Starting /dee2/code/volunteer_pipeline.sh ERR3317438 current disk space = 1525227384832 free memory = 1599111576 ERR3317438 SRAfilesize d849da46f7b5815ab6174a6aff4e077a ERR3317438.sra ERR3317438.sra file validated ERR3317438 is paired end ERR3317438 is conventional basespace ERR3317438 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317438_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.733 33.0 33.0 33.0 33.0 33.0 2 32.762 33.0 33.0 33.0 33.0 33.0 3 32.76225 33.0 33.0 33.0 33.0 33.0 4 32.789 33.0 33.0 33.0 33.0 33.0 5 32.78125 33.0 33.0 33.0 33.0 33.0 6 36.6065 37.0 37.0 37.0 37.0 37.0 7 36.6715 37.0 37.0 37.0 37.0 37.0 8 36.68075 37.0 37.0 37.0 37.0 37.0 9 36.60975 37.0 37.0 37.0 37.0 37.0 10-11 36.653875 37.0 37.0 37.0 37.0 37.0 12-13 36.70125 37.0 37.0 37.0 37.0 37.0 14-15 36.697375 37.0 37.0 37.0 37.0 37.0 16-17 36.6935 37.0 37.0 37.0 37.0 37.0 18-19 36.679874999999996 37.0 37.0 37.0 37.0 37.0 20-21 36.672124999999994 37.0 37.0 37.0 37.0 37.0 22-23 36.63475 37.0 37.0 37.0 37.0 37.0 24-25 36.628 37.0 37.0 37.0 37.0 37.0 26-27 36.607125 37.0 37.0 37.0 37.0 37.0 28-29 36.575625 37.0 37.0 37.0 37.0 37.0 30-31 36.555625000000006 37.0 37.0 37.0 37.0 37.0 32-33 36.541375 37.0 37.0 37.0 37.0 37.0 34-35 36.528 37.0 37.0 37.0 37.0 37.0 36-37 36.498999999999995 37.0 37.0 37.0 37.0 37.0 38-39 36.480625 37.0 37.0 37.0 37.0 37.0 40-41 36.287625 37.0 37.0 37.0 37.0 37.0 42-43 36.156 37.0 37.0 37.0 37.0 37.0 44-45 35.95 37.0 37.0 37.0 37.0 37.0 46-47 35.79725 37.0 37.0 37.0 37.0 37.0 48-49 35.562125 37.0 37.0 37.0 37.0 37.0 50-51 35.56125 37.0 37.0 37.0 37.0 37.0 52-53 35.63275 37.0 37.0 37.0 37.0 37.0 54-55 35.887375 37.0 37.0 37.0 37.0 37.0 56-57 35.97475 37.0 37.0 37.0 37.0 37.0 58-59 35.97625 37.0 37.0 37.0 37.0 37.0 60-61 36.156625 37.0 37.0 37.0 37.0 37.0 62-63 36.101375000000004 37.0 37.0 37.0 37.0 37.0 64-65 36.129374999999996 37.0 37.0 37.0 37.0 37.0 66-67 36.066500000000005 37.0 37.0 37.0 37.0 37.0 68-69 35.958749999999995 37.0 37.0 37.0 37.0 37.0 70-71 35.88425 37.0 37.0 37.0 37.0 37.0 72-73 35.855125 37.0 37.0 37.0 37.0 37.0 74-75 35.854875 37.0 37.0 37.0 37.0 37.0 76-77 35.686375 37.0 37.0 37.0 37.0 37.0 78-79 35.488375000000005 37.0 37.0 37.0 35.0 37.0 80-81 35.27775 37.0 37.0 37.0 33.0 37.0 82-83 34.88225 37.0 37.0 37.0 33.0 37.0 84-85 34.66675 37.0 37.0 37.0 33.0 37.0 86-87 34.689125 37.0 37.0 37.0 33.0 37.0 88-89 34.6575 37.0 37.0 37.0 33.0 37.0 90-91 34.4875 37.0 37.0 37.0 33.0 37.0 92-93 34.44125 37.0 37.0 37.0 33.0 37.0 94-95 34.415125 37.0 37.0 37.0 33.0 37.0 96-97 34.299499999999995 37.0 37.0 37.0 33.0 37.0 98-99 34.27825 37.0 37.0 37.0 33.0 37.0 100-101 34.133125 37.0 37.0 37.0 27.0 37.0 102-103 33.970875 37.0 37.0 37.0 27.0 37.0 104-105 33.988625 37.0 37.0 37.0 27.0 37.0 106-107 33.908125 37.0 37.0 37.0 27.0 37.0 108-109 33.7455 37.0 37.0 37.0 27.0 37.0 110-111 33.701499999999996 37.0 37.0 37.0 27.0 37.0 112-113 33.4685 37.0 37.0 37.0 22.0 37.0 114-115 33.21 37.0 37.0 37.0 22.0 37.0 116-117 33.126875 37.0 37.0 37.0 18.0 37.0 118-119 32.974875 37.0 37.0 37.0 14.0 37.0 120-121 32.7025 37.0 37.0 37.0 14.0 37.0 122-123 32.334500000000006 37.0 35.0 37.0 14.0 37.0 124-125 30.126625 37.0 30.0 37.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 7.0 8 4.0 9 3.0 10 6.0 11 2.0 12 3.0 13 3.0 14 1.0 15 5.0 16 1.0 17 7.0 18 6.0 19 7.0 20 9.0 21 13.0 22 19.0 23 41.0 24 60.0 25 14.0 26 11.0 27 14.0 28 17.0 29 35.0 30 43.0 31 53.0 32 66.0 33 89.0 34 154.0 35 385.0 36 2921.0 >>END_MODULE >>Per base sequence content pass #Base G A T C 1 26.3013013013013 24.824824824824827 19.96996996996997 28.903903903903906 2 25.324999999999996 22.1 18.775 33.800000000000004 3 23.325000000000003 23.75 22.525000000000002 30.4 4 24.95 22.475 21.275 31.3 5 28.499999999999996 22.425 18.75 30.325000000000003 6 29.775000000000002 23.825 21.15 25.25 7 23.799999999999997 25.674999999999997 26.974999999999998 23.549999999999997 8 25.45 25.1 29.25 20.200000000000003 9 25.525 28.575 27.474999999999998 18.425 10-11 24.825 27.0875 26.937499999999996 21.15 12-13 24.2625 26.525 27.575 21.637500000000003 14-15 23.875 27.200000000000003 26.674999999999997 22.25 16-17 25.05 25.174999999999997 25.4625 24.3125 18-19 24.6125 24.887500000000003 26.087500000000002 