 25.362499999999997 24.9 27.325 22.412499999999998 98-99 25.2625 25.4 25.624999999999996 23.7125 100-101 25.3125 25.087500000000002 26.174999999999997 23.425 102-103 24.712500000000002 25.324999999999996 26.5125 23.45 104-105 25.275 25.0625 25.674999999999997 23.9875 106-107 24.875 26.337500000000002 24.9125 23.875 108-109 24.7 26.087500000000002 25.8125 23.400000000000002 110-111 24.878109763720467 25.803225403175396 25.815726965870734 23.502937867233403 112-113 24.675 25.4625 25.7375 24.125 114-115 24.587500000000002 26.575 25.887500000000003 22.95 116-117 24.9 26.400000000000002 25.1875 23.5125 118-119 25.025 25.7625 24.3625 24.85 120-121 25.15 25.7625 25.8 23.2875 122-123 25.4 25.9875 25.5125 23.1 124-125 25.2375 26.737499999999997 24.675 23.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.0 5 1.5 6 1.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 1.0 23 1.5 24 1.5 25 1.5 26 2.5 27 3.5 28 4.5 29 8.5 30 13.0 31 19.0 32 19.0 33 22.0 34 35.5 35 46.0 36 50.5 37 63.0 38 83.0 39 108.0 40 130.0 41 150.5 42 177.5 43 185.0 44 182.0 45 189.0 46 192.0 47 193.0 48 188.0 49 181.5 50 167.5 51 147.0 52 134.0 53 124.5 54 113.5 55 95.0 56 89.0 57 86.5 58 67.5 59 53.5 60 57.5 61 57.0 62 54.0 63 51.5 64 42.5 65 39.0 66 38.5 67 43.5 68 50.5 69 41.0 70 32.0 71 29.0 72 21.5 73 22.0 74 22.0 75 14.0 76 11.5 77 12.5 78 8.5 79 3.5 80 2.5 81 1.5 82 1.0 83 0.5 84 0.0 85 1.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0125 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.15856777493606 95.95 2 1.5856777493606138 3.1 3 0.07672634271099744 0.22499999999999998 4 0.1534526854219949 0.6 5 0.025575447570332477 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TATGGGCAAAGACACTATTGCTGATTTACTAACCTCTATAAGAAACGCGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.15 0.0 0.0 0.0 0.0 4 0.175 0.0 0.0 0.0 0.0 5 0.2 0.0 0.0 0.0 0.0 6 0.375 0.0 0.0 0.0 0.0 7 0.65 0.0 0.0 0.0 0.0 8 0.7 0.0 0.0 0.0 0.0 9 0.7 0.0 0.0 0.0 0.0 10-11 0.7 0.0 0.0 0.0 0.0 12-13 0.7 0.0 0.0 0.0 0.0 14-15 0.7 0.0 0.0 0.0 0.0 16-17 0.7 0.0 0.0 0.0 0.0 18-19 0.7 0.0 0.0 0.0 0.0 20-21 0.7 0.0 0.0 0.0 0.0 22-23 0.7 0.0 0.0 0.0 0.0 24-25 0.7 0.0 0.0 0.0 0.0 26-27 0.7124999999999999 0.0 0.0 0.0 0.0 28-29 0.7375 0.0 0.0 0.0 0.0 30-31 0.75 0.0 0.0 0.0 0.0 32-33 0.7625 0.0 0.0 0.0 0.0 34-35 0.775 0.0 0.0 0.0 0.0 36-37 0.8125 0.0 0.0 0.0 0.0 38-39 0.825 0.0 0.0 0.0 0.0 40-41 0.85 0.0 0.0 0.0 0.0 42-43 0.875 0.0 0.0 0.0 0.0 44-45 0.875 0.0 0.0 0.0 0.0 46-47 0.9 0.0 0.0 0.0 0.0 48-49 0.925 0.0 0.0 0.0 0.0 50-51 0.9375 0.0 0.0 0.0 0.0 52-53 0.9875 0.0 0.0 0.0 0.0 54-55 1.0 0.0 0.0 0.0 0.0 56-57 1.0 0.0 0.0 0.0 0.0 58-59 1.1125 0.0 0.0 0.0 0.0 60-61 1.15 0.0 0.0 0.0 0.0 62-63 1.2125 0.0 0.0 0.0 0.0 64-65 1.2875 0.0 0.0 0.0 0.0 66-67 1.45 0.0 0.0 0.0 0.0 68-69 1.5875 0.0 0.0 0.0 0.0 70-71 