Starting /dee2/code/volunteer_pipeline.sh ERR3317440 current disk space = 1525104369664 free memory = 1527950148 ERR3317440 SRAfilesize 9dbb2852c71af13d8eb1b668a2f128ca ERR3317440.sra ERR3317440.sra file validated ERR3317440 is paired end ERR3317440 is conventional basespace ERR3317440 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317440_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7535 33.0 33.0 33.0 33.0 33.0 2 32.80175 33.0 33.0 33.0 33.0 33.0 3 32.75175 33.0 33.0 33.0 33.0 33.0 4 32.7655 33.0 33.0 33.0 33.0 33.0 5 32.73925 33.0 33.0 33.0 33.0 33.0 6 36.55925 37.0 37.0 37.0 37.0 37.0 7 36.65 37.0 37.0 37.0 37.0 37.0 8 36.708 37.0 37.0 37.0 37.0 37.0 9 36.6085 37.0 37.0 37.0 37.0 37.0 10-11 36.66625 37.0 37.0 37.0 37.0 37.0 12-13 36.627 37.0 37.0 37.0 37.0 37.0 14-15 36.62125 37.0 37.0 37.0 37.0 37.0 16-17 36.653125 37.0 37.0 37.0 37.0 37.0 18-19 36.648624999999996 37.0 37.0 37.0 37.0 37.0 20-21 36.61775 37.0 37.0 37.0 37.0 37.0 22-23 36.61725 37.0 37.0 37.0 37.0 37.0 24-25 36.581625 37.0 37.0 37.0 37.0 37.0 26-27 36.582125 37.0 37.0 37.0 37.0 37.0 28-29 36.51375 37.0 37.0 37.0 37.0 37.0 30-31 36.51175 37.0 37.0 37.0 37.0 37.0 32-33 36.4785 37.0 37.0 37.0 37.0 37.0 34-35 36.45525 37.0 37.0 37.0 37.0 37.0 36-37 36.462125 37.0 37.0 37.0 37.0 37.0 38-39 36.397875 37.0 37.0 37.0 37.0 37.0 40-41 36.296375 37.0 37.0 37.0 37.0 37.0 42-43 36.204375 37.0 37.0 37.0 37.0 37.0 44-45 35.947 37.0 37.0 37.0 37.0 37.0 46-47 35.84525 37.0 37.0 37.0 37.0 37.0 48-49 35.701750000000004 37.0 37.0 37.0 37.0 37.0 50-51 35.613875 37.0 37.0 37.0 37.0 37.0 52-53 35.67725 37.0 37.0 37.0 37.0 37.0 54-55 35.947 37.0 37.0 37.0 37.0 37.0 56-57 35.941 37.0 37.0 37.0 37.0 37.0 58-59 36.01775 37.0 37.0 37.0 37.0 37.0 60-61 36.130375 37.0 37.0 37.0 37.0 37.0 62-63 36.201625 37.0 37.0 37.0 37.0 37.0 64-65 36.2215 37.0 37.0 37.0 37.0 37.0 66-67 36.137 37.0 37.0 37.0 37.0 37.0 68-69 36.0875 37.0 37.0 37.0 37.0 37.0 70-71 36.002250000000004 37.0 37.0 37.0 37.0 37.0 72-73 35.96425 37.0 37.0 37.0 37.0 37.0 74-75 35.914375 37.0 37.0 37.0 37.0 37.0 76-77 35.842749999999995 37.0 37.0 37.0 37.0 37.0 78-79 35.789625 37.0 37.0 37.0 37.0 37.0 80-81 35.72825 37.0 37.0 37.0 37.0 37.0 82-83 35.52775 37.0 37.0 37.0 37.0 37.0 84-85 35.464 37.0 37.0 37.0 37.0 37.0 86-87 35.509 37.0 37.0 37.0 37.0 37.0 88-89 35.400625000000005 37.0 37.0 37.0 35.0 37.0 90-91 35.308125 37.0 37.0 37.0 33.0 37.0 92-93 35.376875 37.0 37.0 37.0 33.0 37.0 94-95 35.3985 37.0 37.0 37.0 33.0 37.0 96-97 35.273125 37.0 37.0 37.0 33.0 37.0 98-99 35.273624999999996 37.0 37.0 37.0 33.0 37.0 100-101 35.2305 37.0 37.0 37.0 33.0 37.0 102-103 35.181749999999994 37.0 37.0 37.0 33.0 37.0 104-105 35.18725 37.0 37.0 37.0 33.0 37.0 106-107 35.192125000000004 37.0 37.0 37.0 33.0 37.0 108-109 35.21 37.0 37.0 37.0 33.0 37.0 110-111 35.06625 37.0 37.0 37.0 33.0 37.0 112-113 35.072874999999996 37.0 37.0 37.0 33.0 37.0 114-115 34.959375 