Starting /dee2/code/volunteer_pipeline.sh ERR3317436 current disk space = 1525210525696 free memory = 1528540580 ERR3317436 SRAfilesize 884debd7b66d77cbab80976870fb103e ERR3317436.sra ERR3317436.sra file validated ERR3317436 is paired end ERR3317436 is conventional basespace ERR3317436 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317436_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9045 33.0 33.0 33.0 33.0 33.0 2 32.34475 33.0 33.0 33.0 33.0 33.0 3 32.43125 33.0 33.0 33.0 33.0 33.0 4 32.571 33.0 33.0 33.0 33.0 33.0 5 32.6105 33.0 33.0 33.0 33.0 33.0 6 36.25825 37.0 37.0 37.0 37.0 37.0 7 36.43325 37.0 37.0 37.0 37.0 37.0 8 36.43825 37.0 37.0 37.0 37.0 37.0 9 36.42125 37.0 37.0 37.0 37.0 37.0 10-11 36.428375 37.0 37.0 37.0 37.0 37.0 12-13 36.432125 37.0 37.0 37.0 37.0 37.0 14-15 36.49675 37.0 37.0 37.0 37.0 37.0 16-17 36.41875 37.0 37.0 37.0 37.0 37.0 18-19 36.44675 37.0 37.0 37.0 37.0 37.0 20-21 36.444874999999996 37.0 37.0 37.0 37.0 37.0 22-23 36.400000000000006 37.0 37.0 37.0 37.0 37.0 24-25 36.4165 37.0 37.0 37.0 37.0 37.0 26-27 36.331374999999994 37.0 37.0 37.0 37.0 37.0 28-29 36.2935 37.0 37.0 37.0 37.0 37.0 30-31 36.245125 37.0 37.0 37.0 37.0 37.0 32-33 36.316874999999996 37.0 37.0 37.0 37.0 37.0 34-35 36.3525 37.0 37.0 37.0 37.0 37.0 36-37 36.297625 37.0 37.0 37.0 37.0 37.0 38-39 36.239375 37.0 37.0 37.0 37.0 37.0 40-41 36.152125 37.0 37.0 37.0 37.0 37.0 42-43 36.1025 37.0 37.0 37.0 37.0 37.0 44-45 36.08325 37.0 37.0 37.0 37.0 37.0 46-47 35.9685 37.0 37.0 37.0 37.0 37.0 48-49 35.931125 37.0 37.0 37.0 35.0 37.0 50-51 35.892875000000004 37.0 37.0 37.0 33.0 37.0 52-53 35.903875 37.0 37.0 37.0 33.0 37.0 54-55 35.94125 37.0 37.0 37.0 33.0 37.0 56-57 35.96825 37.0 37.0 37.0 33.0 37.0 58-59 35.90475 37.0 37.0 37.0 33.0 37.0 60-61 35.763125 37.0 37.0 37.0 33.0 37.0 62-63 35.80925 37.0 37.0 37.0 33.0 37.0 64-65 35.8575 37.0 37.0 37.0 33.0 37.0 66-67 35.883125 37.0 37.0 37.0 33.0 37.0 68-69 35.790499999999994 37.0 37.0 37.0 33.0 37.0 70-71 35.795874999999995 37.0 37.0 37.0 33.0 37.0 72-73 35.66525 37.0 37.0 37.0 33.0 37.0 74-75 35.61925 37.0 37.0 37.0 33.0 37.0 76-77 35.601625 37.0 37.0 37.0 33.0 37.0 78-79 35.431625 37.0 37.0 37.0 33.0 37.0 80-81 35.432125 37.0 37.0 37.0 33.0 37.0 82-83 35.426500000000004 37.0 37.0 37.0 33.0 37.0 84-85 35.385625000000005 37.0 37.0 37.0 33.0 37.0 86-87 35.417500000000004 37.0 37.0 37.0 33.0 37.0 88-89 35.367875 37.0 37.0 37.0 33.0 37.0 90-91 35.35325 37.0 37.0 37.0 33.0 37.0 92-93 35.175875000000005 37.0 37.0 37.0 33.0 37.0 94-95 35.15225 37.0 37.0 37.0 33.0 37.0 96-97 35.058375 37.0 37.0 37.0 33.0 37.0 98-99 35.109 37.0 37.0 37.0 33.0 37.0 100-101 35.111125 37.0 37.0 37.0 33.0 37.0 102-103 35.001625000000004 37.0 37.0 37.0 33.0 37.0 104-105 34.8615 37.0 37.0 37.0 33.0 37.0 106-107 34.81275 37.0 37.0 37.0 33.0 37.0 108-109 34.668375 37.0 37.0 37.0 27.0 37.0 110-111 34.600624999999994 37.0 37.0 37.0 30.0 37.0 112-113 34.766625000000005 37.0 37.0 37.0 33.0 37.0 114-115 34.670125 37.0 37.0 37.0 33.0 37.0 116-117 34.55375 37.0 37.0 37.0 30.0 37.0 118-119 34.508750000000006 37.0 37.0 37.0 27.0 37.0 120-121 34.287375 37.0 37.0 37.0 27.0 37.0 122-123 33.91375 37.0 37.0 37.0 27.0 37.0 124-125 31.807125 37.0 35.0 37.0 12.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 1.0 10 0.0 11 2.0 12 0.0 13 0.0 14 1.0 15 2.0 16 0.0 17 2.0 18 3.0 19 4.0 20 3.0 21 9.0 22 12.0 23 15.0 24 12.0 25 6.0 26 17.0 27 17.0 28 37.0 29 42.0 30 52.0 31 77.0 32 99.0 33 127.0 34 241.0 35 521.0 36 2696.