24.4125 20-21 23.200000000000003 25.2375 26.200000000000003 25.362499999999997 22-23 23.849999999999998 25.374999999999996 25.5125 25.2625 24-25 24.9125 24.0375 27.3125 23.7375 26-27 23.6375 24.375 26.625 25.362499999999997 28-29 25.7375 24.1125 25.5125 24.637500000000003 30-31 24.1125 25.275 26.375 24.2375 32-33 24.1125 23.425 26.55 25.912499999999998 34-35 25.0125 23.9125 25.4375 25.637500000000003 36-37 23.8625 24.375 26.6 25.162499999999998 38-39 23.8625 25.7875 25.3125 25.0375 40-41 24.746526473901614 23.632494680185253 25.785455000625863 25.835523845287273 42-43 24.443885886640693 24.469020987809476 26.71861254241548 24.368480583134346 44-45 24.12834765032845 25.012632642748862 25.5811015664477 25.277918140474988 46-47 25.835866261398177 23.872847011144884 25.3419452887538 24.94934143870314 48-49 23.359146883331217 24.946045448774914 26.55833439126571 25.13647327662816 50-51 25.43323139653415 23.8914373088685 25.891946992864423 24.783384301732923 52-53 26.211369706219003 24.01119165712832 25.626351265420322 24.151087371232354 54-55 24.36784501195119 24.858472763869667 27.09774814442068 23.67593407975846 56-57 25.647147524503644 23.523498366423727 26.388539834129176 24.440814274943452 58-59 24.893350062735255 23.651191969887076 25.809284818067752 25.646173149309913 60-61 25.162499999999998 24.025 26.375 24.4375 62-63 24.675 23.8375 26.7625 24.725 64-65 24.212500000000002 24.3625 26.1 25.324999999999996 66-67 25.0 24.2625 26.3625 24.375 68-69 24.45 25.0625 26.450000000000003 24.0375 70-71 25.2 25.5625 25.25 23.9875 72-73 24.55 26.125 25.15 24.175 74-75 24.9375 26.724999999999998 24.6 23.7375 76-77 25.025 27.075 24.4 23.5 78-79 23.7375 27.762500000000003 25.3 23.200000000000003 80-81 24.325 26.637499999999996 24.4 24.637500000000003 82-83 24.15 27.375 24.775 23.7 84-85 24.6 27.1125 24.75 23.5375 86-87 23.6375 27.037499999999998 24.65 24.675 88-89 25.662499999999998 25.775 24.6875 23.875 90-91 24.125 27.400000000000002 24.8 23.674999999999997 92-93 24.025 26.25 24.8625 24.8625 94-95 24.95 26.0 24.1375 24.9125 96-97 23.775 26.174999999999997 25.7125 24.337500000000002 98-99 23.95 25.4375 24.962500000000002 25.650000000000002 100-101 24.875 25.8 24.75 24.575 102-103 24.05 26.200000000000003 25.575 24.175 104-105 23.425 26.2625 24.4875 25.825 106-107 24.2875 27.1375 24.3875 24.1875 108-109 24.3625 27.200000000000003 24.85 23.5875 110-111 23.175 28.3625 24.025 24.4375 112-113 24.525 27.825 23.6875 23.962500000000002 114-115 24.4125 28.725 23.5375 23.325000000000003 116-117 24.5375 28.275 22.8375 24.349999999999998 118-119 23.724999999999998 28.475 23.8875 23.9125 120-121 23.4375 29.325000000000003 22.95 24.2875 122-123 24.27695004382121 28.68411168148241 23.31288343558282 23.72605483911356 124-125 24.23028785982478 28.46057571964956 22.941176470588236 24.367959949937422 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 6.0 2 6.0 3 3.5 4 5.0 5 3.0 6 2.0 7 2.5 8 1.5 9 1.0 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 2.0 23 2.0 24 2.5 25 3.0 26 5.0 27 7.5 28 9.5 29 13.5 30 15.5 31 16.5 32 22.5 33 23.5 34 27.5 35 40.0 36 49.0 37 67.0 38 93.5 39 106.0 40 122.0 41 154.0 42 172.0 43 172.0 44 170.0 45 178.0 46 169.5 47 161.0 48 175.0 49 160.5 50 149.0 51 156.0 52 135.5 53 129.5 54 120.0 55 92.0 56 85.0 57 79.5 58 73.5 59 60.5 60 61.5 61 60.5 62 53.0 63 61.5 64 59.5 65 48.5 66 52.0 67 51.0 68 39.5 69 43.0 70 41.0 71 35.5 72 32.5 73 26.0 74 21.5 75 16.5 76 12.0 77 10.5 78 10.0 79 5.0 80 0.5 81 1.5 82 1.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.13749999999999998 42-43 0.5375 44-45 1.05 46-47 1.3 48-49 1.5375 50-51 1.9 52-53 1.7125000000000001 54-55 0.6375 56-57 0.525 58-59 0.375 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.1625 124-125 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.375 #Duplication Level Percentage of deduplicated Percentage of total 1 98.04878048780488 95.475 2 1.6174582798459562 3.15 3 0.1540436456996149 0.44999999999999996 4 0.10269576379974327 0.4 5 0.051347881899871634 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025673940949935817 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATG 11 0.27499999999999997 TruSeq Adapter, Index 1 (100% over 49bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit ATTTGAAGAGGGTTCCGTTACTAACATGTTTACTTCCATTGTAGGTAACG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.3 0.0 0.0 0.0 0.0 2 0.325 0.0 0.0 0.0 0.0 3 0.35 0.0 0.0 0.0 0.0 4 0.5 0.0 0.0 0.0 0.0 5 0.775 0.0 0.0 0.0 0.0 6 1.275 0.0 0.0 0.0 0.0 7 2.55 0.0 0.0 0.0 0.0 8 3.25 0.0 0.0 0.0 0.0 9 3.4 0.0 0.0 0.0 0.0 10-11 3.4 0.0 0.0 0.0 0.0 12-13 3.4375 0.0 0.0 0.0 0.0 14-15 3.45 0.0 0.0 0.0 0.0 16-17 3.475 0.0 0.0 0.0 0.0 18-19 3.5 0.0 0.0 0.0 0.0 20-21 3.525 0.0 0.0 0.0 0.0 22-23 3.575 0.0 0.0 0.0 0.0 24-25 3.6 0.0 0.0 0.0 0.0 26-27 3.65 0.0 0.0 0.0 0.0 28-29 3.675 0.0 0.0 0.0 0.0 30-31 3.7375 0.0 0.0 0.0 0.0 32-33 3.775 0.0 0.0 0.0 0.0 34-35 3.7874999999999996 0.0 0.0 0.0 0.0 36-37 3.9375 0.0 0.0 0.0 0.0 38-39 3.95 0.0 0.0 0.0 0.0 40-41 4.0 0.0 0.0 0.0 0.0 42-43 4.0375 0.0 0.0 0.0 0.0 44-45 4.1 0.0 0.0 0.0 0.0 46-47 4.1875 0.0 0.0 0.0 0.0 48-49 4.25 0.0 0.0 0.0 0.0 50-51 4.324999999999999 0.0 0.0 0.0 0.0 52-53 4.4375 0.0 0.0 0.0 0.0 54-55 4.5 0.0 0.0 0.0 0.0 56-57 4.7125 0.0 0.0 0.0 0.0 58-59 4.8875 0.0 0.0 0.0 0.0 60-61 5.075 0.0 0.0 0.0 0.0 62-63 5.2125 0.0 0.0 0.0 0.0 64-65 5.4375 0.0 0.0 0.0 0.0 66-67 5.5875 0.0 0.0 0.0 0.0 68-69 5.7875 0.0 0.0 0.0 0.0 70-71 6.025 0.0 0.0 0.0 0.0 72-73 6.2 0.0 0.0 0.0 0.0 74-75 6.35 0.0 0.0 0.0 0.0 76-77 6.5375 0.0 0.0 0.0 0.0 78-79 6.8125 0.0 0.0 0.0 0.0 80-81 7.074999999999999 0.0 0.0 0.0 0.0 82-83 7.3 0.0 0.0 0.0 0.0 84-85 7.525 0.0 0.0 0.0 0.0 86-87 7.737500000000001 0.0 0.0 0.0 0.0 88-89 7.975 0.0 0.0 0.0 0.0 90-91 8.274999999999999 0.0 0.0 0.0 0.0 92-93 8.5625 0.0 0.0 0.0 0.0 94-95 8.8875 0.0 0.0 0.0 0.0 96-97 9.3375 0.0 0.0 0.0 0.0 98-99 9.6625 0.0 0.0 0.0 0.0 100-101 10.037500000000001 0.0 0.0 0.0 0.0 102-103 10.350000000000001 0.0 0.0 0.0 0.0 104-105 10.7875 0.0 0.0 0.0 0.0 106-107 11.375 0.0 0.0 0.0 0.0 108-109 11.8875 0.0 0.0 0.0 0.0 110-111 12.5375 0.0 0.0 0.0 0.0 112-113 13.274999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 445 0.0069345706 6.6678367 116-117 >>END_MODULE ERR3317438 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317438_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.47625 33.0 33.0 33.0 33.0 33.0 2 32.49175 33.0 33.0 33.0 33.0 33.0 3 32.4515 33.0 33.0 33.0 33.0 33.0 4 32.4695 33.0 33.0 33.0 33.0 33.0 5 32.42375 33.0 33.0 33.0 33.0 33.0 6 36.30675 37.0 37.0 37.0 37.0 37.0 7 36.28375 37.0 37.0 37.0 37.0 37.0 8 36.28125 37.0 37.0 37.0 37.0 37.0 9 36.2275 37.0 37.0 37.0 37.0 37.0 10-11 36.25675 37.0 37.0 37.0 37.0 37.0 12-13 36.27225 37.0 37.0 37.0 37.0 37.0 14-15 36.20275 37.0 37.0 37.0 37.0 37.0 16-17 36.256625 37.0 37.0 37.0 37.0 37.0 18-19 36.222125 37.0 37.0 37.0 37.0 37.0 20-21 36.240125 37.0 37.0 37.0 37.0 37.0 22-23 36.227374999999995 37.0 37.0 37.0 37.0 37.0 24-25 36.237624999999994 37.0 37.0 37.0 37.0 37.0 26-27 36.216499999999996 37.0 37.0 37.0 37.0 37.0 28-29 36.26375 37.0 37.0 37.0 37.0 37.0 30-31 36.266999999999996 37.0 37.0 37.0 37.0 37.0 32-33 36.2585 37.0 37.0 37.0 37.0 37.0 34-35 36.259125 37.0 37.0 37.0 37.0 37.0 36-37 36.258375 37.0 37.0 37.0 37.0 37.0 38-39 36.244125 37.0 37.0 37.0 37.0 37.0 40-41 36.209875 37.0 37.0 37.0 37.0 37.0 42-43 36.252375 37.0 37.0 37.0 37.0 37.0 44-45 36.246375 37.0 37.0 37.0 37.0 37.0 46-47 36.257 37.0 37.0 37.0 37.0 37.0 48-49 36.22825 37.0 37.0 37.0 37.0 37.0 50-51 36.191625 37.0 37.0 37.0 37.0 37.0 52-53 36.200375 37.0 37.0 37.0 37.0 37.0 54-55 36.136625 37.0 37.0 37.0 37.0 37.0 56-57 36.03625 37.0 37.0 37.0 37.0 37.0 58-59 35.91475 37.0 37.0 37.0 37.0 37.0 60-61 35.97325 37.0 37.0 37.0 37.0 37.0 62-63 35.954499999999996 37.0 37.0 37.0 37.0 37.0 64-65 36.05575 37.0 37.0 37.0 37.0 37.0 66-67 36.106375 37.0 37.0 37.0 37.0 37.0 68-69 36.052499999999995 37.0 37.0 37.0 37.0 37.0 70-71 35.99325 37.0 37.0 37.0 37.0 37.0 72-73 35.90075 37.0 37.0 37.0 37.0 37.0 74-75 35.417875 37.0 37.0 37.0 37.0 37.0 76-77 34.937875 37.0 37.0 37.0 37.0 37.0 78-79 34.860875 37.0 37.0 37.0 37.0 37.0 80-81 34.813625 37.0 37.0 37.0 37.0 37.0 82-83 34.847375 37.0 37.0 37.0 37.0 37.0 84-85 34.77775 37.0 37.0 37.0 37.0 37.0 86-87 34.7085 37.0 37.0 37.0 35.0 37.0 88-89 34.643625 37.0 37.0 37.0 35.0 37.0 90-91 34.70275 37.0 37.0 37.0 35.0 37.0 92-93 34.612875 37.0 37.0 37.0 33.0 37.0 94-95 34.57425 