37.0 37.0 37.0 33.0 37.0 116-117 34.933499999999995 37.0 37.0 37.0 33.0 37.0 118-119 34.92975 37.0 37.0 37.0 33.0 37.0 120-121 34.735375000000005 37.0 37.0 37.0 33.0 37.0 122-123 34.533125 37.0 37.0 37.0 33.0 37.0 124-125 33.30125 37.0 37.0 37.0 17.5 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 2.0 7 4.0 8 7.0 9 1.0 10 0.0 11 2.0 12 2.0 13 1.0 14 2.0 15 3.0 16 3.0 17 4.0 18 3.0 19 6.0 20 5.0 21 5.0 22 7.0 23 13.0 24 24.0 25 12.0 26 16.0 27 13.0 28 12.0 29 29.0 30 44.0 31 54.0 32 49.0 33 89.0 34 130.0 35 248.0 36 3208.0 >>END_MODULE >>Per base sequence content pass #Base G A T C 1 25.662831415707853 22.161080540270135 19.684842421210604 32.491245622811405 2 25.25 21.6 19.475 33.675 3 23.175 21.6 23.724999999999998 31.5 4 26.625 19.925 20.525 32.925 5 28.825 19.45 19.025 32.7 6 27.725 23.575 23.075000000000003 25.624999999999996 7 23.625 25.4 26.3 24.675 8 24.25 26.0 28.249999999999996 21.5 9 24.6 28.1 28.199999999999996 19.1 10-11 25.124999999999996 26.337500000000002 26.2625 22.275 12-13 24.0125 25.087500000000002 28.675 22.225 14-15 23.5625 25.387500000000003 26.737499999999997 24.3125 16-17 24.7375 23.8875 25.4625 25.912499999999998 18-19 23.3625 24.875 26.325 25.4375 20-21 23.400000000000002 24.375 25.7125 26.5125 22-23 23.5375 24.15 26.275 26.0375 24-25 24.2 23.3 26.224999999999998 26.275 26-27 24.962500000000002 24.2375 25.0 25.8 28-29 24.8625 23.849999999999998 25.775 25.5125 30-31 24.325 24.349999999999998 26.0 25.324999999999996 32-33 24.4875 23.962500000000002 25.5125 26.0375 34-35 24.875 23.3375 25.124999999999996 26.6625 36-37 24.55 24.725 25.15 25.575 38-39 25.3125 24.375 25.25 25.0625 40-41 24.818432256448787 23.99198597545705 24.70573503631355 26.483846731780613 42-43 25.524431604069843 23.979399572917977 25.03454339907047 25.461625423941715 44-45 24.46606849488184 24.352331606217618 24.97156577783394 26.2100341210666 46-47 24.892377817168903 23.575588756647253 24.75310205115219 26.778931375031657 48-49 24.755493458656165 24.590372158008382 26.000254032770226 24.65388035056522 50-51 24.341183959261617 24.290260980267345 25.60152768936983 25.767027371101207 52-53 24.987283825025433 24.275178026449645 25.419633774160733 25.317904374364193 54-55 25.40880503144654 25.345911949685533 25.069182389937104 24.17610062893082 56-57 24.600879949717157 24.135763670647393 24.94028912633564 26.323067253299808 58-59 25.203966361240116 23.522028367013935 25.191414585163802 26.08259068658215 60-61 23.875 25.2125 25.3125 25.6 62-63 25.112499999999997 24.95 24.9125 25.025 64-65 24.325 23.799999999999997 25.337500000000002 26.5375 66-67 25.1875 23.65 24.925 26.237500000000004 68-69 25.337500000000002 23.875 25.637500000000003 25.15 70-71 25.724999999999998 23.7875 25.112499999999997 25.374999999999996 72-73 24.525 25.1875 25.25 25.0375 74-75 24.75 24.525 26.150000000000002 24.575 76-77 25.1875 24.3 23.8125 26.700000000000003 78-79 23.7 26.487500000000004 