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 23.59313077939234 26.39365918097754 19.788639365918097 30.22457067371202 2 24.0 23.849999999999998 19.825 32.324999999999996 3 25.3 26.275 20.200000000000003 28.225 4 26.150000000000002 24.5 19.275000000000002 30.075000000000003 5 29.5 22.575 18.45 29.475 6 28.050000000000004 24.425 21.099999999999998 26.424999999999997 7 26.200000000000003 23.974999999999998 22.975 26.85 8 28.349999999999998 24.85 26.900000000000002 19.900000000000002 9 28.575 27.025 26.05 18.35 10-11 28.6875 26.35 24.85 20.1125 12-13 27.8125 26.025 25.0125 21.15 14-15 26.25 25.0125 25.674999999999997 23.0625 16-17 26.0125 23.95 26.0125 24.025 18-19 25.8125 24.9125 25.387500000000003 23.8875 20-21 25.837500000000002 24.45 25.112499999999997 24.6 22-23 25.337500000000002 24.212500000000002 26.400000000000002 24.05 24-25 24.837500000000002 24.4 26.75 24.0125 26-27 24.0125 24.525 26.4625 25.0 28-29 25.95 24.6625 24.975 24.4125 30-31 25.412499999999998 24.4 26.3625 23.825 32-33 26.2125 24.0 26.2875 23.5 34-35 25.4375 23.962500000000002 25.912499999999998 24.6875 36-37 25.1875 24.4 26.05 24.3625 38-39 25.15 24.95 26.174999999999997 23.724999999999998 40-41 25.5375 24.1875 25.074999999999996 25.2 42-43 25.887500000000003 24.462500000000002 25.775 23.875 44-45 25.8125 24.725 25.6125 23.849999999999998 46-47 25.85 24.4375 24.7875 24.925 48-49 25.825 23.849999999999998 26.5 23.825 50-51 25.687500000000004 24.8625 25.687500000000004 23.7625 52-53 25.8625 24.55 25.1 24.4875 54-55 25.4 24.837500000000002 26.200000000000003 23.5625 56-57 26.2875 23.9125 25.7375 24.0625 58-59 25.5375 24.4 24.925 25.137500000000003 60-61 24.0625 24.325 27.250000000000004 24.3625 62-63 25.775 24.775 26.674999999999997 22.775000000000002 64-65 25.474999999999998 24.8 25.85 23.875 66-67 24.9375 24.925 26.237500000000004 23.9 68-69 24.8625 24.6875 26.187500000000004 24.2625 70-71 25.55 24.462500000000002 25.4375 24.55 72-73 25.900000000000002 24.762500000000003 26.200000000000003 23.1375 74-75 26.025 24.575 25.5 23.9 76-77 26.7125 25.1875 24.675 23.425 78-79 25.0 25.637500000000003 25.662499999999998 23.7 80-81 26.025 24.3625 26.187500000000004 23.425 82-83 25.162499999999998 24.925 25.650000000000002 24.2625 84-85 25.5125 25.074999999999996 26.337500000000002 23.075000000000003 86-87 26.025 24.887500000000003 25.7 23.3875 88-89 25.900000000000002 25.124999999999996 24.2625 24.712500000000002 90-91 25.8125 25.1 25.45 23.6375 92-93 25.9875 25.112499999999997 25.587500000000002 23.3125 94-95 25.874999999999996 23.625 25.874999999999996 24.625 96-97 25.0375 25.025 26.137500000000003 23.799999999999997 98-99 26.1125 24.7875 25.587500000000002 23.5125 100-101 25.6 25.374999999999996 24.9875 24.0375 102-103 24.875 25.4375 25.162499999999998 24.525 104-105 26.1 24.837500000000002 25.0625 24.0 106-107 25.924999999999997 24.625 25.4875 23.962500000000002 108-109 25.8125 25.15 25.7625 23.275000000000002 110-111 25.55319414926866 25.928241030128767 25.19064883110389 23.32791598949869 112-113 25.2125 26.35 24.474999999999998 23.962500000000002 114-115 25.275 25.7 25.387500000000003 23.6375 116-117 25.15 25.7375 24.725 24.3875 118-119 26.200000000000003 25.650000000000002 24.0625 24.087500000000002 120-121 25.2 25.775 25.624999999999996 23.400000000000002 122-123 25.95 24.925 24.7 24.425 124-125 25.4875 25.837500000000002 24.4375 24.2375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 1.5 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 2.0 21 2.0 22 0.5 23 0.5 24 0.5 25 2.0 26 3.0 27 2.0 28 2.0 29 6.5 30 