37.0 37.0 37.0 33.0 37.0 96-97 34.583 37.0 37.0 37.0 33.0 37.0 98-99 34.581 37.0 37.0 37.0 33.0 37.0 100-101 34.495374999999996 37.0 37.0 37.0 33.0 37.0 102-103 34.5395 37.0 37.0 37.0 33.0 37.0 104-105 34.48975 37.0 37.0 37.0 33.0 37.0 106-107 34.408500000000004 37.0 37.0 37.0 33.0 37.0 108-109 34.411 37.0 37.0 37.0 33.0 37.0 110-111 34.324375 37.0 37.0 37.0 33.0 37.0 112-113 34.252875 37.0 37.0 37.0 33.0 37.0 114-115 34.20975 37.0 37.0 37.0 33.0 37.0 116-117 34.13975 37.0 37.0 37.0 33.0 37.0 118-119 34.00812500000001 37.0 37.0 37.0 30.0 37.0 120-121 34.017375 37.0 37.0 37.0 33.0 37.0 122-123 33.969875 37.0 37.0 37.0 33.0 37.0 124-125 32.486875 37.0 35.0 37.0 17.5 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 24.0 3 6.0 4 2.0 5 3.0 6 0.0 7 1.0 8 2.0 9 1.0 10 0.0 11 2.0 12 0.0 13 1.0 14 2.0 15 4.0 16 2.0 17 3.0 18 2.0 19 2.0 20 18.0 21 16.0 22 109.0 23 12.0 24 12.0 25 15.0 26 17.0 27 16.0 28 14.0 29 17.0 30 17.0 31 25.0 32 37.0 33 38.0 34 87.0 35 183.0 36 3310.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.549999999999997 16.2 23.65 30.599999999999998 2 28.9 14.625 23.375 33.1 3 25.287643821910955 15.232616308154077 24.81240620310155 34.667333666833414 4 27.459324155193993 13.141426783479348 24.705882352941178 34.69336670838548 5 31.66458072590738 15.619524405506885 20.500625782227786 32.21526908635794 6 35.1188986232791 16.871088861076345 26.80851063829787 21.201501877346686 7 28.825444527923867 26.59654395191585 29.201101928374655 15.376909591785626 8 18.598247809762203 27.133917396745932 36.9712140175219 17.296620775969963 9 27.662240040090204 29.942370333249812 26.55975945878226 15.835630167877726 10-11 24.111166750125186 25.876314471707563 30.84626940410616 19.166249374061092 12-13 20.876095118898625 25.131414267834796 29.624530663329164 24.367959949937422 14-15 19.679519278918377 26.81522283425138 29.394091136705057 24.111166750125186 16-17 20.135236664162285 25.732531930879038 27.38542449286251 26.746806912096165 18-19 25.58838257386079 25.463194792188283 23.585378067100653 25.363044566850274 20-21 20.906359539308962 29.018527791687532 28.743114672008012 21.331997996995494 22-23 21.496496496496498 24.01151151151151 27.5025025025025 26.989489489489486 24-25 22.92866082603254 26.7459324155194 26.971214017521906 23.35419274092616 26-27 23.736236236236234 26.614114114114113 24.71221221221221 24.93743743743744 28-29 26.93846923461731 26.038019009504755 22.911455727863935 24.112056028014006 30-31 23.50881580592722 28.260597724146553 25.659622358384393 22.570964111541826 32-33 24.193548387096776 28.557139284821204 25.506376594148538 21.742935733933482 34-35 24.15603900975244 26.36909227306827 24.01850462615654 25.456364091022753 36-37 23.090386298287285 26.328291036379547 27.015876984623077 23.56544568071009 38-39 22.675 27.05 26.7125 23.5625 40-41 24.075 26.987499999999997 23.5125 25.424999999999997 42-43 23.8375 27.200000000000003 25.025 23.9375 44-45 22.775000000000002 26.275 25.474999999999998 25.474999999999998 46-47 24.337500000000002 25.7375 23.8125 26.1125 48-49 24.75 26.1625 25.25 23.8375 50-51 24.8125 25.45 25.85 23.8875 52-53 24.65 25.662499999999998 24.775 24.9125 54-55 22.792736380713837 26.787726988102694 25.14715090795241 25.272385723231057 56-57 23.933768188660313 25.95333667837431 24.912192674360263 25.200702458605118 58-59 23.526448362720405 26.272040302267 25.201511335012594 25.0 60-61 22.382989431303475 27.34021137393055 26.459486663311527 23.817312531454455 62-63 21.91194968553459 27.911949685534594 25.22012578616352 24.955974842767294 64-65 23.336668334167083 28.12656328164082 23.74937468734367 24.787393696848426 66-67 22.532215688727636 29.888652570999625 24.634054797948206 22.945076942324533 68-69 23.025000000000002 29.812499999999996 23.2875 23.875 70-71 22.475 28.9125 22.6 26.0125 72-73 23.275000000000002 30.2375 22.787499999999998 23.7 74-75 22.8125 29.725 22.912499999999998 24.55 76-77 23.51175587793897 28.714357178589296 23.724362181090545 24.049524762381193 78-79 23.26454033771107 29.593495934959353 23.2520325203252 23.889931207004377 80-81 22.853566958698373 28.936170212765955 24.06758448060075 24.14267834793492 82-83 23.748122183274912 27.891837756634953 23.798197295943915 