25.2375 24.575 80-81 24.85 24.8625 24.825 25.4625 82-83 24.95 24.9 24.2375 25.912499999999998 84-85 24.775 24.337500000000002 26.1125 24.775 86-87 25.1 25.0125 24.525 25.362499999999997 88-89 24.975 23.9 24.0375 27.0875 90-91 24.8625 25.0125 25.124999999999996 25.0 92-93 25.2875 25.662499999999998 24.2375 24.8125 94-95 25.362499999999997 24.349999999999998 23.5 26.787499999999998 96-97 25.35 23.35 26.9625 24.337500000000002 98-99 25.637500000000003 24.1625 24.1125 26.087500000000002 100-101 24.6625 23.9 24.712500000000002 26.724999999999998 102-103 24.8625 24.625 25.95 24.5625 104-105 26.1625 24.9375 23.3375 25.5625 106-107 26.5875 23.3375 23.6125 26.4625 108-109 24.6625 25.0375 25.2125 25.087500000000002 110-111 26.1125 24.6 24.425 24.8625 112-113 24.837500000000002 25.15 24.875 25.137500000000003 114-115 25.0375 25.55 24.4875 24.925 116-117 24.212500000000002 26.174999999999997 24.6 25.0125 118-119 25.05 24.925 23.4625 26.5625 120-121 24.8125 25.5 24.8625 24.825 122-123 25.31613872542882 25.22849630649806 23.801176912482784 25.654188055590332 124-125 25.725725725725724 25.33783783783784 23.51101101101101 25.425425425425423 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 6.0 1 5.0 2 4.5 3 4.5 4 3.5 5 2.0 6 1.0 7 1.5 8 1.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 2.0 25 3.5 26 3.5 27 3.5 28 5.0 29 8.0 30 8.5 31 9.5 32 20.0 33 23.5 34 22.5 35 30.0 36 35.5 37 52.5 38 79.0 39 89.0 40 119.0 41 146.0 42 159.0 43 164.5 44 174.5 45 180.5 46 170.0 47 172.0 48 166.0 49 158.5 50 151.5 51 129.0 52 123.5 53 121.5 54 105.0 55 100.5 56 83.5 57 78.5 58 86.5 59 77.5 60 68.5 61 80.5 62 88.0 63 69.5 64 59.0 65 51.5 66 50.5 67 60.0 68 51.5 69 49.5 70 44.5 71 38.0 72 47.0 73 43.0 74 28.5 75 19.5 76 14.5 77 11.5 78 9.0 79 5.5 80 4.5 81 5.0 82 2.5 83 0.5 84 1.0 85 1.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.17500000000000002 42-43 0.4875 44-45 1.0875 46-47 1.275 48-49 1.5875 50-51 1.8124999999999998 52-53 1.7000000000000002 54-55 0.625 56-57 0.5625 58-59 0.41250000000000003 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.1625 124-125 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.8 #Duplication Level Percentage of deduplicated Percentage of total 1 97.83402922755741 93.72500000000001 2 1.4874739039665972 2.85 3 0.2870563674321503 0.8250000000000001 4 0.052192066805845504 0.2 5 0.18267223382045927 0.8750000000000001 6 0.052192066805845504 0.3 7 0.0 0.0 8 0.026096033402922752 0.2 9 0.0 0.0 >10 0.07828810020876827 1.0250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TATCCCCTGCTTCCCCGCTTCCTCTTCCTCCTCCCCCTCACTCCCCAAGC 18 0.44999999999999996 No Hit CCACGCACACCAGAGCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCA 13 0.325 No Hit CCCCCTACCAAGCAGCAGCCATGGCAGCGTCTCTCCAGGCCGCCGCCACC 10 0.25 No Hit TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 8 0.2 No Hit GCTCTGCACACTCACGTCTCACTCTTGGAGAACACAGGACACCTCCGGTC 6 0.15 No Hit