13.0 31 16.5 32 17.5 33 18.5 34 29.5 35 41.5 36 45.5 37 49.5 38 74.0 39 94.0 40 104.5 41 127.0 42 163.5 43 184.5 44 185.5 45 212.0 46 219.0 47 201.0 48 193.5 49 170.0 50 154.0 51 142.5 52 128.5 53 130.0 54 120.0 55 107.0 56 90.5 57 65.0 58 60.5 59 62.0 60 57.5 61 57.5 62 58.0 63 60.0 64 51.0 65 45.0 66 41.5 67 44.0 68 49.5 69 49.0 70 43.5 71 38.0 72 34.0 73 29.0 74 23.5 75 15.5 76 11.0 77 10.5 78 10.0 79 8.5 80 5.5 81 3.0 82 3.0 83 2.0 84 1.5 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0125 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.65 #Duplication Level Percentage of deduplicated Percentage of total 1 97.74961200206931 94.475 2 1.5002586652871184 2.9000000000000004 3 0.46559751681324363 1.35 4 0.1551991722710812 0.6 5 0.0775995861355406 0.375 6 0.05173305742369374 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATTAAGCTTTCCTGCTAGCTATAGCTCGGTGGATAGCTGATCATCA 6 0.15 No Hit TGCTCGTGAAGGTAATGAAATTATCCGAGCAGCTTGCAAATGGAGTCCTG 6 0.15 No Hit CTAGCCTGCGCCGCCGCACCCAAAACCCTAGCCCTACCTCCGCCTCACCA 5 0.125 No Hit CCACAGCTTAATCCCTATTTTACTCCTAGAAATAGAACACAGCCATATAA 5 0.125 No Hit GCAAAAAATTACGGTAGAGCGTGTTATGAGTGTCTACGTGGTGGACTTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.225 0.0 0.0 0.0 0.0 7 0.525 0.0 0.0 0.0 0.0 8 0.575 0.0 0.0 0.0 0.0 9 0.575 0.0 0.0 0.0 0.0 10-11 0.575 0.0 0.0 0.0 0.0 12-13 0.575 0.0 0.0 0.0 0.0 14-15 0.575 0.0 0.0 0.0 0.0 16-17 0.575 0.0 0.0 0.0 0.0 18-19 0.575 0.0 0.0 0.0 0.0 20-21 0.575 0.0 0.0 0.0 0.0 22-23 0.575 0.0 0.0 0.0 0.0 24-25 0.575 0.0 0.0 0.0 0.0 26-27 0.575 0.0 0.0 0.0 0.0 28-29 0.575 0.0 0.0 0.0 0.0 30-31 0.575 0.0 0.0 0.0 0.0 32-33 0.6 0.0 0.0 0.0 0.0 34-35 0.6 0.0 0.0 0.0 0.0 36-37 0.65 0.0 0.0 0.0 0.0 38-39 0.65 0.0 0.0 0.0 0.0 40-41 0.65 0.0 0.0 0.0 0.0 42-43 0.6875 0.0 0.0 0.0 0.0 44-45 0.7 0.0 0.0 0.0 0.0 46-47 0.725 0.0 0.0 0.0 0.0 48-49 0.75 0.0 0.0 0.0 0.0 50-51 0.7625 0.0 0.0 0.0 0.0 52-53 0.8125 0.0 0.0 0.0 0.0 54-55 0.9 0.0 0.0 0.0 0.0 56-57 1.0125 0.0 0.0 0.0 0.0 58-59 1.1375 0.0 0.0 0.0 0.0 60-61 1.1875 0.0 0.0 0.0 0.0 62-63 1.225 0.0 0.0 0.0 0.0 64-65 1.2999999999999998 0.0 0.0 0.0 0.0 66-67 1.4625 0.0 0.0 0.0 0.0 68-69 1.5750000000000002 0.0 0.0 0.0 0.0 70-71 1.7000000000000002 0.0 0.0 0.0 0.0 72-73 1.7999999999999998 0.0 0.0 0.0 0.0 74-75 2.0625 0.0 0.0 0.0 0.0 76-77 2.2750000000000004 0.0 0.0 0.0 0.0 78-79 2.4875 0.0 0.0 0.0 0.0 80-81 2.7375 0.0 0.0 0.0 0.0 82-83 2.9749999999999996 0.0 0.0 0.0 0.0 84-85 3.2125000000000004 0.0 0.0 0.0 0.0 86-87 3.35 0.0 0.0 0.0 0.0 88-89 3.7125 0.0 0.0 0.0 0.0 90-91 4.125 0.0 0.0 0.0 0.0 92-93 4.5625 0.0 0.0 0.0 0.0 94-95 4.775 0.0 0.0 0.0 0.0 96-97 5.1875 0.0 0.0 0.0 0.0 98-99 5.550000000000001 0.0 0.0 0.0 0.0 100-101 6.0625 0.0 0.0 0.0 0.0 102-103 6.5625 0.0 0.0 0.0 0.0 104-105 7.050000000000001 0.0 0.0 0.0 0.0 106-107 7.6625 0.0 0.0 0.0 0.0 108-109 8.1625 0.0 0.0 0.0 0.0 110-111 8.7 0.0 0.0 0.0 0.0 112-113 9.225000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317436 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317436_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.93625 33.0 33.0 33.0 33.0 33.0 2 31.96425 33.0 33.0 33.0 33.0 33.0 3 32.0415 33.0 33.0 33.0 33.0 33.0 4 32.01725 33.0 33.0 33.0 33.0 33.0 5 32.05625 33.0 33.0 33.0 33.0 33.0 6 35.681 37.0 37.0 37.0 37.0 37.0 7 35.69375 37.0 37.0 37.0 37.0 37.0 8 35.62125 37.0 37.0 37.0 37.0 37.0 9 35.62425 37.0 37.0 37.0 37.0 37.0 10-11 35.634875 37.0 37.0 37.0 37.0 37.0 12-13 35.6275 37.0 37.0 37.0 37.0 37.0 14-15 35.572125 37.0 37.0 37.0 37.0 37.0 16-17 35.583375000000004 37.0 