Starting /dee2/code/volunteer_pipeline.sh ERR3317439 current disk space = 1525234356224 free memory = 1602328756 ERR3317439 SRAfilesize 9e9845e516b5a36d08b12a043ca8d837 ERR3317439.sra ERR3317439.sra file validated ERR3317439 is paired end ERR3317439 is conventional basespace ERR3317439 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317439_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8385 33.0 33.0 33.0 33.0 33.0 2 32.8375 33.0 33.0 33.0 33.0 33.0 3 32.7995 33.0 33.0 33.0 33.0 33.0 4 32.7815 33.0 33.0 33.0 33.0 33.0 5 32.831 33.0 33.0 33.0 33.0 33.0 6 36.61925 37.0 37.0 37.0 37.0 37.0 7 36.681 37.0 37.0 37.0 37.0 37.0 8 36.74075 37.0 37.0 37.0 37.0 37.0 9 36.714 37.0 37.0 37.0 37.0 37.0 10-11 36.743875 37.0 37.0 37.0 37.0 37.0 12-13 36.722125 37.0 37.0 37.0 37.0 37.0 14-15 36.723625 37.0 37.0 37.0 37.0 37.0 16-17 36.7575 37.0 37.0 37.0 37.0 37.0 18-19 36.736125 37.0 37.0 37.0 37.0 37.0 20-21 36.763999999999996 37.0 37.0 37.0 37.0 37.0 22-23 36.721000000000004 37.0 37.0 37.0 37.0 37.0 24-25 36.708749999999995 37.0 37.0 37.0 37.0 37.0 26-27 36.6875 37.0 37.0 37.0 37.0 37.0 28-29 36.636375 37.0 37.0 37.0 37.0 37.0 30-31 36.68575 37.0 37.0 37.0 37.0 37.0 32-33 36.6515 37.0 37.0 37.0 37.0 37.0 34-35 36.667 37.0 37.0 37.0 37.0 37.0 36-37 36.607 37.0 37.0 37.0 37.0 37.0 38-39 36.591875 37.0 37.0 37.0 37.0 37.0 40-41 36.511625 37.0 37.0 37.0 37.0 37.0 42-43 36.279875000000004 37.0 37.0 37.0 37.0 37.0 44-45 36.029375 37.0 37.0 37.0 37.0 37.0 46-47 35.9375 37.0 37.0 37.0 37.0 37.0 48-49 35.848 37.0 37.0 37.0 37.0 37.0 50-51 35.75475 37.0 37.0 37.0 37.0 37.0 52-53 35.8255 37.0 37.0 37.0 37.0 37.0 54-55 36.053125 37.0 37.0 37.0 37.0 37.0 56-57 36.101124999999996 37.0 37.0 37.0 37.0 37.0 58-59 36.196625 37.0 37.0 37.0 37.0 37.0 60-61 36.367625000000004 37.0 37.0 37.0 37.0 37.0 62-63 36.358875 37.0 37.0 37.0 37.0 37.0 64-65 36.39775 37.0 37.0 37.0 37.0 37.0 66-67 36.369625 37.0 37.0 37.0 37.0 37.0 68-69 36.246125 37.0 37.0 37.0 37.0 37.0 70-71 36.273624999999996 37.0 37.0 37.0 37.0 37.0 72-73 36.198499999999996 37.0 37.0 37.0 37.0 37.0 74-75 36.173625 37.0 37.0 37.0 37.0 37.0 76-77 36.073375 37.0 37.0 37.0 37.0 37.0 78-79 35.9965 37.0 37.0 37.0 37.0 37.0 80-81 35.874875 37.0 37.0 37.0 37.0 37.0 82-83 35.427875 37.0 37.0 37.0 37.0 37.0 84-85 35.259375 37.0 37.0 37.0 37.0 37.0 86-87 35.274 37.0 37.0 37.0 37.0 37.0 88-89 35.311375 37.0 37.0 37.0 37.0 37.0 90-91 35.216499999999996 37.0 37.0 37.0 35.0 37.0 92-93 35.17825 37.0 37.0 37.0 35.0 37.0 94-95 35.16925 37.0 37.0 37.0 37.0 37.0 96-97 35.12075 37.0 37.0 37.0 35.0 37.0 98-99 35.09425 37.0 37.0 37.0 33.0 37.0 100-101 35.056 37.0 37.0 37.0 33.0 37.0 102-103 35.000249999999994 37.0 37.0 37.0 33.0 37.0 104-105 35.058875 37.0 37.0 37.0 35.0 37.0 106-107 35.015625 37.0 37.0 37.0 33.0 37.0 108-109 34.977625 37.0 37.0 37.0 33.0 37.0 110-111 34.93275 37.0 37.0 37.0 33.0 37.0 112-113 34.8885 37.0 37.0 37.0 33.0 37.0 114-115 34.85525 37.0 37.0 37.0 33.0 37.0 116-117 34.805625 37.0 37.0 37.0 33.0 37.0 118-119 34.713375 37.0 37.0 37.0 33.0 37.0 120-121 34.4985 37.0 37.0 37.0 33.0 37.0 122-123 34.351625 37.0 37.0 37.0 33.0 37.0 124-125 33.259375 37.0 35.0 37.0 17.5 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 2.0 9 3.0 10 1.0 11 1.0 12 1.0 13 4.0 14 2.0 15 1.0 16 1.0 17 1.0 18 3.0 19 3.0 20 3.0 21 8.0 22 16.0 23 33.0 24 54.0 25 9.0 26 10.0 27 9.0 28 20.0 29 17.0 30 27.0 31 40.0 32 67.0 33 51.0 34 124.0 35 220.0 36 3267.0 >>END_MODULE >>Per base sequence content pass #Base G A T C 1 25.587793896948476 22.0360180090045 19.884942471235618 32.491245622811405 2 24.975 21.349999999999998 18.925 34.75 3 23.3 22.3 22.25 32.15 4 26.075 19.525000000000002 21.125 33.275 5 28.325 20.225 19.175 32.275 6 29.25 21.825 23.25 25.674999999999997 7 25.3 26.174999999999997 24.675 23.849999999999998 8 24.099999999999998 26.125 29.349999999999998 20.424999999999997 9 25.05 28.825 26.400000000000002 19.725 10-11 24.4875 26.6 26.1 22.8125 12-13 25.0375 25.0625 27.075 22.825 14-15 23.7875 25.2875 26.1 24.825 16-17 24.212500000000002 23.5 26.5125 25.775 18-19 24.15 24.925 26.35 24.575 20-21 22.275 24.125 27.1125 26.487500000000004 22-23 24.05 23.3125 26.5875 26.05 24-25 23.8125 23.7875 26.6625 25.7375 26-27 24.712500000000002 23.375 26.5125 25.4 28-29 24.3 24.8 24.9125 