TTGGGGATGATTCTGTATTACAATTTGGTGGAGGAACTTTAGGACATCCT 6 0.15 No Hit CTCCTCCGTGCTGGGATTTCTCTTTGTTGGTAGCTTGGAGCGTGCGGGGC 5 0.125 No Hit CCAAATCCTCCCCCGCCCCCGTCCGGCACCTCCCTCCCTCTTCTTCCTCC 5 0.125 No Hit TATGTACCTTTTTCACACGTTTGTTTCATGTTGTATTTATGCATGTGATC 5 0.125 No Hit CGGTCTGCATCCTCCCGTCGCCGCCATGGACGGCGTCGTCGGCCAGATCT 5 0.125 No Hit CTCCTCCACCGCCACCGCCTCCTCGCGTCCTCATCCCCTGCTCCTCGACT 5 0.125 No Hit ACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCA 5 0.125 No Hit AACACGGACCAAGGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.225 0.0 0.0 0.0 0.0 6 0.35 0.0 0.0 0.0 0.0 7 0.7 0.0 0.0 0.0 0.0 8 1.0 0.0 0.0 0.0 0.0 9 1.025 0.0 0.0 0.0 0.0 10-11 1.05 0.0 0.0 0.0 0.0 12-13 1.05 0.0 0.0 0.0 0.0 14-15 1.05 0.0 0.0125 0.0 0.0 16-17 1.05 0.0 0.025 0.0 0.0 18-19 1.05 0.0 0.025 0.0 0.0 20-21 1.05 0.0 0.025 0.0 0.0 22-23 1.0875 0.0 0.025 0.0 0.0 24-25 1.1 0.0 0.025 0.0 0.0 26-27 1.1 0.0 0.025 0.0 0.0 28-29 1.1125 0.0 0.025 0.0 0.0 30-31 1.125 0.0 0.025 0.0 0.0 32-33 1.125 0.0 0.025 0.0 0.0 34-35 1.125 0.0 0.025 0.0 0.0 36-37 1.1375 0.0 0.025 0.0 0.0 38-39 1.1625 0.0 0.025 0.0 0.0 40-41 1.1875 0.0 0.025 0.0 0.0 42-43 1.25 0.0 0.025 0.0 0.0 44-45 1.275 0.0 0.025 0.0 0.0 46-47 1.275 0.0 0.025 0.0 0.0 48-49 1.3125 0.0 0.025 0.0 0.0 50-51 1.375 0.0 0.025 0.0 0.0 52-53 1.4249999999999998 0.0 0.025 0.0 0.0 54-55 1.5 0.0 0.025 0.0 0.0 56-57 1.6 0.0 0.025 0.0 0.0 58-59 1.6375 0.0 0.025 0.0 0.0 60-61 1.7125 0.0 0.025 0.0 0.0 62-63 1.7875 0.0 0.025 0.0 0.0 64-65 1.8625 0.0 0.025 0.0 0.0 66-67 1.9874999999999998 0.0 0.025 0.0 0.0 68-69 2.0999999999999996 0.0 0.025 0.0 0.0 70-71 2.3125 0.0 0.025 0.0 0.0 72-73 2.3875 0.0 0.025 0.0 0.0 74-75 2.5125 0.0 0.025 0.0 0.0 76-77 2.7 0.0 0.025 0.0 0.0 78-79 2.825 0.0 0.025 0.0 0.0 80-81 3.1125 0.0 0.025 0.0 0.0 82-83 3.3499999999999996 0.0 0.025 0.0 0.0 84-85 3.5375 0.0 0.025 0.0 0.0 86-87 3.8875 0.0 0.025 0.0 0.0 88-89 4.0625 0.0 0.025 0.0 0.0 90-91 4.35 0.0 0.025 0.0 0.0 92-93 4.6875 0.0 0.025 0.0 0.0 94-95 4.95 0.0 0.025 0.0 0.0 96-97 5.15 0.0 0.025 0.0 0.0 98-99 5.325 0.0 0.025 0.0 0.0 100-101 5.5 0.0 0.025 0.0 0.0 102-103 5.75 0.0 0.025 0.0 0.0 104-105 6.0 0.0 0.025 0.0 0.0 106-107 6.3 0.0 0.025 0.0 0.0 108-109 6.5125 0.0 0.025 0.0 0.0 110-111 6.7375 0.0 0.025 0.0 0.0 112-113 7.075 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317440 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317440_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.41925 33.0 33.0 33.0 33.0 33.0 2 32.48875 33.0 33.0 33.0 33.0 33.0 3 32.466 33.0 33.0 33.0 33.0 33.0 4 32.428 33.0 33.0 33.0 33.0 33.0 5 32.42775 33.0 33.0 33.0 33.0 33.0 6 36.21525 37.0 37.0 37.0 37.0 37.0 7 36.23575 37.0 37.0 37.0 37.0 37.0 8 36.20325 37.0 37.0 37.0 37.0 37.0 9 36.21675 37.0 37.0 37.0 37.0 37.0 10-11 36.235 37.0 37.0 37.0 37.0 37.0 12-13 36.207125000000005 37.0 37.0 37.0 37.0 37.0 14-15 36.210375 37.0 37.0 37.0 37.0 37.0 16-17 36.206875 37.0 37.0 37.0 37.0 37.0 18-19 