37.0 37.0 37.0 37.0 18-19 35.60575 37.0 37.0 37.0 37.0 37.0 20-21 35.584875 37.0 37.0 37.0 37.0 37.0 22-23 35.520125 37.0 37.0 37.0 37.0 37.0 24-25 35.534625000000005 37.0 37.0 37.0 37.0 37.0 26-27 35.501875 37.0 37.0 37.0 37.0 37.0 28-29 35.503125 37.0 37.0 37.0 37.0 37.0 30-31 35.412499999999994 37.0 37.0 37.0 37.0 37.0 32-33 35.452625 37.0 37.0 37.0 37.0 37.0 34-35 35.4095 37.0 37.0 37.0 37.0 37.0 36-37 35.400625000000005 37.0 37.0 37.0 37.0 37.0 38-39 35.342 37.0 37.0 37.0 35.0 37.0 40-41 35.37975 37.0 37.0 37.0 37.0 37.0 42-43 35.331500000000005 37.0 37.0 37.0 33.0 37.0 44-45 35.252125 37.0 37.0 37.0 33.0 37.0 46-47 35.269625000000005 37.0 37.0 37.0 33.0 37.0 48-49 35.287 37.0 37.0 37.0 33.0 37.0 50-51 35.314 37.0 37.0 37.0 33.0 37.0 52-53 35.218 37.0 37.0 37.0 33.0 37.0 54-55 35.1625 37.0 37.0 37.0 33.0 37.0 56-57 35.184250000000006 37.0 37.0 37.0 33.0 37.0 58-59 35.212625 37.0 37.0 37.0 33.0 37.0 60-61 35.23175 37.0 37.0 37.0 33.0 37.0 62-63 35.158125 37.0 37.0 37.0 33.0 37.0 64-65 35.1025 37.0 37.0 37.0 33.0 37.0 66-67 35.027875 37.0 37.0 37.0 33.0 37.0 68-69 35.02025 37.0 37.0 37.0 33.0 37.0 70-71 35.04175 37.0 37.0 37.0 33.0 37.0 72-73 34.952875 37.0 37.0 37.0 33.0 37.0 74-75 34.877875 37.0 37.0 37.0 33.0 37.0 76-77 34.663624999999996 37.0 37.0 37.0 33.0 37.0 78-79 34.704125000000005 37.0 37.0 37.0 33.0 37.0 80-81 34.7545 37.0 37.0 37.0 33.0 37.0 82-83 34.687250000000006 37.0 37.0 37.0 33.0 37.0 84-85 34.6885 37.0 37.0 37.0 33.0 37.0 86-87 34.744875 37.0 37.0 37.0 33.0 37.0 88-89 34.457750000000004 37.0 37.0 37.0 33.0 37.0 90-91 34.070625 37.0 37.0 37.0 27.0 37.0 92-93 33.924125000000004 37.0 37.0 37.0 27.0 37.0 94-95 33.613125 37.0 37.0 37.0 27.0 37.0 96-97 33.26075 37.0 37.0 37.0 18.0 37.0 98-99 33.111875 37.0 37.0 37.0 14.0 37.0 100-101 32.710499999999996 37.0 37.0 37.0 8.0 37.0 102-103 32.289249999999996 37.0 37.0 37.0 2.0 37.0 104-105 31.897125 37.0 37.0 37.0 2.0 37.0 106-107 31.897125000000003 37.0 37.0 37.0 2.0 37.0 108-109 31.390625 37.0 37.0 37.0 2.0 37.0 110-111 31.36125 37.0 37.0 37.0 2.0 37.0 112-113 31.194875 37.0 37.0 37.0 2.0 37.0 114-115 30.82575 37.0 33.0 37.0 2.0 37.0 116-117 30.718125 37.0 33.0 37.0 2.0 37.0 118-119 30.3925 37.0 33.0 37.0 2.0 37.0 120-121 30.323 37.0 33.0 37.0 2.0 37.0 122-123 30.14425 37.0 33.0 37.0 2.0 37.0 124-125 28.4185 37.0 27.5 37.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 53.0 3 8.0 4 9.0 5 5.0 6 5.0 7 2.0 8 2.0 9 2.0 10 4.0 11 5.0 12 5.0 13 2.0 14 3.0 15 1.0 16 6.0 17 6.0 18 4.0 19 4.0 20 14.0 21 13.0 22 25.0 23 19.0 24 20.0 25 19.0 26 86.0 27 70.0 28 80.0 29 101.0 30 78.0 31 65.0 32 106.0 33 114.0 34 143.0 35 316.0 36 2605.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.025 12.975 27.1 27.900000000000002 2 27.500000000000004 12.85 23.125 36.525 3 23.7 14.524999999999999 26.474999999999998 35.3 4 25.825 13.5 25.775 34.9 5 28.599999999999998 16.525000000000002 21.8 33.074999999999996 6 28.9 19.125 27.800000000000004 24.175 7 21.2 26.700000000000003 35.325 16.775000000000002 8 18.575 27.875 33.175 20.375 9 18.925 30.875000000000004 31.424999999999997 18.775 10-11 20.825 27.437499999999996 30.2375 21.5 12-13 20.7 28.799999999999997 29.049999999999997 21.45 14-15 21.8625 27.1625 28.212500000000002 22.7625 16-17 21.637500000000003 27.6625 27.1 23.599999999999998 18-19 21.6 27.474999999999998 26.787499999999998 24.1375 20-21 22.7625 26.575 26.5875 24.075 22-23 21.5625 26.75 26.3625 25.324999999999996 24-25 21.462500000000002 27.9125 25.5375 25.087500000000002 26-27 21.7375 28.225 24.925 