25.9875 30-31 23.175 25.224999999999998 26.4625 25.137500000000003 32-33 24.025 23.8625 25.4875 26.625 34-35 24.224999999999998 24.0375 25.1 26.637499999999996 36-37 23.8875 24.712500000000002 25.4875 25.912499999999998 38-39 24.675 25.2 25.137500000000003 24.9875 40-41 24.77144646211647 23.944896681277395 24.971822166562305 26.311834690043835 42-43 25.21695384228399 23.996981511759525 26.311155829455412 24.47490881650107 44-45 24.350690485240087 24.008615228683645 26.71987837324211 24.920815912834158 46-47 24.02638589369529 23.595078015983763 26.018013446657363 26.360522643663582 48-49 24.290983085336386 24.023909449319596 26.27495866717538 25.410148798168635 50-51 24.744637385086822 23.45505617977528 25.485188968335038 26.31511746680286 52-53 25.324840764331206 23.949044585987263 25.872611464968152 24.853503184713375 54-55 25.390625 24.117943548387096 26.033266129032256 24.458165322580644 56-57 24.571788413098236 23.727959697733 25.56675062972292 26.133501259445847 58-59 25.21968365553603 23.587747928696963 25.520964097414012 25.671604318353005 60-61 24.6125 23.6375 26.4125 25.337500000000002 62-63 24.887500000000003 24.725 25.974999999999998 24.4125 64-65 23.575 23.65 26.1 26.674999999999997 66-67 23.849999999999998 24.2375 25.8625 26.05 68-69 25.724999999999998 24.125 25.5625 24.587500000000002 70-71 24.3875 24.474999999999998 25.637500000000003 25.5 72-73 24.587500000000002 25.2 24.637500000000003 25.575 74-75 24.4 25.2375 25.45 24.9125 76-77 23.775 26.25 24.1125 25.8625 78-79 22.8875 26.924999999999997 24.8 25.387500000000003 80-81 24.3875 25.474999999999998 24.8125 25.324999999999996 82-83 24.837500000000002 24.85 25.275 25.0375 84-85 24.125 25.75 25.1875 24.9375 86-87 24.712500000000002 25.412499999999998 24.587500000000002 25.2875 88-89 24.675 25.0625 25.0125 25.25 90-91 23.8875 26.025 25.074999999999996 25.0125 92-93 25.3125 25.224999999999998 23.400000000000002 26.0625 94-95 24.075 25.3 24.3 26.325 96-97 24.6875 24.4125 25.924999999999997 24.975 98-99 25.650000000000002 24.75 25.174999999999997 24.425 100-101 24.7375 24.1375 25.387500000000003 25.7375 102-103 24.474999999999998 25.55 25.4875 24.4875 104-105 25.662499999999998 24.2375 24.4875 25.6125 106-107 23.9 25.0 25.2875 25.8125 108-109 23.8875 26.5125 24.775 24.825 110-111 24.9125 26.237500000000004 24.2625 24.587500000000002 112-113 24.3625 25.837500000000002 24.6625 25.137500000000003 114-115 23.9 27.125 24.3625 24.6125 116-117 24.5 26.5125 23.825 25.162499999999998 118-119 24.8 26.474999999999998 23.575 25.15 120-121 24.4875 26.8625 23.875 24.775 122-123 24.709120480420367 26.79844864256224 23.683222819967472 24.80920805704992 124-125 24.49337002752064 26.319739804853644 23.01726294721041 26.169627220415308 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 6.0 1 6.5 2 5.5 3 2.0 4 0.0 5 0.5 6 1.0 7 0.5 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.0 24 1.5 25 2.5 26 4.0 27 4.5 28 3.0 29 8.0 30 14.5 31 15.5 32 16.5 33 19.0 34 31.5 35 44.0 36 46.0 37 63.5 38 71.5 39 92.0 40 117.5 41 138.5 42 158.5 43 168.0 44 188.5 45 180.0 46 176.5 47 182.5 48 173.5 49 162.5 50 157.0 51 141.5 52 127.0 53 122.5 54 110.0 55 104.0 56 85.5 57 72.5 58 70.5 59 63.0 60 67.0 61 81.5 62 78.5 63 55.5 64 53.5 65 52.0 66 49.5 67 49.5 68 39.0 69 44.0 70 43.5 71 32.0 72 41.0 73 42.0 74 25.5 75 25.0 76 22.5 77 14.5 78 9.5 79 5.5 80 3.5 81 1.5 82 1.0 83 1.0 84 1.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.1875 42-43 0.6125 44-45 1.3375 46-47 1.4625000000000001 48-49 1.7125000000000001 50-51 2.1 52-53 1.875 54-55 0.8 56-57 0.75 58-59 0.42500000000000004 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.08750000000000001 124-125 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.0 #Duplication Level Percentage of deduplicated Percentage of total 1 97.91666666666666 94.0 2 1.4322916666666665 2.75 3 0.26041666666666663 0.75 4 0.15625 0.6 5 0.052083333333333336 0.25 6 0.10416666666666667 0.6 7 0.026041666666666668 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.052083333333333336 0.8750000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TATCCCCTGCTTCCCCGCTTCCTCTTCCTCCTCCCCCTCACTCCCCAAGC 23 0.575 No Hit CTCCTCCACCGCCACCGCCTCCTCGCGTCCTCATCCCCTGCTCCTCGACT 12 0.3 No Hit CCCCCTACCAAGCAGCAGCCATGGCAGCGTCTCTCCAGGCCGCCGCCACC 