1.725 0.0 0.0 0.0 0.0 72-73 1.7999999999999998 0.0 0.0 0.0 0.0 74-75 1.9749999999999999 0.0 0.0 0.0 0.0 76-77 2.2375 0.0 0.0 0.0 0.0 78-79 2.325 0.0 0.0 0.0 0.0 80-81 2.425 0.0 0.0 0.0 0.0 82-83 2.6375 0.0 0.0 0.0 0.0 84-85 2.9124999999999996 0.0 0.0 0.0 0.0 86-87 3.425 0.0 0.0 0.0 0.0 88-89 3.7625 0.0 0.0 0.0 0.0 90-91 4.0375 0.0 0.0 0.0 0.0 92-93 4.5375 0.0 0.0 0.0 0.0 94-95 5.0 0.0 0.0 0.0 0.0 96-97 5.3875 0.0 0.0 0.0 0.0 98-99 5.7375 0.0 0.0 0.0 0.0 100-101 6.1 0.0 0.0 0.0 0.0 102-103 6.65 0.0 0.0 0.0 0.0 104-105 7.0625 0.0 0.0 0.0 0.0 106-107 7.4 0.0 0.0 0.0 0.0 108-109 7.85 0.0 0.0 0.0 0.0 110-111 8.537500000000001 0.0 0.0 0.0 0.0 112-113 9.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCCCC 10 0.00936543 130.31506 1 TAGATAA 15 0.0040965383 59.45625 64-65 AGATAAA 15 0.0040965383 59.45625 66-67 >>END_MODULE ERR3317435 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317435_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.98325 33.0 33.0 33.0 33.0 33.0 2 32.0235 33.0 33.0 33.0 33.0 33.0 3 32.02075 33.0 33.0 33.0 33.0 33.0 4 31.9645 33.0 33.0 33.0 33.0 33.0 5 31.9885 33.0 33.0 33.0 33.0 33.0 6 35.5515 37.0 37.0 37.0 37.0 37.0 7 35.6355 37.0 37.0 37.0 37.0 37.0 8 35.6835 37.0 37.0 37.0 37.0 37.0 9 35.6505 37.0 37.0 37.0 37.0 37.0 10-11 35.5565 37.0 37.0 37.0 37.0 37.0 12-13 35.598 37.0 37.0 37.0 37.0 37.0 14-15 35.614125 37.0 37.0 37.0 37.0 37.0 16-17 35.599500000000006 37.0 37.0 37.0 37.0 37.0 18-19 35.547875000000005 37.0 37.0 37.0 37.0 37.0 20-21 35.541624999999996 37.0 37.0 37.0 37.0 37.0 22-23 35.487875 37.0 37.0 37.0 37.0 37.0 24-25 35.464124999999996 37.0 37.0 37.0 37.0 37.0 26-27 35.408375 37.0 37.0 37.0 37.0 37.0 28-29 35.495875 37.0 37.0 37.0 37.0 37.0 30-31 35.434625 37.0 37.0 37.0 37.0 37.0 32-33 35.424499999999995 37.0 37.0 37.0 37.0 37.0 34-35 35.401250000000005 37.0 37.0 37.0 37.0 37.0 36-37 35.371875 37.0 37.0 37.0 37.0 37.0 38-39 35.3075 37.0 37.0 37.0 35.0 37.0 40-41 35.312375 37.0 37.0 37.0 35.0 37.0 42-43 35.28675 37.0 37.0 37.0 35.0 37.0 44-45 35.231875 37.0 37.0 37.0 35.0 37.0 46-47 35.179874999999996 37.0 37.0 37.0 33.0 37.0 48-49 35.334500000000006 37.0 37.0 37.0 35.0 37.0 50-51 35.26875 37.0 37.0 37.0 33.0 37.0 52-53 35.2065 37.0 37.0 37.0 33.0 37.0 54-55 35.1345 37.0 37.0 37.0 33.0 37.0 56-57 35.124625 37.0 37.0 37.0 33.0 37.0 58-59 35.130624999999995 37.0 37.0 37.0 33.0 37.0 60-61 35.116875 37.0 37.0 37.0 33.0 37.0 62-63 35.108625 37.0 37.0 37.0 33.0 37.0 64-65 35.135374999999996 37.0 37.0 37.0 33.0 37.0 66-67 35.152375000000006 37.0 37.0 37.0 33.0 37.0 68-69 35.070125000000004 37.0 37.0 37.0 33.0 37.0 70-71 34.944874999999996 37.0 37.0 37.0 33.0 37.0 72-73 34.87325 37.0 37.0 37.0 33.0 37.0 74-75 34.818250000000006 37.0 37.0 37.0 33.0 37.0 76-77 34.644875 37.0 37.0 37.0 33.0 37.0 78-79 34.6355 