25.112499999999997 28-29 22.8125 26.950000000000003 23.8875 26.35 30-31 21.7 28.1875 25.912499999999998 24.2 32-33 22.9875 27.737499999999997 24.925 24.349999999999998 34-35 22.25 27.237499999999997 24.7375 25.775 36-37 22.275 27.224999999999998 25.5375 24.962500000000002 38-39 22.425 27.650000000000002 24.224999999999998 25.7 40-41 22.6875 26.487500000000004 24.3125 26.5125 42-43 22.3875 27.275 25.587500000000002 24.75 44-45 23.45 26.437500000000004 25.0375 25.074999999999996 46-47 23.3375 26.700000000000003 23.625 26.337500000000002 48-49 22.7625 28.4375 24.5 24.3 50-51 23.825 26.087500000000002 25.424999999999997 24.6625 52-53 22.8125 26.0125 25.174999999999997 26.0 54-55 22.3 27.975 25.387500000000003 24.337500000000002 56-57 22.025 26.737499999999997 26.0 25.2375 58-59 22.237499999999997 26.025 24.85 26.887499999999996 60-61 22.1875 26.474999999999998 26.85 24.4875 62-63 23.05 26.674999999999997 24.587500000000002 25.687500000000004 64-65 23.35 26.387500000000003 24.0125 26.25 66-67 21.987499999999997 28.212500000000002 25.55 24.25 68-69 23.1875 28.1375 24.337500000000002 24.337500000000002 70-71 22.2 27.450000000000003 23.5625 26.787499999999998 72-73 22.037499999999998 26.787499999999998 25.662499999999998 25.5125 74-75 23.6875 27.3 24.587500000000002 24.425 76-77 23.599999999999998 26.575 24.425 25.4 78-79 23.1375 27.0625 23.8375 25.9625 80-81 24.5625 26.787499999999998 24.675 23.974999999999998 82-83 23.674999999999997 26.437500000000004 24.099999999999998 25.7875 84-85 24.275 26.5625 24.212500000000002 24.95 86-87 25.4 25.5125 23.6375 25.45 88-89 23.731155778894472 25.967336683417088 24.522613065326635 25.778894472361806 90-91 23.959519291587604 27.6280834914611 24.060721062618594 24.3516761543327 92-93 24.28444218292838 26.154433278208877 25.111308993766695 24.449815545096044 94-95 23.70150792627916 25.969841474416803 24.474803454053358 25.853847145250676 96-97 25.142265907915156 26.4355923435075 24.806001034661147 23.61614071391619 98-99 24.343985450766432 26.370485840478047 23.655494933749026 25.630033775006495 100-101 25.06252468079505 26.168224299065418 23.706726339344478 25.06252468079505 102-103 24.714323677916557 27.079457879351583 23.305872973691205 24.90034546904066 104-105 24.2497320471597 27.505359056806 23.861200428724544 24.383708467309752 106-107 24.765604071792126 26.18537369407983 23.841414412001072 25.207607822126977 108-109 24.54037859185619 27.536429252349176 22.919787552771346 25.003404603023288 110-111 25.067750677506773 26.476964769647697 23.983739837398375 24.471544715447155 112-113 24.986286341195832 25.45255074053758 24.712013165112452 24.849149753154144 114-115 25.151598676957 26.281697905181918 24.035281146637267 24.531422271223814 116-117 24.969199178644764 26.981519507186857 24.06570841889117 23.98357289527721 118-119 26.18485059068798 25.489923558026405 23.293954134815845 25.03127171646977 120-121 24.695290858725762 27.493074792243767 24.681440443213294 23.130193905817176 122-123 24.81296758104738 27.528401219174288 24.30036021058465 23.358270989193684 124-125 25.768647456225008 26.719977940162693 24.08658486143665 23.42478974217565 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 1.5 24 1.5 25 5.0 26 7.5 27 7.0 28 10.0 29 14.5 30 17.0 31 23.5 32 30.5 33 31.5 34 41.5 35 54.0 36 65.0 37 82.5 38 96.5 39 118.0 40 142.0 41 179.0 42 203.0 43 201.0 44 199.5 45 185.5 46 181.0 47 179.5 48 181.0 49 166.0 50 156.0 51 155.0 52 123.5 53 108.0 54 96.5 55 84.0 56 83.5 57 79.0 58 65.0 59 54.0 60 55.0 61 50.0 62 45.0 63 