7 0.17500000000000002 No Hit TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit GTTGGAGTCCCATATATATATGTATAAGATGCCAGCCCGGTTTCGTCAAC 6 0.15 No Hit ACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCA 6 0.15 No Hit AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATG 6 0.15 TruSeq Adapter, Index 2 (100% over 49bp) CCAAGAGAAAACGCAAAGCTCGAGATGGCACAGGCCATGGCGTCCATGAC 5 0.125 No Hit CGGTCTGCATCCTCCCGTCGCCGCCATGGACGGCGTCGTCGGCCAGATCT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.15 0.0 0.0 0.0 0.0 2 0.2 0.0 0.0 0.0 0.0 3 0.25 0.0 0.0 0.0 0.0 4 0.275 0.0 0.0 0.0 0.0 5 0.525 0.0 0.0 0.0 0.0 6 1.0 0.0 0.0 0.0 0.0 7 1.75 0.0 0.0 0.0 0.0 8 2.2 0.0 0.0 0.0 0.0 9 2.375 0.0 0.0 0.0 0.0 10-11 2.4 0.0 0.0 0.0 0.0 12-13 2.4 0.0 0.0 0.0 0.0 14-15 2.4 0.0 0.0 0.0 0.0 16-17 2.4375 0.0 0.0 0.0 0.0 18-19 2.4875 0.0 0.0 0.0 0.0 20-21 2.5 0.0 0.0 0.0 0.0 22-23 2.5374999999999996 0.0 0.0 0.0 0.0 24-25 2.575 0.0 0.0 0.0 0.0 26-27 2.5875000000000004 0.0 0.0 0.0 0.0 28-29 2.6 0.0 0.0 0.0 0.0 30-31 2.625 0.0 0.0 0.0 0.0 32-33 2.625 0.0 0.0 0.0 0.0 34-35 2.6375 0.0 0.0 0.0 0.0 36-37 2.7 0.0 0.0 0.0 0.0 38-39 2.7 0.0 0.0 0.0 0.0 40-41 2.7125000000000004 0.0 0.0 0.0 0.0 42-43 2.7625 0.0 0.0 0.0 0.0 44-45 2.8375 0.0 0.0 0.0 0.0 46-47 2.9124999999999996 0.0 0.0 0.0 0.0 48-49 3.025 0.0 0.0 0.0 0.0 50-51 3.075 0.0 0.0 0.0 0.0 52-53 3.2 0.0 0.0 0.0 0.0 54-55 3.225 0.0 0.0 0.0 0.0 56-57 3.3375 0.0 0.0 0.0 0.0 58-59 3.4375 0.0 0.0 0.0 0.0 60-61 3.5625 0.0 0.0 0.0 0.0 62-63 3.7375 0.0 0.0 0.0 0.0 64-65 3.8625 0.0 0.0 0.0 0.0 66-67 3.925 0.0 0.0 0.0 0.0 68-69 4.0 0.0 0.0 0.0 0.0 70-71 4.125 0.0 0.0 0.0 0.0 72-73 4.3625 0.0 0.0 0.0 0.0 74-75 4.574999999999999 0.0 0.0 0.0 0.0 76-77 4.762499999999999 0.0 0.0 0.0 0.0 78-79 4.987500000000001 0.0 0.0 0.0 0.0 80-81 5.3625 0.0 0.0 0.0 0.0 82-83 5.6625 0.0 0.0 0.0 0.0 84-85 5.925 0.0 0.0 0.0 0.0 86-87 6.15 0.0 0.0 0.0 0.0 88-89 6.5625 0.0 0.0 0.0 0.0 90-91 6.8625 0.0 0.0 0.0 0.0 92-93 7.1875 0.0 0.0 0.0 0.0 94-95 7.4875 0.0 0.0 0.0 0.0 96-97 7.737500000000001 0.0 0.0 0.0 0.0 98-99 8.0625 0.0 0.0 0.0 0.0 100-101 8.4125 0.0 0.0 0.0 0.0 102-103 8.712499999999999 0.0 0.0 0.0 0.0 104-105 9.2 0.0 0.0 0.0 0.0 106-107 9.7875 0.0 0.0 0.0 0.0 108-109 10.2875 0.0 0.0 0.0 0.0 110-111 10.625 0.0 0.0 0.0 0.0 112-113 11.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317439 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317439_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.52375 33.0 33.0 33.0 33.0 33.0 2 32.493 33.0 33.0 33.0 33.0 33.0 3 32.4785 33.0 33.0 33.0 33.0 33.0 4 32.503 33.0 33.0 33.0 33.0 33.0 5 32.50975 33.0 33.0 33.0 33.0 33.0 6 36.29125 37.0 37.0 37.0 37.0 37.0 7 36.3135 37.0 37.0 37.0 37.0 37.0 8 36.32825 37.0 37.0 37.0 37.0 37.0 9 36.3445 37.0 37.0 37.0 37.0 37.0 10-11 36.3115 37.0 37.0 37.0 37.0 37.0 12-13 36.317875 37.0 37.0 37.0 37.0 37.0 14-15 36.295125 37.0 37.0 37.0 37.0 37.0 16-17 36.2875 37.0 37.0 37.0 37.0 37.0 18-19 36.304 37.0 37.0 37.0 37.0 37.0 20-21 36.272000000000006 37.0 37.0 37.0 37.0 37.0 22-23 36.2915 37.0 37.0 37.0 37.0 37.0 24-25 36.241125 37.0 37.0 37.0 37.0 37.0 26-27 36.26575 37.0 37.0 37.0 37.0 37.0 28-29 36.317499999999995 37.0 37.0 37.0 37.0 37.0 30-31 36.278999999999996 37.0 37.0 37.0 37.0 37.0 32-33 36.305625000000006 37.0 37.0 37.0 37.0 37.0 34-35 36.334625 37.0 37.0 37.0 37.0 37.0 36-37 36.325 37.0 37.0 37.0 37.0 37.0 38-39 36.3485 37.0 37.0 37.0 37.0 37.0 40-41 36.337625 37.0 37.0 37.0 37.0 37.0 42-43 36.340875 37.0 37.0 37.0 37.0 37.0 44-45 36.369625 37.0 37.0 37.0 37.0 37.0 46-47 36.336875 37.0 37.0 37.0 37.0 37.0 48-49 36.300375 37.0 37.0 37.0 37.0 37.0 50-51 36.2965 37.0 37.0 37.0 37.0 37.0 52-53 36.292249999999996 37.0 37.0 37.0 37.0 37.0 54-55 36.24525 37.0 37.0 37.0 37.0 37.0 56-57 36.117 37.0 37.0 37.0 37.0 37.0 58-59 35.90725 37.0 37.0 37.0 37.0 37.0 60-61 35.934375 37.0 37.0 37.0 37.0 37.0 62-63 35.945499999999996 37.0 37.0 37.0 37.0 37.0 64-65 36.191125 37.0 37.0 37.0 37.0 37.0 66-67 36.2335 37.0 37.0 37.0 37.0 37.0 68-69 36.217124999999996 37.0 37.0 37.0 37.0 37.0 70-71 36.119375000000005 37.0 37.0 37.0 37.0 37.0 72-73 36.06925 37.0 37.0 37.0 37.0 37.0 74-75 35.677875 37.0 37.0 37.0 37.0 37.0 76-77 35.30175 37.0 37.0 37.0 37.0 37.0 78-79 35.213499999999996 37.0 37.0 37.0 37.0 37.0 80-81 35.252375 37.0 