37.0 37.0 37.0 33.0 37.0 80-81 34.691375 37.0 37.0 37.0 33.0 37.0 82-83 34.576625 37.0 37.0 37.0 33.0 37.0 84-85 34.5695 37.0 37.0 37.0 33.0 37.0 86-87 34.567625 37.0 37.0 37.0 33.0 37.0 88-89 34.403875 37.0 37.0 37.0 33.0 37.0 90-91 34.086 37.0 37.0 37.0 27.0 37.0 92-93 34.0 37.0 37.0 37.0 27.0 37.0 94-95 33.61875 37.0 37.0 37.0 27.0 37.0 96-97 33.310375 37.0 37.0 37.0 18.0 37.0 98-99 33.178125 37.0 37.0 37.0 14.0 37.0 100-101 32.857875 37.0 37.0 37.0 14.0 37.0 102-103 32.500125 37.0 37.0 37.0 2.0 37.0 104-105 32.022875 37.0 37.0 37.0 2.0 37.0 106-107 31.944375 37.0 37.0 37.0 2.0 37.0 108-109 31.362625 37.0 37.0 37.0 2.0 37.0 110-111 31.2775 37.0 37.0 37.0 2.0 37.0 112-113 31.0435 37.0 37.0 37.0 2.0 37.0 114-115 30.705375 37.0 33.0 37.0 2.0 37.0 116-117 30.54625 37.0 33.0 37.0 2.0 37.0 118-119 30.415125 37.0 35.0 37.0 2.0 37.0 120-121 30.357 37.0 33.0 37.0 2.0 37.0 122-123 30.068375 37.0 33.0 37.0 2.0 37.0 124-125 28.389625000000002 37.0 17.5 37.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 67.0 3 7.0 4 5.0 5 4.0 6 4.0 7 2.0 8 1.0 9 5.0 10 4.0 11 5.0 12 1.0 13 3.0 14 4.0 15 5.0 16 7.0 17 7.0 18 4.0 19 7.0 20 8.0 21 12.0 22 26.0 23 14.0 24 11.0 25 30.0 26 70.0 27 79.0 28 62.0 29 95.0 30 89.0 31 72.0 32 110.0 33 102.0 34 147.0 35 285.0 36 2646.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.874999999999996 12.25 26.924999999999997 28.95 2 26.875 12.75 24.025 36.35 3 23.125 15.625 26.424999999999997 34.825 4 25.424999999999997 14.7 25.0 34.875 5 28.349999999999998 16.2 21.0 34.449999999999996 6 27.775 19.650000000000002 28.7 23.875 7 21.0 27.025 35.4 16.575 8 17.549999999999997 27.700000000000003 34.625 20.125 9 19.0 30.349999999999998 31.85 18.8 10-11 19.4625 29.4375 30.575000000000003 20.525 12-13 19.5875 29.9625 28.875 21.575 14-15 20.4 29.2375 27.250000000000004 23.1125 16-17 21.075 28.3375 27.0625 23.525 18-19 21.1125 29.375 26.450000000000003 23.0625 20-21 21.0375 28.425 27.1375 23.400000000000002 22-23 21.575 27.1625 26.6625 24.6 24-25 20.974999999999998 28.4 26.787499999999998 23.8375 26-27 20.6125 28.375 25.887500000000003 25.124999999999996 28-29 22.75 27.487499999999997 24.525 25.2375 30-31 20.875 29.375 26.075 23.674999999999997 32-33 22.400000000000002 28.3125 25.137500000000003 24.15 34-35 21.25 28.0625 24.962500000000002 25.724999999999998 36-37 22.025 27.8375 25.224999999999998 24.9125 38-39 21.4375 28.349999999999998 25.174999999999997 25.0375 40-41 22.412499999999998 26.5125 25.174999999999997 25.900000000000002 42-43 22.025 27.8875 25.45 24.637500000000003 44-45 23.1875 27.575 24.7375 24.5 46-47 22.821057896711267 27.947980492684753 23.321245467050144 25.909716143553833 48-49 21.8304576144036 29.232308077019255 24.943735933983497 23.99349837459365 50-51 23.75 27.5875 24.55 24.1125 52-53 22.6125 