39.0 64 33.5 65 37.5 66 35.0 67 32.0 68 32.0 69 28.0 70 24.5 71 26.5 72 27.5 73 23.5 74 19.5 75 13.5 76 11.5 77 7.5 78 6.0 79 5.5 80 3.0 81 4.5 82 3.0 83 0.5 84 0.5 85 0.5 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.5 90-91 1.1875 92-93 1.7375000000000003 94-95 3.0124999999999997 96-97 3.35 98-99 3.775 100-101 5.0375000000000005 102-103 5.925 104-105 6.7 106-107 6.675000000000001 108-109 8.2125 110-111 7.75 112-113 8.85 114-115 9.3 116-117 8.6875 118-119 10.0625 120-121 9.75 122-123 9.775 124-125 9.3375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.82951653944019 97.1 2 0.8651399491094147 1.7000000000000002 3 0.178117048346056 0.525 4 0.07633587786259542 0.3 5 0.02544529262086514 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02544529262086514 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 10 0.25 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.225 0.0 0.0 0.0 0.0 7 0.525 0.0 0.0 0.0 0.0 8 0.575 0.0 0.0 0.0 0.0 9 0.575 0.0 0.0 0.0 0.0 10-11 0.575 0.0 0.0 0.0 0.0 12-13 0.575 0.0 0.0 0.0 0.0 14-15 0.575 0.0 0.0 0.0 0.0 16-17 0.575 0.0 0.0 0.0 0.0 18-19 0.575 0.0 0.0 0.0 0.0 20-21 0.575 0.0 0.0 0.0 0.0 22-23 0.575 0.0 0.0 0.0 0.0 24-25 0.575 0.0 0.0 0.0 0.0 26-27 0.575 0.0 0.0 0.0 0.0 28-29 0.575 0.0 0.0 0.0 0.0 30-31 0.575 0.0 0.0 0.0 0.0 32-33 0.575 0.0 0.0 0.0 0.0 34-35 0.575 0.0 0.0 0.0 0.0 36-37 0.625 0.0 0.0 0.0 0.0 38-39 0.625 0.0 0.0 0.0 0.0 40-41 0.625 0.0 0.0 0.0 0.0 42-43 0.65 0.0 0.0 0.0 0.0 44-45 0.65 0.0 0.0 0.0 0.0 46-47 0.6625000000000001 0.0 0.0 0.0 0.0 48-49 0.675 0.0 0.0 0.0 0.0 50-51 0.6875 0.0 0.0 0.0 0.0 52-53 0.7375 0.0 0.0 0.0 0.0 54-55 0.7875 0.0 0.0 0.0 0.0 56-57 0.9125000000000001 0.0 0.0 0.0 0.0 58-59 1.0375 0.0 0.0 0.0 0.0 60-61 1.0875 0.0 0.0 0.0 0.0 62-63 1.15 0.0 0.0 0.0 0.0 64-65 1.2375 0.0 0.0 0.0 0.0 66-67 1.3875000000000002 0.0 0.0 0.0 0.0 68-69 1.5 0.0 0.0 0.0 0.0 70-71 1.625 0.0 0.0 0.0 0.0 72-73 1.725 0.0 0.0 0.0 0.0 74-75 1.9625 0.0 0.0 0.0 0.0 76-77 2.175 0.0 0.0 0.0 0.0 78-79 2.3875 0.0 0.0 0.0 0.0 80-81 2.6500000000000004 0.0 0.0 0.0 0.0 82-83 2.875 0.0 0.0 0.0 0.0 84-85 3.0875000000000004 0.0 0.0 0.0 0.0 86-87 3.225 0.0 0.0 0.0 0.0 88-89 3.5625 0.0 0.0 0.0 0.0 90-91 3.975 0.0 0.0 0.0 0.0 92-93 4.35 0.0 0.0 0.0 0.0 94-95 4.525 0.0 0.0 0.0 0.0 96-97 4.925 0.0 0.0 0.0 0.0 98-99 5.25 0.0 0.0 0.0 0.0 100-101 5.675000000000001 0.0 0.0 0.0 0.0 102-103 6.0875 0.0 0.0 0.0 0.0 104-105 6.574999999999999 0.0 0.0 0.0 0.0 106-107 7.175000000000001 0.0 0.0 0.0 0.0 108-109 7.6625 0.0 0.0 0.0 0.0 110-111 8.100000000000001 0.0 0.0 0.0 0.0 112-113 8.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2071326 spots for ERR3317436.sra Written 2071326 spots for ERR3317436.sra Read 2071326 spots for ERR3317436.sra Written 2071326 spots for ERR3317436.sra Read 2071326 spots for ERR3317436.sra Written 2071326 spots for ERR3317436.sra Read 2071326 spots for ERR3317436.sra Written 2071326 spots for ERR3317436.sra Read 2071326 spots for ERR3317436.sra Written 2071326 spots for ERR3317436.sra Read 2071342 spots for ERR3317436.sra Written 2071342 spots for ERR3317436.sra Read 2071326 spots for ERR3317436.sra Written 2071326 spots for ERR3317436.sra Read 2071326 spots for ERR3317436.sra Written 2071326 spots for ERR3317436.sra Read 2071326 spots for ERR3317436.sra Written 2071326 spots for ERR3317436.sra Read 2071326 spots for ERR3317436.sra Written 2071326 spots for ERR3317436.sra Read 2071326 spots for ERR3317436.sra Written 2071326 spots for ERR3317436.sra Read 2071326 spots for ERR3317436.sra Written 