37.0 37.0 37.0 37.0 82-83 35.230875 37.0 37.0 37.0 37.0 37.0 84-85 35.15375 37.0 37.0 37.0 37.0 37.0 86-87 35.112125 37.0 37.0 37.0 37.0 37.0 88-89 35.062375 37.0 37.0 37.0 37.0 37.0 90-91 34.997 37.0 37.0 37.0 37.0 37.0 92-93 35.011875 37.0 37.0 37.0 35.0 37.0 94-95 35.0205 37.0 37.0 37.0 37.0 37.0 96-97 34.95975 37.0 37.0 37.0 37.0 37.0 98-99 34.95225 37.0 37.0 37.0 37.0 37.0 100-101 34.960125 37.0 37.0 37.0 37.0 37.0 102-103 35.00125 37.0 37.0 37.0 37.0 37.0 104-105 34.945750000000004 37.0 37.0 37.0 37.0 37.0 106-107 34.912875 37.0 37.0 37.0 37.0 37.0 108-109 34.829875 37.0 37.0 37.0 33.0 37.0 110-111 34.824124999999995 37.0 37.0 37.0 33.0 37.0 112-113 34.713499999999996 37.0 37.0 37.0 33.0 37.0 114-115 34.573499999999996 37.0 37.0 37.0 33.0 37.0 116-117 34.608625 37.0 37.0 37.0 33.0 37.0 118-119 34.461749999999995 37.0 37.0 37.0 33.0 37.0 120-121 34.429500000000004 37.0 37.0 37.0 33.0 37.0 122-123 34.342375000000004 37.0 37.0 37.0 33.0 37.0 124-125 32.622 37.0 35.0 37.0 17.5 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 2.0 4 1.0 5 1.0 6 2.0 7 0.0 8 2.0 9 0.0 10 1.0 11 1.0 12 1.0 13 3.0 14 6.0 15 5.0 16 4.0 17 2.0 18 2.0 19 4.0 20 9.0 21 21.0 22 68.0 23 12.0 24 7.0 25 11.0 26 7.0 27 12.0 28 13.0 29 13.0 30 22.0 31 29.0 32 40.0 33 45.0 34 109.0 35 182.0 36 3340.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.575 14.924999999999999 24.75 25.75 2 30.182545636409102 14.403600900225054 21.80545136284071 33.60840210052513 3 26.81522283425138 15.222834251377066 24.511767651477214 33.45017526289434 4 28.274480340596043 13.5236664162284 23.816679188580014 34.38517405459554 5 31.40495867768595 16.754320060105186 19.684447783621337 32.15627347858753 6 33.81763527054108 16.658316633266534 26.027054108216436 23.49699398797595 7 28.181362725450903 25.501002004008015 31.362725450901802 14.954909819639278 8 21.492985971943888 25.35070140280561 34.99498997995992 18.161322645290582 9 26.384364820846905 28.213480330744172 28.68955149085442 16.7126033575545 10-11 25.789078156312623 25.71392785571142 28.669839679358716 19.827154308617235 12-13 22.069138276553108 26.127254509018037 29.220941883767537 22.58266533066132 14-15 21.51803607214429 26.377755511022045 28.143787575150302 23.960420841683366 16-17 22.55761523046092 25.738977955911825 26.340180360721444 25.363226452905813 18-19 25.316297131404237 26.54390579982463 23.687836652887388 24.451960415883754 20-21 21.8061122244489 28.0185370741483 26.92885771543086 23.246492985971944 22-23 22.567313713212272 23.706950532247966 27.12586098935504 26.599874765184722 24-25 24.671258609893552 25.973700688791485 25.823418910457107 23.53162179085786 26-27 24.292511895817682 26.69671925870273 23.96694214876033 25.043826696719258 28-29 25.963945918878316 25.112669003505257 23.222333500250375 25.701051577366048 30-31 25.03442233070472 26.99962448366504 25.222180498185004 22.743772687445237 32-33 24.77488744372186 27.55127563781891 24.387193596798397 23.28664332166083 34-35 24.781195298824706 26.581645411352838 22.9057264316079 25.731432858214554 36-37 24.428053506688336 25.678209776222026 25.090636329541194 24.803100387548444 38-39 24.337500000000002 25.900000000000002 25.374999999999996 24.3875 40-41 24.9875 25.650000000000002 23.45 25.912499999999998 42-43 24.474999999999998 26.5 24.325 24.7 44-45 24.975 25.55 24.075 25.4 46-47 24.025 26.224999999999998 23.674999999999997 26.075 48-49 23.724999999999998 26.55 24.887500000000003 24.837500000000002 50-51 25.637500000000003 25.2375 24.075 25.05 52-53 23.8875 26.3125 24.4 25.4 54-55 24.405506883604506 26.645807259073845 24.69336670838548 24.25531914893617 56-57 24.53849051864875 26.2463895516765 23.998493030264974 25.21662689940977 58-59 23.638660770688567 26.53190145293746 23.68919772583702 26.140240050536956 60-61 23.729027374795002 27.034186955973254 24.309322568436986 24.927463100794753 62-63 23.211807745679323 28.207392456162484 24.13271098776334 24.448088810394854 64-65 23.733900212579716 27.72289608603226 23.521320495185694 25.02188320620233 66-67 22.386193096548272 28.326663331665834 25.11255627813907 24.174587293646823 68-69 23.175 29.5875 22.8875 24.349999999999998 70-71 23.9375 29.025000000000002 22.775000000000002 24.2625 72-73 24.353044130516317 27.640955119389925 23.540442555319416 