27.950000000000003 24.962500000000002 24.474999999999998 54-55 21.2875 27.675 26.150000000000002 24.887500000000003 56-57 22.2625 27.825 25.7 24.212500000000002 58-59 22.025 27.537499999999998 24.9875 25.45 60-61 21.6875 28.8375 25.35 24.125 62-63 22.175 27.8875 25.337500000000002 24.6 64-65 22.425 26.637499999999996 25.650000000000002 25.2875 66-67 21.25 29.1375 25.474999999999998 24.1375 68-69 20.962500000000002 28.65 24.45 25.937500000000004 70-71 21.625 27.8375 24.837500000000002 25.7 72-73 22.75 28.1375 24.6 24.5125 74-75 22.6 27.800000000000004 24.725 24.875 76-77 22.4375 28.6125 24.0375 24.9125 78-79 22.3375 28.1 24.6125 24.95 80-81 22.45 27.9125 24.55 25.087500000000002 82-83 22.287499999999998 27.237499999999997 24.1875 26.2875 84-85 23.400000000000002 27.900000000000002 24.725 23.974999999999998 86-87 24.125 27.825 24.1125 23.9375 88-89 23.634994351700765 26.647420610016315 24.651688213882263 25.065896824400653 90-91 22.310505738428553 28.793038214150585 24.883339639298775 24.013116408122084 92-93 23.86205147711424 27.23468999619627 24.432610625079242 24.470647901610246 94-95 23.08483290488432 27.49357326478149 24.447300771208226 24.974293059125962 96-97 24.139264990328822 27.027724049000646 24.564796905222437 24.268214055448098 98-99 24.27498705334024 27.136198860693938 23.446400828586224 25.142413257379598 100-101 22.895357985837922 27.917650144243378 23.983739837398375 25.203252032520325 102-103 23.51225977468522 28.66799204771372 23.750828363154408 24.068919814446655 104-105 24.360861999732297 27.051264890911526 24.01284968545041 24.57502342390577 106-107 24.184055644729803 26.685393258426966 23.903156768325307 25.22739432851792 108-109 25.225225225225223 26.754026754026754 23.737373737373737 24.283374283374286 110-111 24.49007342942616 28.610280119662768 23.85096546097362 23.04868098993745 112-113 23.841059602649008 26.766004415011036 23.827262693156733 25.565673289183223 114-115 24.47960033305579 26.991396058839857 24.396336386344714 24.132667221759647 116-117 23.987367842921874 26.9119868186187 23.904984209803654 25.19566112865577 118-119 25.670175438596495 26.94736842105263 23.326315789473682 24.056140350877193 120-121 23.68972746331237 28.74912648497554 24.360587002096437 23.200559049615656 122-123 25.467746439542026 27.57609606255236 22.870706506562414 24.085450991343198 124-125 24.822892068342824 25.961939158216417 25.128490068065005 24.086678705375746 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.5 4 1.