24.56184276414622 84-85 23.829201101928373 28.625093914350114 23.516153268219384 24.02955171550213 86-87 25.93937875751503 27.70541082164329 23.371743486973948 22.983466933867735 88-89 23.7468671679198 27.957393483709275 23.759398496240603 24.536340852130326 90-91 24.34259954921112 28.524918607563237 23.37841222138743 23.754069621838216 92-93 23.60606440295702 28.07918807167022 24.82145094599674 23.49329657937602 94-95 24.855997996493866 27.372902579514154 23.077886301026798 24.693213122965187 96-97 25.250501002004004 28.2064128256513 23.334168336673347 23.208917835671343 98-99 24.705882352941178 27.40926157697122 23.817271589486857 24.06758448060075 100-101 24.887330996494743 27.516274411617424 23.272408612919378 24.32398597896845 102-103 25.18147684605757 28.147684605757195 23.46683354192741 23.204005006257823 104-105 24.618272841051315 27.709637046307883 24.005006257822277 23.667083854818525 106-107 24.243182386790092 27.845884413309985 23.29246935201401 24.618463847885916 108-109 24.674837418709355 27.688844422211105 23.56178089044522 24.074537268634316 110-111 25.519139354515886 28.32124093069802 23.30497873405054 22.854640980735553 112-113 25.900450225112557 27.51375687843922 22.836418209104554 23.74937468734367 114-115 25.218804701175294 27.906976744186046 23.118279569892472 23.755938984746187 116-117 25.03125781445361 27.04426106526632 23.280820205051263 24.643660915228807 118-119 26.540817602200274 27.753469183647955 21.990248781097637 23.71546443305413 120-121 24.8125 27.737499999999997 24.8125 22.6375 122-123 25.374999999999996 27.962500000000002 23.3125 23.35 124-125 25.337500000000002 26.8375 23.225 24.6 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 8.0 1 4.0 2 1.0 3 2.5 4 2.0 5 2.0 6 1.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.5 20 1.5 21 1.0 22 1.5 23 1.5 24 2.0 25 6.0 26 9.0 27 8.0 28 9.5 29 11.5 30 9.5 31 14.0 32 24.5 33 34.5 34 47.5 35 50.5 36 63.5 37 85.5 38 104.0 39 120.0 40 140.5 41 175.0 42 173.0 43 168.5 44 184.0 45 180.0 46 183.5 47 190.5 48 179.5 49 156.0 50 139.5 51 136.0 52 133.0 53 123.0 54 108.5 55 97.0 56 96.0 57 96.0 58 75.0 59 60.0 60 57.5 61 50.5 62 50.5 63 42.5 64 45.5 65 50.0 66 36.5 67 31.0 68 30.5 69 30.0 70 22.0 71 15.5 72 19.5 73 21.0 74 15.0 75 12.5 76 12.0 77 11.0 78 8.5 79 6.0 80 5.0 81 3.0 82 2.5 83 1.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.05 4 0.125 5 0.125 6 0.125 7 0.17500000000000002 8 0.125 9 0.22499999999999998 10-11 0.15 12-13 0.125 14-15 0.15 16-17 0.17500000000000002 18-19 0.15 20-21 0.15 22-23 0.1 24-25 0.125 26-27 0.1 28-29 0.05 30-31 0.0375 32-33 0.025 34-35 0.025 36-37 0.0125 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.1875 56-57 0.35000000000000003 58-59 0.75 60-61 0.65 62-63 0.625 64-65 0.05 66-67 0.08750000000000001 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.05 78-79 0.0625 80-81 0.125 82-83 0.15 84-85 0.17500000000000002 86-87 0.2 88-89 0.25 90-91 0.17500000000000002 92-93 0.2375 94-95 0.17500000000000002 96-97 0.2 98-99 0.125 100-101 0.15 102-103 0.125 104-105 0.125 106-107 0.075 108-109 0.05 110-111 0.075 112-113 0.05 114-115 0.025 116-117 0.025 118-119 0.0125 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.15 #Duplication Level Percentage of deduplicated Percentage of total 1 98.87926642893531 97.05 2 0.891492613346918 1.7500000000000002 3 0.1273560876209883 0.375 4 0.0 0.0 5 0.05094243504839531 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05094243504839531 0.575 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCC 12 0.3 Illumina Single End PCR Primer 1 (100% over 50bp) AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 11 0.27499999999999997 No Hit TCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 5 0.125 No Hit TTGGGGATGATTCTGTATTACAATTTGGTGGAGGAACTTTAGGACATCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.3 0.0 0.0 0.0 0.0 2 0.325 0.0 0.0 0.0 0.0 3 0.35 0.0 0.0 0.0 0.0 4 0.5 0.0 0.0 0.0 0.0 5 0.775 0.0 0.0 0.0 0.0 6 1.275 0.0 0.0 0.0 0.0 7 2.575 0.0 0.0 0.0 0.0 8 3.325 0.0 0.0 0.0 0.0 9 3.475 0.0 0.0 0.0 0.0 10-11 3.475 0.0 0.0 0.0 0.0 12-13 3.5125 0.0 0.0 0.0 0.0 14-15 3.525 0.0 0.0 0.0 0.0 16-17 3.55 0.0 0.0 0.0 0.0 18-19 3.575 0.0 0.0 0.0 0.0 20-21 3.6 0.0 0.0 0.0 0.0 22-23 3.65 0.0 