24.46555819477435 74-75 24.831207801950487 28.107026756689173 22.83070767691923 24.23105776444111 76-77 23.817271589486857 28.335419274092615 22.5657071339174 25.281602002503128 78-79 24.214348316013524 28.18329785902091 23.28784274445975 24.31451108050582 80-81 23.95742016280526 29.304946775203504 22.85535378835316 23.882279273638073 82-83 24.62424849699399 27.054108216432866 22.870741482965933 25.450901803607213 84-85 25.231771485843147 27.38661989476322 23.765973440240543 23.615635179153095 86-87 26.713444430522493 26.751033705049494 22.791630121538653 23.74389174288936 88-89 25.0 26.930792377131397 22.68054162487462 25.388665997993982 90-91 24.87786546411124 27.20781661029688 24.163848177376927 23.750469748214957 92-93 24.877804236119815 26.657475874169695 23.386389271838574 25.078330617871913 94-95 25.32882375046975 26.180633846924717 23.39972441438056 25.090817988224977 96-97 25.460468612955772 26.826212254103492 23.656183435659692 24.057135697281044 98-99 26.039579158316634 25.237975951903806 23.72244488977956 25.0 100-101 25.58867735470942 25.80160320641283 23.847695390781563 24.762024048096194 102-103 25.585472761427674 26.762680025046965 23.218534752661242 24.43331246086412 104-105 26.13323315802655 27.210117705985475 22.96518908089156 23.69146005509642 106-107 25.544703230653642 26.508890558477333 23.102930127723518 24.843476083145504 108-109 24.837255883825737 26.564847270906363 24.061091637456183 24.536805207811717 110-111 26.245930378161788 26.90959178562484 22.9526671675432 23.89181066867017 112-113 25.42245587683064 26.861935160846162 22.393290774815373 25.322318187507825 114-115 24.515322076297686 27.74233896185116 23.61475922451532 24.127579737335836 116-117 25.418854713678417 27.406851712928233 23.1807951987997 23.99349837459365 118-119 25.731432858214554 25.881470367591895 23.0432608152038 25.343835958989747 120-121 24.6875 27.750000000000004 23.9 23.6625 122-123 25.790723840480062 27.203400425053132 24.0780097512189 22.927865983247905 124-125 26.400000000000002 27.725 22.400000000000002 23.474999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.5 19 2.0 20 4.0 21 2.5 22 1.5 23 4.5 24 3.5 25 2.0 26 2.5 27 4.0 28 3.5 29 5.5 30 10.0 31 11.0 32 17.5 33 23.5 34 31.5 35 46.0 36 68.0 37 76.5 38 79.0 39 98.5 40 124.5 41 151.0 42 161.5 43 179.0 44 198.0 45 200.5 46 192.0 47 182.0 48 174.0 49 160.0 50 159.0 51 152.0 52 135.5 53 124.5 54 109.5 55 94.5 56 86.0 57 78.5 58 73.0 59 74.5 60 61.5 61 51.5 62 53.5 63 45.0 64 45.5 65 49.5 66 45.0 67 38.5 68 34.5 69 35.5 70 31.5 71 31.0 72 33.0 73 28.5 74 22.5 75 16.0 76 12.5 77 13.5 78 14.0 79 9.5 80 5.5 81 4.5 82 3.0 83 1.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.15 4 0.17500000000000002 5 0.17500000000000002 6 0.2 7 0.2 8 0.2 9 0.22499999999999998 10-11 0.2 12-13 0.2 14-15 0.2 16-17 0.2 18-19 0.21250000000000002 20-21 0.2 22-23 0.1875 24-25 0.1875 26-27 0.17500000000000002 28-29 0.15 30-31 0.13749999999999998 32-33 0.05 34-35 0.025 36-37 0.0125 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.125 56-57 0.46249999999999997 58-59 1.0625 60-61 0.9125 62-63 0.9125 64-65 0.0375 66-67 0.05 68-69 0.0 70-71 0.0 72-73 0.0125 74-75 0.025 76-77 0.125 78-79 0.1625 80-81 0.1875 82-83 0.2 84-85 0.22499999999999998 86-87 0.2375 88-89 0.3 90-91 0.21250000000000002 92-93 0.2625 94-95 0.21250000000000002 96-97 0.2375 98-99 0.2 100-101 0.2 102-103 0.1875 104-105 0.17500000000000002 106-107 0.17500000000000002 108-109 0.15 110-111 0.17500000000000002 112-113 0.13749999999999998 114-115 0.0625 116-117 0.025 118-119 0.025 120-121 0.0 122-123 0.0125 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.275 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98244721444925 97.275 2 0.6868481302467566 1.35 3 0.15263291783261257 0.44999999999999996 4 0.05087763927753752 0.2 5 0.07631645891630628 0.375 6 0.02543881963876876 0.15 7 0.0 0.0 8 0.02543881963876876 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGG 8 0.2 No Hit AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCC 6 0.15 Illumina Single End PCR Primer 1 (100% over 50bp) GACCCGAGTAGCATGGGGCACGTGGAATCCCGTGTGAATCAGCAAGGACC 5 0.125 No Hit ATCCCCATCACGATGAAATTTCCCAAGATTACCCGGGCCTGTCGGCCAAG 5 0.125 No Hit TTGGGGATTCGGTGGCGGTGGAGGCAACGGCGACGGCGCGGCGGCGGCGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.15 