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 2.0 23 3.5 24 3.5 25 5.0 26 7.0 27 7.5 28 11.0 29 13.5 30 15.5 31 24.0 32 31.0 33 40.5 34 59.0 35 69.0 36 80.0 37 103.5 38 124.5 39 140.0 40 158.5 41 183.5 42 209.0 43 219.0 44 219.5 45 201.0 46 177.0 47 167.0 48 157.5 49 150.5 50 144.5 51 134.0 52 119.0 53 99.0 54 84.0 55 83.0 56 89.0 57 78.5 58 56.0 59 52.5 60 57.0 61 51.0 62 33.5 63 31.0 64 33.0 65 24.5 66 25.5 67 27.0 68 23.0 69 23.5 70 22.5 71 18.5 72 16.0 73 18.5 74 19.5 75 11.5 76 8.5 77 10.0 78 6.0 79 3.5 80 3.5 81 1.5 82 1.0 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0375 48-49 0.025 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.41250000000000003 90-91 0.8875 92-93 1.4125 94-95 2.75 96-97 3.0625 98-99 3.45 100-101 4.675 102-103 5.6875 104-105 6.612500000000001 106-107 6.550000000000001 108-109 8.425 110-111 8.075000000000001 112-113 9.4 114-115 9.925 116-117 8.9625 118-119 10.9375 120-121 10.5625 122-123 10.475 124-125 10.012500000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0379746835443 97.8 2 0.7848101265822786 1.55 3 0.10126582278481014 0.3 4 0.05063291139240507 0.2 5 0.0 0.0 6 0.025316455696202535 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.15 0.0 0.0 0.0 0.0 4 0.175 0.0 0.0 0.0 0.0 5 0.2 0.0 0.0 0.0 0.0 6 0.375 0.0 0.0 0.0 0.0 7 0.65 0.0 0.0 0.0 0.0 8 0.7 0.0 0.0 0.0 0.0 9 0.7 0.0 0.0 0.0 0.0 10-11 0.7 0.0 0.0 0.0 0.0 12-13 0.7 0.0 0.0 0.0 0.0 14-15 0.7 0.0 0.0 0.0 0.0 16-17 0.7 0.0 0.0 0.0 0.0 18-19 0.7 0.0 0.0 0.0 0.0 20-21 0.7 0.0 0.0 0.0 0.0 22-23 0.7 0.0 0.0 0.0 0.0 24-25 0.7 0.0 0.0 0.0 0.0 26-27 0.7124999999999999 0.0 0.0 0.0 0.0 28-29 0.7375 0.0 0.0 0.0 0.0 30-31 0.75 0.0 0.0 0.0 0.0 32-33 0.7625 0.0 0.0 0.0 0.0 34-35 0.775 0.0 0.0 0.0 0.0 36-37 0.8 0.0 0.0 0.0 0.0 38-39 0.8 0.0 0.0 0.0 0.0 40-41 0.825 0.0 0.0 0.0 0.0 42-43 0.85 0.0 0.0 0.0 0.0 44-45 0.85 0.0 0.0 0.0 0.0 46-47 0.875 0.0 0.0 0.0 0.0 48-49 0.9 0.0 0.0 0.0 0.0 50-51 0.9125000000000001 0.0 0.0 0.0 0.0 52-53 0.9624999999999999 0.0 0.0 0.0 0.0 54-55 1.0 0.0 0.0 0.0 0.0 56-57 1.0 0.0 0.0 0.0 0.0 58-59 1.1125 0.0 0.0 0.0 0.0 60-61 1.175 0.0 0.0 0.0 0.0 62-63 1.2625 0.0 0.0 0.0 0.0 64-65 1.3375 0.0 0.0 0.0 0.0 66-67 1.5 0.0 0.0 0.0 0.0 68-69 1.6375000000000002 0.0 0.0 0.0 0.0 70-71 1.75 0.0 0.0 0.0 0.0 72-73 1.8250000000000002 0.0 0.0 0.0 0.0 74-75 2.0125 0.0 0.0 0.0 0.0 76-77 2.2875 0.0 0.0 0.0 0.0 78-79 2.4375 0.0 0.0 0.0 0.0 80-81 2.55 0.0 0.0 0.0 0.0 82-83 2.7625 0.0 0.0 0.0 0.0 84-85 3.05 0.0 0.0 0.0 0.0 86-87 3.6125 0.0 0.0 0.0 0.0 88-89 3.9625 0.0 0.0 0.0 0.0 90-91 4.15 0.0 0.0 0.0 0.0 92-93 4.5875 0.0 0.0 0.0 0.0 94-95 5.0 0.0 0.0 0.0 0.0 96-97 5.35 0.0 0.0 0.0 0.0 98-99 5.6625 0.0 0.0 0.0 0.0 100-101 6.025 0.0 0.0 0.0 0.0 102-103 6.4625 0.0 0.0 0.0 0.0 104-105 6.775 0.0 0.0 0.0 0.0 106-107 7.0875 0.0 0.0 0.0 0.0 108-109 7.4875 0.0 0.0 0.0 0.0 110-111 8.075 0.0 0.0 0.0 0.0 112-113 8.475000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTAGTT 20 8.898533E-4 86.54063 9 TATTTAG 20 8.898533E-4 86.54063 7 ATTTAGT 20 8.898533E-4 86.54063 8 CTCGAAT 15 0.0046149883 57.69375 50-51 CGCGAAC 15 0.0046149883 57.69375 44-45 