0.0 0.0 0.0 24-25 3.675 0.0 0.0 0.0 0.0 26-27 3.7125000000000004 0.0 0.0 0.0 0.0 28-29 3.75 0.0 0.0 0.0 0.0 30-31 3.8125 0.0 0.0 0.0 0.0 32-33 3.85 0.0 0.0 0.0 0.0 34-35 3.8625 0.0 0.0 0.0 0.0 36-37 3.9875 0.0 0.0 0.0 0.0 38-39 4.0 0.0 0.0 0.0 0.0 40-41 4.050000000000001 0.0 0.0 0.0 0.0 42-43 4.075 0.0 0.0 0.0 0.0 44-45 4.15 0.0 0.0 0.0 0.0 46-47 4.2125 0.0 0.0 0.0 0.0 48-49 4.2625 0.0 0.0 0.0 0.0 50-51 4.3125 0.0 0.0 0.0 0.0 52-53 4.375 0.0 0.0 0.0 0.0 54-55 4.425000000000001 0.0 0.0 0.0 0.0 56-57 4.5 0.0 0.0 0.0 0.0 58-59 4.6875 0.0 0.0 0.0 0.0 60-61 4.824999999999999 0.0 0.0 0.0 0.0 62-63 4.9125 0.0 0.0 0.0 0.0 64-65 5.0625 0.0 0.0 0.0 0.0 66-67 5.125 0.0 0.0 0.0 0.0 68-69 5.2875 0.0 0.0 0.0 0.0 70-71 5.525 0.0 0.0 0.0 0.0 72-73 5.6875 0.0 0.0 0.0 0.0 74-75 5.85 0.0 0.0 0.0 0.0 76-77 6.0875 0.0 0.0 0.0 0.0 78-79 6.3625 0.0 0.0 0.0 0.0 80-81 6.6125 0.0 0.0 0.0 0.0 82-83 6.85 0.0 0.0 0.0 0.0 84-85 7.075 0.0 0.0 0.0 0.0 86-87 7.325 0.0 0.0 0.0 0.0 88-89 7.6 0.0 0.0 0.0 0.0 90-91 7.9875 0.0 0.0 0.0 0.0 92-93 8.2875 0.0 0.0 0.0 0.0 94-95 8.5375 0.0 0.0 0.0 0.0 96-97 8.9625 0.0 0.0 0.0 0.0 98-99 9.225000000000001 0.0 0.0 0.0 0.0 100-101 9.575 0.0 0.0 0.0 0.0 102-103 9.9125 0.0 0.0 0.0 0.0 104-105 10.3125 0.0 0.0 0.0 0.0 106-107 10.8625 0.0 0.0 0.0 0.0 108-109 11.325 0.0 0.0 0.0 0.0 110-111 11.875 0.0 0.0 0.0 0.0 112-113 12.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGCTCT 45 3.310257E-6 66.11111 9 GTGTGCT 45 2.80371E-4 52.888885 7 TGTGCTC 45 2.80371E-4 52.888885 8 GAGATCG 35 0.007243562 51.0 7 TCTTCCG 45 4.543039E-6 39.666664 12-13 TTCCGAT 50 9.365898E-6 35.7 14-15 CCGATCT 50 9.365898E-6 35.7 16-17 TGCTCTT 45 2.1882859E-4 33.055553 10-11 CTTCCGA 45 2.1882859E-4 33.055553 14-15 GCTCTTC 55 1.7996972E-5 32.454544 10-11 TCCGATC 50 4.0610554E-4 29.75 16-17 CTCTTCC 55 7.095549E-4 27.045454 12-13 >>END_MODULE Read 946276 spots for ERR3317438.sra Written 946276 spots for ERR3317438.sra Read 946276 spots for ERR3317438.sra Written 946276 spots for ERR3317438.sra Read 946276 spots for ERR3317438.sra Written 946276 spots for ERR3317438.sra Read 946276 spots for ERR3317438.sra Written 946276 spots for ERR3317438.sra Read 946276 spots for ERR3317438.sra Written 946276 spots for ERR3317438.sra Read 946276 spots for ERR3317438.sra Written 946276 spots for ERR3317438.sra Read 946276 spots for ERR3317438.sra Written 946276 spots for ERR3317438.sra Read 946276 spots for ERR3317438.sra Written 946276 spots for ERR3317438.sra Read 946276 spots for ERR3317438.sra Written 946276 spots for ERR3317438.sra Read 946276 spots for ERR3317438.sra Written 946276 spots for ERR3317438.sra Read 946276 spots for ERR3317438.sra Written 946276 spots for ERR3317438.sra Read 946288 spots for ERR3317438.sra Written 946288 spots for ERR3317438.sra Read 946276 spots for ERR3317438.sra Written 946276 spots for ERR3317438.sra Read 946276 spots for ERR3317438.sra Written 946276 spots for ERR3317438.sra Read 946276 spots for ERR3317438.sra Written 946276 spots for ERR3317438.sra Read 946276 spots for ERR3317438.sra Written 946276 spots for ERR3317438.sra Read 946276 spots for ERR3317438.sra Written 946276 spots for ERR3317438.sra Read 946276 spots for ERR3317438.sra Written 946276 spots for ERR3317438.sra Read 946276 spots for ERR3317438.sra Written 946276 spots for ERR3317438.sra Read 946276 spots for ERR3317438.sra Written 946276 spots for ERR3317438.sra SRR ids: ['ERR3317438.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u9b1rnc7 ERR3317438.sra spots: 18925532 blocks: [[1, 946276], [946277, 1892552], [1892553, 2838828], [2838829, 3785104], [3785105, 4731380], [4731381, 5677656], [5677657, 6623932], [6623933, 7570208], [7570209, 8516484], [8516485, 9462760], [9462761, 10409036], [10409037, 11355312], [11355313, 12301588], [12301589, 13247864], [13247865, 14194140], [14194141, 15140416], [15140417, 16086692], [16086693, 17032968], [17032969, 17979244], [17979245, 18925532]] ERR3317438 file size 5430479 ERR3317438 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317438 ERR3317438_1.fastq ERR3317438_2.fastq Input file: ERR3317438_1.fastq Paired file: ERR3317438_2.fastq trimmed: ERR3317438-trimmed-pair1.fastq, ERR3317438-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:16:44 2024 >> started Tue Dec 10 09:17:03 2024 >> done (19.070s) 18925532 read pairs processed; of these: 641576 ( 3.39%) short read pairs filtered out after trimming by size control 157980 ( 0.83%) empty read pairs filtered out after trimming by size control 18125976 (95.78%) read pairs available; of these: 6455997 (35.62%) trimmed read pairs available after processing 11669979 (64.