0.0 0.0 0.0 0.0 2 0.2 0.0 0.0 0.0 0.0 3 0.275 0.0 0.0 0.0 0.0 4 0.325 0.0 0.0 0.0 0.0 5 0.625 0.0 0.0 0.0 0.0 6 1.1 0.0 0.0 0.0 0.0 7 1.85 0.0 0.0 0.0 0.0 8 2.325 0.0 0.0 0.0 0.0 9 2.5 0.0 0.0 0.0 0.0 10-11 2.5625 0.0 0.0 0.0 0.0 12-13 2.575 0.0 0.0 0.0 0.0 14-15 2.575 0.0 0.0 0.0 0.0 16-17 2.6125 0.0 0.0 0.0 0.0 18-19 2.6375 0.0 0.0 0.0 0.0 20-21 2.65 0.0 0.0 0.0 0.0 22-23 2.675 0.0 0.0 0.0 0.0 24-25 2.7 0.0 0.0 0.0 0.0 26-27 2.7125000000000004 0.0 0.0 0.0 0.0 28-29 2.725 0.0 0.0 0.0 0.0 30-31 2.75 0.0 0.0 0.0 0.0 32-33 2.75 0.0 0.0 0.0 0.0 34-35 2.7625 0.0 0.0 0.0 0.0 36-37 2.825 0.0 0.0 0.0 0.0 38-39 2.85 0.0 0.0 0.0 0.0 40-41 2.8625 0.0 0.0 0.0 0.0 42-43 2.9125 0.0 0.0 0.0 0.0 44-45 2.9875 0.0 0.0 0.0 0.0 46-47 3.0625 0.0 0.0 0.0 0.0 48-49 3.175 0.0 0.0 0.0 0.0 50-51 3.225 0.0 0.0 0.0 0.0 52-53 3.35 0.0 0.0 0.0 0.0 54-55 3.3875 0.0 0.0 0.0 0.0 56-57 3.475 0.0 0.0 0.0 0.0 58-59 3.5625 0.0 0.0 0.0 0.0 60-61 3.6624999999999996 0.0 0.0 0.0 0.0 62-63 3.8375 0.0 0.0 0.0 0.0 64-65 3.9625000000000004 0.0 0.0 0.0 0.0 66-67 4.0125 0.0 0.0 0.0 0.0 68-69 4.0625 0.0 0.0 0.0 0.0 70-71 4.1625 0.0 0.0 0.0 0.0 72-73 4.3375 0.0 0.0 0.0 0.0 74-75 4.5125 0.0 0.0 0.0 0.0 76-77 4.675 0.0 0.0 0.0 0.0 78-79 4.887499999999999 0.0 0.0 0.0 0.0 80-81 5.2125 0.0 0.0 0.0 0.0 82-83 5.487500000000001 0.0 0.0 0.0 0.0 84-85 5.737500000000001 0.0 0.0 0.0 0.0 86-87 5.9 0.0 0.0 0.0 0.0 88-89 6.3125 0.0 0.0 0.0 0.0 90-91 6.574999999999999 0.0 0.0 0.0 0.0 92-93 6.8875 0.0 0.0 0.0 0.0 94-95 7.2125 0.0 0.0 0.0 0.0 96-97 7.487500000000001 0.0 0.0 0.0 0.0 98-99 7.8125 0.0 0.0 0.0 0.0 100-101 8.1375 0.0 0.0 0.0 0.0 102-103 8.425 0.0 0.0 0.0 0.0 104-105 8.8875 0.0 0.0 0.0 0.0 106-107 9.4125 0.0 0.0 0.0 0.0 108-109 9.875 0.0 0.0 0.0 0.0 110-111 10.1875 0.0 0.0 0.0 0.0 112-113 10.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTGCT 15 2.5068579E-4 119.0 7 TGTGCTC 15 2.5068579E-4 119.0 8 GTGCTCT 15 2.5068579E-4 119.0 9 AACGAAG 15 0.0040846216 59.5 74-75 CTCTTCC 15 0.0040846216 59.5 12-13 TGCTCTT 15 0.0040846216 59.5 10-11 GCTCTTC 15 0.0040846216 59.5 10-11 CTTCCGA 15 0.0040846216 59.5 14-15 >>END_MODULE Read 867527 spots for ERR3317439.sra Written 867527 spots for ERR3317439.sra Read 867527 spots for ERR3317439.sra Written 867527 spots for ERR3317439.sra Read 867527 spots for ERR3317439.sra Written 867527 spots for ERR3317439.sra Read 867527 spots for ERR3317439.sra Written 867527 spots for ERR3317439.sra Read 867527 spots for ERR3317439.sra Written 867527 spots for ERR3317439.sra Read 867527 spots for ERR3317439.sra Written 867527 spots for ERR3317439.sra Read 867527 spots for ERR3317439.sra Written 867527 spots for ERR3317439.sra Read 867527 spots for ERR3317439.sra Written 867527 spots for ERR3317439.sra Read 867527 spots for ERR3317439.sra Written 867527 spots for ERR3317439.sra Read 867527 spots for ERR3317439.sra Written 867527 spots for ERR3317439.sra Read 867527 spots for ERR3317439.sra Written 867527 spots for ERR3317439.sra Read 867527 spots for ERR3317439.sra Written 867527 spots for ERR3317439.sra Read 867527 spots for ERR3317439.sra Written 867527 spots for ERR3317439.sra Read 867527 spots for ERR3317439.sra Written 867527 spots for ERR3317439.sra Read 867527 spots for ERR3317439.sra Written 867527 spots for ERR3317439.sra Read 867527 spots for ERR3317439.sra Written 867527 spots for ERR3317439.sra Read 867527 spots for ERR3317439.sra Written 867527 spots for ERR3317439.sra Read 867527 spots for ERR3317439.sra Written 867527 spots for ERR3317439.sra Read 867527 spots for ERR3317439.sra Written 867527 spots for ERR3317439.sra Read 867541 spots for ERR3317439.sra Written 867541 spots for ERR3317439.sra SRR ids: ['ERR3317439.