36.183625 37.0 37.0 37.0 37.0 37.0 20-21 36.196625 37.0 37.0 37.0 37.0 37.0 22-23 36.217875 37.0 37.0 37.0 37.0 37.0 24-25 36.237624999999994 37.0 37.0 37.0 37.0 37.0 26-27 36.170625 37.0 37.0 37.0 37.0 37.0 28-29 36.2545 37.0 37.0 37.0 37.0 37.0 30-31 36.261875 37.0 37.0 37.0 37.0 37.0 32-33 36.25075 37.0 37.0 37.0 37.0 37.0 34-35 36.23725 37.0 37.0 37.0 37.0 37.0 36-37 36.273125 37.0 37.0 37.0 37.0 37.0 38-39 36.266999999999996 37.0 37.0 37.0 37.0 37.0 40-41 36.254625000000004 37.0 37.0 37.0 37.0 37.0 42-43 36.230375 37.0 37.0 37.0 37.0 37.0 44-45 36.257000000000005 37.0 37.0 37.0 37.0 37.0 46-47 36.238749999999996 37.0 37.0 37.0 37.0 37.0 48-49 36.194125 37.0 37.0 37.0 37.0 37.0 50-51 36.197375 37.0 37.0 37.0 37.0 37.0 52-53 36.210125 37.0 37.0 37.0 37.0 37.0 54-55 36.131 37.0 37.0 37.0 37.0 37.0 56-57 36.039874999999995 37.0 37.0 37.0 37.0 37.0 58-59 35.91437500000001 37.0 37.0 37.0 37.0 37.0 60-61 35.94775 37.0 37.0 37.0 37.0 37.0 62-63 35.942625 37.0 37.0 37.0 37.0 37.0 64-65 36.043 37.0 37.0 37.0 37.0 37.0 66-67 36.09 37.0 37.0 37.0 37.0 37.0 68-69 36.130875 37.0 37.0 37.0 37.0 37.0 70-71 36.1055 37.0 37.0 37.0 37.0 37.0 72-73 36.049499999999995 37.0 37.0 37.0 37.0 37.0 74-75 35.916 37.0 37.0 37.0 37.0 37.0 76-77 35.715374999999995 37.0 37.0 37.0 37.0 37.0 78-79 35.69125 37.0 37.0 37.0 37.0 37.0 80-81 35.601124999999996 37.0 37.0 37.0 37.0 37.0 82-83 35.56725 37.0 37.0 37.0 37.0 37.0 84-85 35.543625 37.0 37.0 37.0 37.0 37.0 86-87 35.548500000000004 37.0 37.0 37.0 37.0 37.0 88-89 35.517375 37.0 37.0 37.0 37.0 37.0 90-91 35.501374999999996 37.0 37.0 37.0 37.0 37.0 92-93 35.462125 37.0 37.0 37.0 37.0 37.0 94-95 35.430125 37.0 37.0 37.0 37.0 37.0 96-97 35.403375 37.0 37.0 37.0 37.0 37.0 98-99 35.42875 37.0 37.0 37.0 37.0 37.0 100-101 35.368375 37.0 37.0 37.0 37.0 37.0 102-103 35.326125 37.0 37.0 37.0 37.0 37.0 104-105 35.332499999999996 37.0 37.0 37.0 37.0 37.0 106-107 35.34525 37.0 37.0 37.0 37.0 37.0 108-109 35.269125 37.0 37.0 37.0 37.0 37.0 110-111 35.195875 37.0 37.0 37.0 35.0 37.0 112-113 35.144875 37.0 37.0 37.0 35.0 37.0 114-115 35.0845 37.0 37.0 37.0 33.0 37.0 116-117 35.091375 37.0 37.0 37.0 33.0 37.0 118-119 34.985749999999996 37.0 37.0 37.0 33.0 37.0 120-121 34.908500000000004 37.0 37.0 37.0 33.0 37.0 122-123 34.753 37.0 37.0 37.0 33.0 37.0 124-125 33.088125 37.0 35.0 37.0 17.5 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 31.0 3 3.0 4 1.0 5 2.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 1.0 12 0.0 13 1.0 14 3.0 15 0.0 16 5.0 17 2.0 18 5.0 19 2.0 20 6.0 21 10.0 22 46.0 23 8.0 24 13.0 25 6.0 26 16.0 27 9.0 28 16.0 29 8.0 30 27.0 31 21.0 32 21.0 33 53.0 34 99.0 35 190.0 36 3393.