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1795 0.01% 19 7425 0.04% 20 9262 0.05% 21 15686 0.09% 22 4916 0.03% 23 4442 0.02% 24 1998 0.01% 25 2256 0.01% 26 2603 0.01% 27 3136 0.02% 28 3025 0.02% 29 2541 0.01% 30 1962 0.01% 31 2913 0.02% 32 2457 0.01% 33 2918 0.02% 34 4423 0.02% 35 10072 0.06% 36 3653 0.02% 37 3264 0.02% 38 3789 0.02% 39 4665 0.03% 40 4833 0.03% 41 4707 0.03% 42 5362 0.03% 43 6381 0.04% 44 7798 0.04% 45 6705 0.04% 46 6874 0.04% 47 6817 0.04% 48 6948 0.04% 49 7377 0.04% 50 8026 0.04% 51 7904 0.04% 52 8114 0.04% 53 8859 0.05% 54 9490 0.05% 55 9733 0.05% 56 10120 0.06% 57 10872 0.06% 58 10858 0.06% 59 11560 0.06% 60 13479 0.07% 61 13212 0.07% 62 13837 0.08% 63 14464 0.08% 64 16643 0.09% 65 14763 0.08% 66 16418 0.09% 67 17097 0.09% 68 17051 0.09% 69 18199 0.10% 70 18370 0.10% 71 21406 0.12% 72 23520 0.13% 73 27251 0.15% 74 27093 0.15% 75 27064 0.15% 76 27418 0.15% 77 28445 0.16% 78 28757 0.16% 79 28821 0.16% 80 30202 0.17% 81 29650 0.16% 82 29567 0.16% 83 31148 0.17% 84 31176 0.17% 85 33884 0.19% 86 35275 0.19% 87 35531 0.20% 88 36833 0.20% 89 41062 0.23% 90 37501 0.21% 91 36863 0.20% 92 37643 0.21% 93 37561 0.21% 94 38819 0.21% 95 40428 0.22% 96 44034 0.24% 97 44202 0.24% 98 46130 0.25% 99 48300 0.27% 100 49964 0.28% 101 50633 0.28% 102 48333 0.27% 103 48561 0.27% 104 49482 0.27% 105 52229 0.29% 106 56997 0.31% 107 54654 0.30% 108 54427 0.30% 109 56621 0.31% 110 58249 0.32% 111 60487 0.33% 112 65770 0.36% 113 65691 0.36% 114 68880 0.38% 115 74250 0.41% 116 77684 0.43% 117 84958 0.47% 118 93079 0.51% 119 108373 0.60% 120 129782 0.72% 121 167100 0.92% 122 240998 1.33% 123 471977 2.60% 124 2749162 15.17% 125 11669979 64.38% 18125976 reads passed initial QC criterion=sequence-density sequence-density=1.90 sequence-density-rank=1 fanout-score=59.49 fanout-score-rank=1 prefix-density=2.10 prefix-fanout=53.7 sequence=AGATCGGAAGAGCACACC criterion=fanout-score sequence-density=1.90 sequence-density-rank=1 fanout-score=59.49 fanout-score-rank=1 prefix-density=2.10 prefix-fanout=53.7 sequence=AGATCGGAAGAGCACACC criterion=sequence-density sequence-density=9.25 sequence-density-rank=1 fanout-score=35.90 fanout-score-rank=4 prefix-density=9.42 prefix-fanout=35.3 sequence=GGTGTGCTCTTCCGATCT criterion=fanout-score sequence-density=0.75 sequence-density-rank=18 fanout-score=46.68 fanout-score-rank=1 prefix-density=0.76 prefix-fanout=46.6 sequence=CCGTGTGCTCTTC Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACC -y GGTGTGCTCTTCCGATCT -o ERR3317438 ERR3317438_1.fastq ERR3317438_2.fastq Input file: ERR3317438_1.fastq Paired file: ERR3317438_2.fastq trimmed: ERR3317438-trimmed-pair1.fastq, ERR3317438-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACC -- paired 3' end adapter sequence (-y): GGTGTGCTCTTCCGATCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:19:23 2024 >> started Tue Dec 10 09:19:34 2024 >> done (11.097s) 12083984 read pairs processed; of these: 3638 ( 0.03%) short read pairs filtered out after trimming by size control 2032 ( 0.02%) empty read pairs filtered out after trimming by size control 12078314 (99.95%) read pairs available; of these: 3128 ( 0.03%) trimmed read pairs available after processing 12075186 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1233 0.01% 19 4963 0.04% 20 6187 0.05% 21 10454 0.09% 22 3257 0.03% 23 2462 0.02% 24 1274 0.01% 25 1513 0.01% 26 1750 0.01% 27 2112 0.02% 28 2097 0.02% 29 1701 0.01% 30 1307 0.01% 31 1955 0.02% 32 1661 0.01% 33 1946 0.02% 34 3000 0.02% 35 6772 0.06% 36 2440 0.02% 37 2203 0.02% 38 2535 0.02% 39 3184 0.03% 40 3216 0.03% 41 3108 0.03% 42 3566 0.03% 43 4284 0.04% 44 5206 0.04% 45 4389 0.04% 46 4372 0.04% 47 4540 0.04% 48 4672 0.04% 49 4898 0.04% 50 5396 0.04% 51 5230 0.04% 52 5439 0.05% 53 5928 0.05% 54 6364 0.05% 55 6567 0.05% 56 6705 0.06% 57 7265 