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uyy6nj60 ERR3317439.sra spots: 17350554 blocks: [[1, 867527], [867528, 1735054], [1735055, 2602581], [2602582, 3470108], [3470109, 4337635], [4337636, 5205162], [5205163, 6072689], [6072690, 6940216], [6940217, 7807743], [7807744, 8675270], [8675271, 9542797], [9542798, 10410324], [10410325, 11277851], [11277852, 12145378], [12145379, 13012905], [13012906, 13880432], [13880433, 14747959], [14747960, 15615486], [15615487, 16483013], [16483014, 17350554]] ERR3317439 file size 4976750 ERR3317439 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317439 ERR3317439_1.fastq ERR3317439_2.fastq Input file: ERR3317439_1.fastq Paired file: ERR3317439_2.fastq trimmed: ERR3317439-trimmed-pair1.fastq, ERR3317439-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:18:15 2024 >> started Tue Dec 10 09:18:33 2024 >> done (18.056s) 17350554 read pairs processed; of these: 412289 ( 2.38%) short read pairs filtered out after trimming by size control 151310 ( 0.87%) empty read pairs filtered out after trimming by size control 16786955 (96.75%) read pairs available; of these: 4788613 (28.53%) trimmed read pairs available after processing 11998342 (71.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1143 0.01% 19 3883 0.02% 20 3917 0.02% 21 7069 0.04% 22 2618 0.02% 23 2629 0.02% 24 1590 0.01% 25 1830 0.01% 26 2054 0.01% 27 2636 0.02% 28 2463 0.01% 29 2057 0.01% 30 1836 0.01% 31 2984 0.02% 32 2558 0.02% 33 2899 0.02% 34 3577 0.02% 35 5326 0.03% 36 3415 0.02% 37 3392 0.02% 38 3649 0.02% 39 4192 0.02% 40 4238 0.03% 41 4620 0.03% 42 5257 0.03% 43 5237 0.03% 44 5998 0.04% 45 5409 0.03% 46 5750 0.03% 47 5949 0.04% 48 6522 0.04% 49 6455 0.04% 50 7255 0.04% 51 6847 0.04% 52 7463 0.04% 53 7870 0.05% 54 8886 0.05% 55 8461 0.05% 56 8857 0.05% 57 9162 0.05% 58 9634 0.06% 59 10124 0.06% 60 11284 0.07% 61 11796 0.07% 62 11914 0.07% 63 13310 0.08% 64 14938 0.09% 65 12652 0.08% 66 13760 0.08% 67 14103 0.08% 68 14508 0.09% 69 15003 0.09% 70 15229 0.09% 71 18279 0.11% 72 20068 0.12% 73 22938 0.14% 74 23015 0.14% 75 22143 0.13% 76 22623 0.13% 77 23901 0.14% 78 23711 0.14% 79 23892 0.14% 80 25871 0.15% 81 25101 0.15% 82 24412 0.15% 83 26511 0.16% 84 26318 0.16% 85 27802 0.17% 86 28601 0.17% 87 29328 0.17% 88 30289 0.18% 89 32816 0.20% 90 31716 0.19% 91 30922 0.18% 92 33009 0.20% 93 32018 0.19% 94 33085 0.20% 95 34581 0.21% 96 36273 0.22% 97 36614 0.22% 98 38322 0.23% 99 40308 0.24% 100 42382 0.25% 101 43595 0.26% 102 40135 0.24% 103 39903 0.24% 104 40764 0.24% 105 42037 0.25% 106 43553 0.26% 107 45068 0.27% 108 43323 0.26% 109 44873 0.27% 110 46125 0.27% 111 47079 0.28% 112 50283 0.30% 113 51004 0.30% 114 54463 0.32% 115 57480 0.34% 116 58327 0.35% 117 63498 0.38% 118 68800 0.41% 119 76399 0.46% 120 88889 0.53% 121 108739 0.65% 122 150656 0.90% 123 279778 1.67% 124 1980785 11.80% 125 11998342 71.47% 16786955 reads passed initial QC criterion=sequence-density sequence-density=1.09 sequence-density-rank=1 fanout-score=59.17 fanout-score-rank=2 prefix-density=1.23 prefix-fanout=52.5 sequence=AGATCGGAAGAGCACACC criterion=fanout-score sequence-density=0.13 sequence-density-rank=20 fanout-score=69.29 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=12.0 sequence=CGGCGGCGGCGC criterion=sequence-density sequence-density=6.17 sequence-density-rank=1 fanout-score=35.12 fanout-score-rank=2 prefix-density=6.28 prefix-fanout=34.5 sequence=GGTGTGCTCTTCCGATCT criterion=fanout-score sequence-density=0.49 sequence-density-rank=18 fanout-score=36.47 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=36.5 sequence=CCGTGTGCTCTTC Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACC -y GGTGTGCTCTTCCGATCT -o ERR3317439 ERR3317439_1.fastq ERR3317439_2.fastq Input file: ERR3317439_1.fastq Paired file: ERR3317439_2.fastq trimmed: ERR3317439-trimmed-pair1.fastq, ERR3317439-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACC -- paired 3' end adapter sequence (-y): GGTGTGCTCTTCCGATCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:19:48 2024 >> started Tue Dec 10 09:19:58 2024 >> done (9.953s) 10072173 read pairs processed; of these: 1928 ( 0.02%) short read pairs filtered out after trimming by size control 898 ( 0.01%) empty read pairs filtered out after trimming by size control 10069347 (99.97%) read pairs available; of these: 1434 ( 0.01%) trimmed read pairs available after processing 10067913 (99.