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.824999999999996 14.975 22.775000000000002 29.425 2 29.525000000000002 14.475 22.525000000000002 33.475 3 26.431607901975497 14.403600900225054 25.681420355088775 33.48337084271068 4 27.95994993742178 13.366708385481852 24.25531914893617 34.4180225281602 5 31.013767209011263 16.09511889862328 20.35043804755945 32.540675844806 6 33.49198396793587 16.85871743486974 25.425851703406817 24.223446893787575 7 27.37975951903808 25.701402805611224 30.886773547094187 16.03206412825651 8 20.465931863727455 25.425851703406817 35.14529058116233 18.962925851703407 9 26.377755511022045 27.70541082164329 28.632264529058116 17.284569138276552 10-11 24.032561051972447 26.587351283656858 29.392611145898563 19.987476518472135 12-13 21.039448966812774 26.03631809643081 29.718221665623044 23.206011271133377 14-15 20.89178356713427 25.738977955911825 27.880761523046093 25.488476953907817 16-17 20.62875751503006 25.125250501002007 26.77855711422846 27.467434869739478 18-19 25.062625250501004 25.663827655310623 23.70991983967936 25.56362725450902 20-21 22.006513026052104 28.557114228456914 26.866232464929862 22.57014028056112 22-23 22.005257228689448 23.732632369508075 27.087244961822503 27.17486543997997 24-25 23.42263395092639 26.652478718077116 24.949924887330997 24.9749624436655 26-27 23.776748842447752 26.2670504317357 24.2898260543111 25.666374671505444 28-29 24.662331165582792 25.950475237618807 23.036518259129565 26.350675337668832 30-31 23.58089522380595 27.219304826206553 24.69367341835459 24.50612653163291 32-33 23.200000000000003 27.950000000000003 24.575 24.275 34-35 23.3875 26.6125 23.525 26.474999999999998 36-37 23.3875 25.337500000000002 25.387500000000003 25.887500000000003 38-39 23.45 26.737499999999997 25.45 24.3625 40-41 23.275000000000002 26.5875 23.4125 26.724999999999998 42-43 23.325000000000003 27.212500000000002 24.2875 25.174999999999997 44-45 24.175 26.674999999999997 24.5125 24.637500000000003 46-47 24.575 26.474999999999998 23.4625 25.4875 48-49 23.175 27.125 25.3 24.4 50-51 25.424999999999997 26.5875 23.625 24.3625 52-53 23.6875 26.174999999999997 23.8875 26.25 54-55 23.519098309329994 26.587351283656858 24.370695053224797 25.522855353788355 56-57 24.18727249905862 26.83569725116104 24.300238483745453 24.676791766034896 58-59 23.90428211586902 26.561712846347607 23.879093198992443 25.654911838790934 60-61 22.696374622356497 27.177744209466265 25.151057401812686 24.97482376636455 62-63 24.251195570098165 27.39743267052605 23.634533098414295 24.71683866096149 64-65 23.524262131065534 26.613306653326664 24.399699849924964 25.46273136568284 66-67 23.067300475356518 27.5331498623968 24.49337002752064 24.906179634726044 68-69 23.2375 28.625 23.1125 25.025 70-71 23.599999999999998 27.750000000000004 22.912499999999998 25.7375 72-73 24.05 27.1625 23.4625 25.324999999999996 74-75 24.637500000000003 27.187499999999996 23.549999999999997 24.625 76-77 23.377922240280036 27.50343792974122 22.96537067133392 26.153269158644832 78-79 23.36168084042021 27.63881940970485 23.6368184092046 25.362681340670335 80-81 24.92800801302116 26.142481532490297 23.688493802428948 