2071326 spots for ERR3317436.sra Read 2071326 spots for ERR3317436.sra Written 2071326 spots for ERR3317436.sra Read 2071326 spots for ERR3317436.sra Written 2071326 spots for ERR3317436.sra Read 2071326 spots for ERR3317436.sra Written 2071326 spots for ERR3317436.sra Read 2071326 spots for ERR3317436.sra Written 2071326 spots for ERR3317436.sra Read 2071326 spots for ERR3317436.sra Written 2071326 spots for ERR3317436.sra Read 2071326 spots for ERR3317436.sra Written 2071326 spots for ERR3317436.sra Read 2071326 spots for ERR3317436.sra Written 2071326 spots for ERR3317436.sra Read 2071326 spots for ERR3317436.sra Written 2071326 spots for ERR3317436.sra SRR ids: ['ERR3317436.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ybgshx67 ERR3317436.sra spots: 41426536 blocks: [[1, 2071326], [2071327, 4142652], [4142653, 6213978], [6213979, 8285304], [8285305, 10356630], [10356631, 12427956], [12427957, 14499282], [14499283, 16570608], [16570609, 18641934], [18641935, 20713260], [20713261, 22784586], [22784587, 24855912], [24855913, 26927238], [26927239, 28998564], [28998565, 31069890], [31069891, 33141216], [33141217, 35212542], [35212543, 37283868], [37283869, 39355194], [39355195, 41426536]] ERR3317436 file size 11912702 ERR3317436 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317436 ERR3317436_1.fastq ERR3317436_2.fastq Input file: ERR3317436_1.fastq Paired file: ERR3317436_2.fastq trimmed: ERR3317436-trimmed-pair1.fastq, ERR3317436-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:17:52 2024 >> started Tue Dec 10 09:18:37 2024 >> done (44.420s) 41426536 read pairs processed; of these: 546333 ( 1.32%) short read pairs filtered out after trimming by size control 504767 ( 1.22%) empty read pairs filtered out after trimming by size control 40375436 (97.46%) read pairs available; of these: 13165666 (32.61%) trimmed read pairs available after processing 27209770 (67.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 397 0.00% 19 1169 0.00% 20 1142 0.00% 21 1935 0.00% 22 1023 0.00% 23 1064 0.00% 24 867 0.00% 25 922 0.00% 26 1092 0.00% 27 1462 0.00% 28 1410 0.00% 29 1405 0.00% 30 1453 0.00% 31 2979 0.01% 32 2051 0.01% 33 2302 0.01% 34 2910 0.01% 35 3428 0.01% 36 3177 0.01% 37 3124 0.01% 38 3858 0.01% 39 4036 0.01% 40 4499 0.01% 41 4837 0.01% 42 5384 0.01% 43 5745 0.01% 44 6426 0.02% 45 7104 0.02% 46 7103 0.02% 47 8117 0.02% 48 8818 0.02% 49 9259 0.02% 50 10247 0.03% 51 10886 0.03% 52 11095 0.03% 53 12724 0.03% 54 13794 0.03% 55 14932 0.04% 56 15314 0.04% 57 16113 0.04% 58 17156 0.04% 59 18872 0.05% 60 23832 0.06% 61 21701 0.05% 62 22851 0.06% 63 23774 0.06% 64 27138 0.07% 65 27026 0.07% 66 29861 0.07% 67 31582 0.08% 68 32372 0.08% 69 35606 0.09% 70 37010 0.09% 71 48652 0.12% 72 54301 0.13% 73 58511 0.14% 74 58684 0.15% 75 57856 0.14% 76 59589 0.15% 77 61588 0.15% 78 65777 0.16% 79 65976 0.16% 80 68091 0.17% 81 67458 0.17% 82 69873 0.17% 83 73272 0.18% 84 76523 0.19% 85 81803 0.20% 86 84349 0.21% 87 86008 0.21% 88 85419 0.21% 89 96956 0.24% 90 89707 0.22% 91 89466 0.22% 92 94874 0.23% 93 92793 0.23% 94 98290 0.24% 95 101991 0.25% 96 107978 0.27% 97 106953 0.26% 98 107057 0.27% 99 112304 0.28% 100 112254 0.28% 101 123282 0.31% 102 123059 0.30% 103 125605 0.31% 104 128416 0.32% 105 134925 0.33% 106 137258 0.34% 107 142386 0.35% 108 147393 0.37% 109 162732 0.40% 110 159048 0.39% 111 166741 0.41% 112 178832 0.44% 113 181105 0.45% 114 187060 0.46% 115 197474 0.49% 116 210126 0.52% 117 224421 0.56% 118 245244 0.61% 119 277760 0.69% 120 323610 0.80% 