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 671 0.01% 19 2331 0.02% 20 2334 0.02% 21 4253 0.04% 22 1530 0.02% 23 1361 0.01% 24 979 0.01% 25 1080 0.01% 26 1284 0.01% 27 1554 0.02% 28 1570 0.02% 29 1241 0.01% 30 1111 0.01% 31 1804 0.02% 32 1525 0.02% 33 1716 0.02% 34 2153 0.02% 35 3181 0.03% 36 2051 0.02% 37 2087 0.02% 38 2159 0.02% 39 2509 0.02% 40 2557 0.03% 41 2762 0.03% 42 3163 0.03% 43 3119 0.03% 44 3574 0.04% 45 3279 0.03% 46 3416 0.03% 47 3672 0.04% 48 3867 0.04% 49 3876 0.04% 50 4316 0.04% 51 4107 0.04% 52 4533 0.05% 53 4768 0.05% 54 5337 0.05% 55 5064 0.05% 56 5343 0.05% 57 5544 0.06% 58 5848 0.06% 59 6121 0.06% 60 6838 0.07% 61 7108 0.07% 62 7130 0.07% 63 7978 0.08% 64 8986 0.09% 65 7565 0.08% 66 8237 0.08% 67 8443 0.08% 68 8710 0.09% 69 8913 0.09% 70 9215 0.09% 71 10903 0.11% 72 12128 0.12% 73 13746 0.14% 74 13742 0.14% 75 13301 0.13% 76 13523 0.13% 77 14370 0.14% 78 14276 0.14% 79 14217 0.14% 80 15536 0.15% 81 15091 0.15% 82 14646 0.15% 83 15988 0.16% 84 15942 0.16% 85 16642 0.17% 86 17130 0.17% 87 17539 0.17% 88 18190 0.18% 89 19791 0.20% 90 19057 0.19% 91 18658 0.19% 92 19797 0.20% 93 19259 0.19% 94 19799 0.20% 95 20673 0.21% 96 21695 0.22% 97 22040 0.22% 98 22944 0.23% 99 24181 0.24% 100 25363 0.25% 101 26258 0.26% 102 24252 0.24% 103 24036 0.24% 104 24436 0.24% 105 25366 0.25% 106 26124 0.26% 107 27086 0.27% 108 25939 0.26% 109 26633 0.26% 110 27652 0.27% 111 28271 0.28% 112 30179 0.30% 113 30666 0.30% 114 32466 0.32% 115 34589 0.34% 116 34739 0.34% 117 38198 0.38% 118 41349 0.41% 119 45952 0.46% 120 53538 0.53% 121 64958 0.65% 122 90445 0.90% 123 168154 1.67% 124 1187701 11.80% 125 7196320 71.47% criterion=sequence-density sequence-density=1.10 sequence-density-rank=1 fanout-score=57.73 fanout-score-rank=2 prefix-density=1.23 prefix-fanout=51.6 sequence=AGATCGGAAGAGCACACC criterion=fanout-score sequence-density=0.13 sequence-density-rank=20 fanout-score=67.62 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=11.7 sequence=CGGCGGCGGCGC criterion=sequence-density sequence-density=6.09 sequence-density-rank=1 fanout-score=35.04 fanout-score-rank=2 prefix-density=6.21 prefix-fanout=34.4 sequence=GGTGTGCTCTTCCGATCT criterion=fanout-score sequence-density=0.49 sequence-density-rank=18 fanout-score=36.98 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=37.0 sequence=CCGTGTGCTCTTC ERR3317439 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:20:45 Started mapping on | Dec 10 09:20:45 Finished on | Dec 10 09:21:44 Mapping speed, Million of reads per hour | 1024.12 Number of input reads | 16784129 Average input read length | 241 UNIQUE READS: Uniquely mapped reads number | 15189591 Uniquely mapped reads % | 90.50% Average mapped length | 237.57 Number of splices: Total | 10063440 Number of splices: Annotated (sjdb) | 9477547 Number of splices: GT/AG | 9907136 Number of splices: GC/AG | 131533 Number of splices: AT/AC | 9088 Number of splices: Non-canonical | 15683 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.00% Deletion average length | 1.25 Insertion rate per base | 0.00% Insertion average length | 1.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 958343 % of reads mapped to multiple loci | 5.71% Number of reads mapped to too many loci | 58476 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.84% % of reads unmapped: other | 1.60% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 656428 656428 656428 N_multimapping 958343 958343 958343 N_noFeature 647724 3662804 11856542 N_ambiguous 495219 168340 60106 UnstrandedReadsAssigned:14046648 PositiveStrandReadsAssigned:11358447 NegativeStrandReadsAssigned:3272943 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 ERR3317439 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317439-trimmed-pair1.fastq ERR3317439-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,784,129 reads, 15,345,829 reads pseudoaligned [quant] estimated average fragment length: 245.991 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,239 rounds 52973 ERR3317439.ke.tsv 35125 ERR3317439.se.tsv 88098 total ==> ERR3317439.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 691.775 0 0 PNS24247 1044 799.009 4.89221 0.557064 PNS24249 1928 1683.01 116.444 6.29484 PNS24246 1044 799.009 4.89221 0.557064 PNS24248 1044 799.009 4.89221 0.557064 PNS24244 1471 1226.01 183.879 13.6455 PNS24243 293 111.56 31 25.2817 KQK14069 1603 1358.01 4634.81 310.514 KQK14071 474 255.038 22.6168 8.06822 ==> ERR3317439.se.tsv <== BRADI_1g14170v3 5161 BRADI_1g53295v3 149 BRADI_1g59795v3 190 BRADI_1g07683v3 0 BRADI_1g00485v3 50 BRADI_1g20270v3 1354 BRADI_1g74790v3 75 BRADI_1g09890v3 2 BRADI_1g77505v3 188 BRADI_1g48960v3 0 ERR3317439 completed mapping pipeline successfully