CTTCACA 15 0.0046149883 57.69375 72-73 ACTCGAA 15 0.0046149883 57.69375 48-49 CGATAGT 15 0.0046149883 57.69375 28-29 CGCCTTC 15 0.0046149883 57.69375 62-63 TCGATAG 15 0.0046149883 57.69375 26-27 AATTTGA 15 0.0046149883 57.69375 54-55 GGCGCGA 15 0.0046149883 57.69375 42-43 TCGAATT 15 0.0046149883 57.69375 50-51 CACAAGC 15 0.0046149883 57.69375 76-77 TGATCGC 15 0.0046149883 57.69375 58-59 GTATCTA 15 0.0046149883 57.69375 32-33 GCGAACT 15 0.0046149883 57.69375 44-45 GCGCGAA 15 0.0046149883 57.69375 42-43 GTTTTAT 15 0.0046149883 57.69375 12-13 TTTTATC 15 0.0046149883 57.69375 14-15 >>END_MODULE Read 2422790 spots for ERR3317435.sra Written 2422790 spots for ERR3317435.sra Read 2422790 spots for ERR3317435.sra Written 2422790 spots for ERR3317435.sra Read 2422790 spots for ERR3317435.sra Written 2422790 spots for ERR3317435.sra Read 2422790 spots for ERR3317435.sra Written 2422790 spots for ERR3317435.sra Read 2422790 spots for ERR3317435.sra Written 2422790 spots for ERR3317435.sra Read 2422790 spots for ERR3317435.sra Written 2422790 spots for ERR3317435.sra Read 2422790 spots for ERR3317435.sra Written 2422790 spots for ERR3317435.sra Read 2422790 spots for ERR3317435.sra Written 2422790 spots for ERR3317435.sra Read 2422795 spots for ERR3317435.sra Written 2422795 spots for ERR3317435.sra Read 2422790 spots for ERR3317435.sra Written 2422790 spots for ERR3317435.sra Read 2422790 spots for ERR3317435.sra Written 2422790 spots for ERR3317435.sra Read 2422790 spots for ERR3317435.sra Written 2422790 spots for ERR3317435.sra Read 2422790 spots for ERR3317435.sra Written 2422790 spots for ERR3317435.sra Read 2422790 spots for ERR3317435.sra Written 2422790 spots for ERR3317435.sra Read 2422790 spots for ERR3317435.sra Written 2422790 spots for ERR3317435.sra Read 2422790 spots for ERR3317435.sra Written 2422790 spots for ERR3317435.sra Read 2422790 spots for ERR3317435.sra Written 2422790 spots for ERR3317435.sra Read 2422790 spots for ERR3317435.sra Written 2422790 spots for ERR3317435.sra Read 2422790 spots for ERR3317435.sra Written 2422790 spots for ERR3317435.sra Read 2422790 spots for ERR3317435.sra Written 2422790 spots for ERR3317435.sra SRR ids: ['ERR3317435.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mzt0a_xa ERR3317435.sra spots: 48455805 blocks: [[1, 2422790], [2422791, 4845580], [4845581, 7268370], [7268371, 9691160], [9691161, 12113950], [12113951, 14536740], [14536741, 16959530], [16959531, 19382320], [19382321, 21805110], [21805111, 24227900], [24227901, 26650690], [26650691, 29073480], [29073481, 31496270], [31496271, 33919060], [33919061, 36341850], [36341851, 38764640], [38764641, 41187430], [41187431, 43610220], [43610221, 46033010], [46033011, 48455805]] ERR3317435 file size 13937735 ERR3317435 