0.06% 58 7279 0.06% 59 7785 0.06% 60 8970 0.07% 61 8956 0.07% 62 9185 0.08% 63 9527 0.08% 64 11129 0.09% 65 9840 0.08% 66 10975 0.09% 67 11364 0.09% 68 11315 0.09% 69 12131 0.10% 70 12335 0.10% 71 14387 0.12% 72 15735 0.13% 73 18158 0.15% 74 18064 0.15% 75 17996 0.15% 76 18244 0.15% 77 18892 0.16% 78 19139 0.16% 79 19236 0.16% 80 20125 0.17% 81 19659 0.16% 82 19764 0.16% 83 20640 0.17% 84 20773 0.17% 85 22655 0.19% 86 23577 0.20% 87 23658 0.20% 88 24500 0.20% 89 27319 0.23% 90 25133 0.21% 91 24623 0.20% 92 25148 0.21% 93 25044 0.21% 94 25772 0.21% 95 27039 0.22% 96 29239 0.24% 97 29496 0.24% 98 30804 0.26% 99 32224 0.27% 100 33330 0.28% 101 33715 0.28% 102 32116 0.27% 103 32223 0.27% 104 32927 0.27% 105 34673 0.29% 106 37877 0.31% 107 36379 0.30% 108 36419 0.30% 109 37695 0.31% 110 38808 0.32% 111 40245 0.33% 112 43635 0.36% 113 43636 0.36% 114 46040 0.38% 115 49666 0.41% 116 51712 0.43% 117 56398 0.47% 118 62007 0.51% 119 72074 0.60% 120 86386 0.72% 121 111344 0.92% 122 160682 1.33% 123 314505 2.60% 124 1831362 15.16% 125 7777475 64.39% criterion=sequence-density sequence-density=1.90 sequence-density-rank=1 fanout-score=59.20 fanout-score-rank=1 prefix-density=2.10 prefix-fanout=53.5 sequence=AGATCGGAAGAGCACACC criterion=fanout-score sequence-density=1.90 sequence-density-rank=1 fanout-score=59.20 fanout-score-rank=1 prefix-density=2.10 prefix-fanout=53.5 sequence=AGATCGGAAGAGCACACC criterion=sequence-density sequence-density=9.20 sequence-density-rank=1 fanout-score=35.90 fanout-score-rank=3 prefix-density=9.37 prefix-fanout=35.2 sequence=GGTGTGCTCTTCCGATCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=48.11 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.8 sequence=TTTCTCTTTTTATTTTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAAATCAACAAAACCTAAAGTGATTTCGCGTTCCCCTTCTAACTTACCTACTACTGTACCGGCGTG ERR3317438 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:20:26 Started mapping on | Dec 10 09:20:26 Finished on | Dec 10 09:21:29 Mapping speed, Million of reads per hour | 1035.45 Number of input reads | 18120306 Average input read length | 239 UNIQUE READS: Uniquely mapped reads number | 15824771 Uniquely mapped reads % | 87.33% Average mapped length | 235.71 Number of splices: Total | 9857328 Number of splices: Annotated (sjdb) | 9237285 Number of splices: GT/AG | 9689688 Number of splices: GC/AG | 141216 Number of splices: AT/AC | 6624 Number of splices: Non-canonical | 19800 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.01% Deletion average length | 1.25 Insertion rate per base | 0.00% Insertion average length | 1.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1549798 % of reads mapped to multiple loci | 8.55% Number of reads mapped to too many loci | 53715 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.36% % of reads unmapped: other | 1.46% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 768813 768813 768813 N_multimapping 1549798 1549798 1549798 N_noFeature 681767 3560847 12572976 N_ambiguous 593886 221397 67077 UnstrandedReadsAssigned:14549118 PositiveStrandReadsAssigned:12042527 NegativeStrandReadsAssigned:3184718 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=123 echo kmer=119 ERR3317438 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317438-trimmed-pair1.fastq ERR3317438-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,120,306 reads, 16,557,406 reads pseudoaligned [quant] estimated average fragment length: 242.174 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52973 ERR3317438.ke.tsv 35125 ERR3317438.se.tsv 88098 total ==> ERR3317438.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 695.37 0 0 PNS24247 1044 802.826 11.6816 1.19169 PNS24249 1928 1686.83 150.052 7.28546 PNS24246 1044 802.826 11.6816 1.19169 PNS24248 1044 802.826 11.6816 1.19169 PNS24244 1471 1229.83 235.903 15.71 PNS24243 293 110.749 16 11.8322 KQK14069 1603 1361.83 16447.3 989.143 KQK14071 474 253.622 19.8195 6.40018 ==> ERR3317438.se.tsv <== BRADI_1g14170v3 17001 BRADI_1g53295v3 103 BRADI_1g59795v3 241 BRADI_1g07683v3 0 BRADI_1g00485v3 145 BRADI_1g20270v3 856 BRADI_1g74790v3 264 BRADI_1g09890v3 0 BRADI_1g77505v3 216 BRADI_1g48960v3 0 ERR3317438 completed mapping pipeline successfully