121 399665 0.99% 122 560294 1.39% 123 1013375 2.51% 124 4617118 11.44% 125 27209770 67.39% 40375436 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=40.64 fanout-score-rank=6 prefix-density=0.39 prefix-fanout=39.8 sequence=AGATCGGAAGAGCACACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=493.24 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=18.7 sequence=CGGCGGCGGCTACGGTGGCAGCCGTGGAGGCTCCGGCGGCGGCAACTGGAGGGAGTGAATGGTGGGGCCCCTCGTGGCCAGTTATCCTTGTTACCTTTTATCTGTGATGTTATCGCTCCCGAGTATCCTAGATCTCGCTCCATCGCGTAGGGTTTGAGATGTTTAAGGGTTACCATTAGGTGTTTGTCCGTGATGCTACCTGTCGTGTGTTCCTGTTCTGTTCCGTTCGCTATCCCTATGAATGAATGAAAAA criterion=sequence-density sequence-density=1.13 sequence-density-rank=1 fanout-score=31.76 fanout-score-rank=6 prefix-density=1.15 prefix-fanout=31.3 sequence=GGTGTGCTCTTCCGATCT criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=110.27 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=15.1 sequence=GCAGCAGCAGTAATTTGACCGTATGGATCGATCTCAGGCAGGGGTAGTACAAAAAAGAGGAACACATAATATTACTTGAGCATTTCATTCAAGCTCGCTCGCACAGCAGCAACCAAATCGATGCACGATAAGATCCATGGAGCTTAGAGAGATTATGATATCATC ERR3317436 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:19:20 Started mapping on | Dec 10 09:19:20 Finished on | Dec 10 09:21:03 Mapping speed, Million of reads per hour | 1411.18 Number of input reads | 40375436 Average input read length | 240 UNIQUE READS: Uniquely mapped reads number | 35634005 Uniquely mapped reads % | 88.26% Average mapped length | 239.60 Number of splices: Total | 25019433 Number of splices: Annotated (sjdb) | 23615002 Number of splices: GT/AG | 24616206 Number of splices: GC/AG | 359832 Number of splices: AT/AC | 17309 Number of splices: Non-canonical | 26086 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.00% Deletion average length | 1.24 Insertion rate per base | 0.00% Insertion average length | 1.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 3836501 % of reads mapped to multiple loci | 9.50% Number of reads mapped to too many loci | 117183 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.55% % of reads unmapped: other | 1.40% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 961051 961051 961051 N_multimapping 3836501 3836501 3836501 N_noFeature 1560009 3873663 32568190 N_ambiguous 1185863 494733 49777 UnstrandedReadsAssigned:32888133 PositiveStrandReadsAssigned:31265609 NegativeStrandReadsAssigned:3016038 Dataset is classified positive stranded MeadianReadLen=125 20thPercentileLength=124 echo kmer=119 ERR3317436 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317436-trimmed-pair1.fastq ERR3317436-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,375,436 reads, 34,482,837 reads pseudoaligned [quant] estimated average fragment length: 226.189 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,201 rounds 52973 ERR3317436.ke.tsv 35125 ERR3317436.se.tsv 88098 total ==> ERR3317436.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 711.264 0 0 PNS24247 1044 818.811 57.3405 2.85755 PNS24249 1928 1702.81 117.683 2.8201 PNS24246 1044 818.811 57.3405 2.85755 PNS24248 1044 818.811 57.3405 2.85755 PNS24244 1471 1245.81 235.295 7.70685 PNS24243 293 115.456 2 0.706856 KQK14069 1603 1377.81 38300.7 1134.31 KQK14071 474 265.023 51.5602 7.93865 ==> ERR3317436.se.tsv <== BRADI_1g14170v3 41397 BRADI_1g53295v3 135 BRADI_1g59795v3 709 BRADI_1g07683v3 0 BRADI_1g00485v3 48 BRADI_1g20270v3 2511 BRADI_1g74790v3 543 BRADI_1g09890v3 4 BRADI_1g77505v3 461 BRADI_1g48960v3 0 ERR3317436 completed mapping pipeline successfully