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317435 ERR3317435_1.fastq ERR3317435_2.fastq Input file: ERR3317435_1.fastq Paired file: ERR3317435_2.fastq trimmed: ERR3317435-trimmed-pair1.fastq, ERR3317435-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:17:17 2024 >> started Tue Dec 10 09:18:16 2024 >> done (58.643s) 48455805 read pairs processed; of these: 533789 ( 1.10%) short read pairs filtered out after trimming by size control 625116 ( 1.29%) empty read pairs filtered out after trimming by size control 47296900 (97.61%) read pairs available; of these: 15499625 (32.77%) trimmed read pairs available after processing 31797275 (67.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 421 0.00% 19 1201 0.00% 20 1304 0.00% 21 2200 0.00% 22 1142 0.00% 23 1284 0.00% 24 976 0.00% 25 987 0.00% 26 1282 0.00% 27 1477 0.00% 28 1522 0.00% 29 1477 0.00% 30 1603 0.00% 31 2493 0.01% 32 2109 0.00% 33 2384 0.01% 34 3035 0.01% 35 3753 0.01% 36 3266 0.01% 37 3311 0.01% 38 4054 0.01% 39 4450 0.01% 40 4755 0.01% 41 5241 0.01% 42 6203 0.01% 43 6363 0.01% 44 7343 0.02% 45 7270 0.02% 46 7856 0.02% 47 8991 0.02% 48 9707 0.02% 49 10142 0.02% 50 11591 0.02% 51 11922 0.03% 52 12561 0.03% 53 13844 0.03% 54 15571 0.03% 55 16413 0.03% 56 17198 0.04% 57 18534 0.04% 58 19553 0.04% 59 21758 0.05% 60 29524 0.06% 61 24799 0.05% 62 26107 0.06% 63 27585 0.06% 64 32423 0.07% 65 31389 0.07% 66 34833 0.07% 67 35037 0.07% 68 37139 0.08% 69 39981 0.08% 70 43474 0.09% 71 56355 0.12% 72 63073 0.13% 73 68377 0.14% 74 69344 0.15% 75 69504 0.15% 76 70228 0.15% 77 72720 0.15% 78 76801 0.16% 79 77665 0.16% 80 80644 0.17% 81 80377 0.17% 82 82937 0.18% 83 86119 0.18% 84 89901 0.19% 85 97385 0.21% 86 99578 0.21% 87 101565 0.21% 88 101265 0.21% 89 116995 0.25% 90 106759 0.23% 91 105556 0.22% 92 110956 0.23% 93 109890 0.23% 94 117068 0.25% 95 120843 0.26% 96 126244 0.27% 97 126981 0.27% 98 128502 0.27% 99 132143 0.28% 100 133962 0.28% 101 144288 0.31% 102 144206 0.30% 103 146602 0.31% 104 150994 0.32% 105 157754 0.33% 106 160066 0.34% 107 166987 0.35% 108 174348 0.37% 109 200587 0.42% 110 189825 0.40% 111 194774 0.41% 112 212475 0.45% 113 213635 0.45% 114 222570 0.47% 115 233727 0.49% 116 247346 0.52% 117 266529 0.56% 118 288454 0.61% 119 326955 0.69% 120 380210 0.80% 121 470635 1.00% 122 656204 1.39% 123 1184387 2.50% 124 5445492 11.51% 125 31797275 67.23% 47296900 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=35.37 fanout-score-rank=5 prefix-density=0.36 prefix-fanout=35.4 sequence=AGATCGGAAGAGCACACC criterion=fanout-score sequence-density=0.11 sequence-density-rank=13 fanout-score=108.14 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=17.8 sequence=GCCGCCGCCGCCA criterion=sequence-density sequence-density=1.26 sequence-density-rank=1 fanout-score=32.48 fanout-score-rank=6 