25.241016652059596 82-83 24.160821643286575 25.964428857715433 24.04809619238477 25.826653306613228 84-85 24.09819639278557 26.039579158316634 24.66182364729459 25.200400801603205 86-87 24.862224448897795 26.54058116232465 23.309118236472944 25.288076152304612 88-89 24.91544532130778 25.792308655893777 23.750469748214957 25.541776274583487 90-91 24.762024048096194 26.57815631262525 23.935370741482966 24.724448897795593 92-93 24.69939879759519 26.65330661322645 23.246492985971944 25.400801603206414 94-95 25.488476953907817 25.751503006012022 23.446893787575153 25.313126252505008 96-97 25.425851703406817 26.127254509018037 24.223446893787575 24.223446893787575 98-99 24.793388429752067 26.208364638116706 23.22814926120711 25.77009767092412 100-101 25.26302605210421 26.27755511022044 23.246492985971944 25.212925851703403 102-103 25.30361837986728 26.818580192813325 22.62426442969826 25.253536997621133 104-105 24.91552997121762 26.955324740332877 23.188587160555624 24.94055812789388 106-107 26.151151151151154 25.675675675675674 23.123123123123122 25.05005005005005 108-109 25.618904726181547 26.731682920730183 23.243310827706924 24.406101525381345 110-111 26.000500250125064 27.07603801900951 22.823911955977987 24.099549774887443 112-113 24.406101525381345 26.619154788697173 23.868467116779193 25.10627656914228 114-115 24.353044130516317 26.365795724465556 24.153019127390923 25.128141017627204 116-117 26.025 26.525 23.2125 24.2375 118-119 25.412499999999998 25.5625 24.1875 24.837500000000002 120-121 25.324999999999996 27.1375 24.3 23.2375 122-123 25.525 27.0875 23.5625 23.825 124-125 25.137500000000003 27.1625 23.275000000000002 24.425 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 5.0 2 3.0 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.5 14 1.5 15 0.5 16 0.0 17 0.5 18 1.0 19 1.5 20 1.5 21 1.5 22 1.5 23 2.0 24 4.0 25 6.5 26 6.0 27 7.0 28 8.0 29 5.5 30 9.0 31 16.0 32 21.5 33 25.0 34 38.5 35 55.0 36 63.0 37 73.5 38 82.5 39 100.5 40 122.5 41 133.0 42 175.5 43 201.5 44 180.0 45 179.0 46 171.5 47 163.0 48 171.0 49 154.5 50 138.0 51 136.5 52 132.5 53 123.0 54 110.5 55 101.0 56 91.5 57 78.5 58 69.5 59 65.0 60 60.5 61 62.0 62 58.5 63 51.0 64 55.5 65 53.5 66 47.5 67 47.0 68 42.0 69 39.5 70 34.5 71 32.0 72 36.5 73 34.0 74 25.5 75 17.0 76 13.0 77 14.0 78 11.5 79 8.0 80 5.5 81 3.0 82 1.5 83 1.0 84 0.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.125 5 0.125 6 0.2 7 0.2 8 0.2 9 0.2 10-11 0.1875 12-13 0.1875 14-15 0.2 16-17 0.2 18-19 0.2 20-21 0.2 22-23 0.13749999999999998 24-25 0.15 26-27 0.11249999999999999 28-29 0.05 30-31 0.025 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.1875 56-57 0.41250000000000003 58-59 0.75 60-61 0.7000000000000001 62-63 0.675 64-65 0.05 66-67 0.075 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0125 78-79 0.05 80-81 0.1625 82-83 0.2 84-85 0.2 86-87 0.2 88-89 0.21250000000000002 90-91 0.2 92-93 0.2 94-95 0.2 96-97 