prefix-density=1.28 prefix-fanout=32.0 sequence=GGTGTGCTCTTCCGATCT criterion=fanout-score sequence-density=0.11 sequence-density-rank=17 fanout-score=111.23 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=21.2 sequence=AGCAGCAGCAGTAATTTGACCGTATGGATCGATCTCAGGCAGGGGTAGTACAAAAAAGAGGAACACATAATATTACTTGAGCATTTCATTCAAGCTCGCTCGCACAGCAGCAACCAAATCGATGCACGATAAGATCCATGGAGCTTAGAGAGATTATGATATCAT ERR3317435 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:19:05 Started mapping on | Dec 10 09:19:06 Finished on | Dec 10 09:21:21 Mapping speed, Million of reads per hour | 1261.25 Number of input reads | 47296900 Average input read length | 240 UNIQUE READS: Uniquely mapped reads number | 42502407 Uniquely mapped reads % | 89.86% Average mapped length | 239.53 Number of splices: Total | 28873302 Number of splices: Annotated (sjdb) | 27373770 Number of splices: GT/AG | 28453612 Number of splices: GC/AG | 362292 Number of splices: AT/AC | 26895 Number of splices: Non-canonical | 30503 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.00% Deletion average length | 1.23 Insertion rate per base | 0.00% Insertion average length | 1.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 3603766 % of reads mapped to multiple loci | 7.62% Number of reads mapped to too many loci | 162510 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.66% % of reads unmapped: other | 1.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1258314 1258314 1258314 N_multimapping 3603766 3603766 3603766 N_noFeature 1638943 4657920 38542847 N_ambiguous 1448515 585877 69906 UnstrandedReadsAssigned:39414949 PositiveStrandReadsAssigned:37258610 NegativeStrandReadsAssigned:3889654 Dataset is classified positive stranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 ERR3317435 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317435-trimmed-pair1.fastq ERR3317435-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 47,296,900 reads, 40,343,537 reads pseudoaligned [quant] estimated average fragment length: 226.567 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,203 rounds 52973 ERR3317435.ke.tsv 35125 ERR3317435.se.tsv 88098 total ==> ERR3317435.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 710.838 0 0 PNS24247 1044 818.433 61.2249 2.58762 PNS24249 1928 1702.43 192.209 3.90534 PNS24246 1044 818.433 61.2249 2.58762 PNS24248 1044 818.433 61.2249 2.58762 PNS24244 1471 1245.43 368.116 10.224 PNS24243 293 115.087 0 0 KQK14069 1603 1377.43 3822.3 95.9863 KQK14071 474 264.293 1.31381 0.17195 ==> ERR3317435.se.tsv <== BRADI_1g14170v3 4169 BRADI_1g53295v3 82 BRADI_1g59795v3 642 BRADI_1g07683v3 0 BRADI_1g00485v3 82 BRADI_1g20270v3 4239 BRADI_1g74790v3 349 BRADI_1g09890v3 7 BRADI_1g77505v3 628 BRADI_1g48960v3 1 ERR3317435 completed mapping pipeline successfully