0.2 98-99 0.17500000000000002 100-101 0.2 102-103 0.1625 104-105 0.11249999999999999 106-107 0.1 108-109 0.025 110-111 0.05 112-113 0.025 114-115 0.0125 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19110212335693 98.1 2 0.6572295247724975 1.3 3 0.05055611729019212 0.15 4 0.05055611729019212 0.2 5 0.05055611729019212 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 5 0.125 No Hit CCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.225 0.0 0.0 0.0 0.0 6 0.425 0.0 0.0 0.0 0.0 7 0.775 0.0 0.0 0.0 0.0 8 1.1 0.0 0.0 0.0 0.0 9 1.125 0.0 0.0 0.0 0.0 10-11 1.15 0.0 0.0 0.0 0.0 12-13 1.15 0.0 0.0 0.0 0.0 14-15 1.15 0.0 0.0 0.0 0.0 16-17 1.15 0.0 0.0 0.0 0.0 18-19 1.15 0.0 0.0 0.0 0.0 20-21 1.15 0.0 0.0 0.0 0.0 22-23 1.175 0.0 0.0 0.0 0.0 24-25 1.1875 0.0 0.0 0.0 0.0 26-27 1.2 0.0 0.0 0.0 0.0 28-29 1.2125 0.0 0.0 0.0 0.0 30-31 1.225 0.0 0.0 0.0 0.0 32-33 1.225 0.0 0.0 0.0 0.0 34-35 1.225 0.0 0.0 0.0 0.0 36-37 1.225 0.0 0.0 0.0 0.0 38-39 1.2375 0.0 0.0 0.0 0.0 40-41 1.2625 0.0 0.0 0.0 0.0 42-43 1.3 0.0 0.0 0.0 0.0 44-45 1.3 0.0 0.0 0.0 0.0 46-47 1.325 0.0 0.0 0.0 0.0 48-49 1.3625 0.0 0.0 0.0 0.0 50-51 1.4249999999999998 0.0 0.0 0.0 0.0 52-53 1.4625 0.0 0.0 0.0 0.0 54-55 1.525 0.0 0.0 0.0 0.0 56-57 1.6125 0.0 0.0 0.0 0.0 58-59 1.6375 0.0 0.0 0.0 0.0 60-61 1.725 0.0 0.0 0.0 0.0 62-63 1.7875 0.0 0.0 0.0 0.0 64-65 1.85 0.0 0.0 0.0 0.0 66-67 1.9625 0.0 0.0 0.0 0.0 68-69 2.0375 0.0 0.0 0.0 0.0 70-71 2.2375 0.0 0.0 0.0 0.0 72-73 2.3 0.0 0.0 0.0 0.0 74-75 2.4000000000000004 0.0 0.0 0.0 0.0 76-77 2.625 0.0 0.0 0.0 0.0 78-79 2.7125 0.0 0.0 0.0 0.0 80-81 2.95 0.0 0.0 0.0 0.0 82-83 3.175 0.0 0.0 0.0 0.0 84-85 3.3875 0.0 0.0 0.0 0.0 86-87 3.675 0.0 0.0 0.0 0.0 88-89 3.8375 0.0 0.0 0.0 0.0 90-91 4.0875 0.0 0.0 0.0 0.0 92-93 4.3625 0.0 0.0 0.0 0.0 94-95 4.550000000000001 0.0 0.0 0.0 0.0 96-97 4.737500000000001 0.0 0.0 0.0 0.0 98-99 4.875 0.0 0.0 0.0 0.0 100-101 5.0375 0.0 0.0 0.0 0.0 102-103 5.324999999999999 0.0 0.0 0.0 0.0 104-105 5.5875 0.0 0.0 0.0 0.0 106-107 5.85 0.0 0.0 0.0 0.0 108-109 6.0625 0.0 0.0 0.0 0.0 110-111 6.275 0.0 0.0 0.0 0.0 112-113 6.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGTGTG 15 2.5068579E-4 119.0 5 GTGCTCT 45 3.3069227E-8 79.33333 9 GTGTGCT 50 6.8675945E-8 71.4 7 TGTGCTC 50 6.8675945E-8 71.4 8 GGTGTGC 35 8.085533E-5 68.0 6 CGATCTA 20 1.667234E-4 59.499996 18-19 TTCCGAT 45 4.543039E-6 39.666664 14-15 TGCTCTT 45 4.543039E-6 39.666664 10-11 TCCGATC 45 4.543039E-6 39.666664 16-17 TCTTCCG 45 4.543039E-6 39.666664 12-13 CCGATCT 45 4.543039E-6 39.666664 16-17 CTCTTCC 50 9.365898E-6 35.7 12-13 GCTCTTC 50 9.365898E-6 35.7 10-11 CTTCCGA 50 9.365898E-6 35.7 14-15 >>END_MODULE Read 826317 spots for ERR3317440.sra Written 826317 spots for ERR3317440.sra Read 826317 spots for ERR3317440.sra Written 826317 spots for ERR3317440.sra Read 826317 spots for ERR3317440.sra Written 826317 spots for ERR3317440.sra Read 826317 spots for ERR3317440.sra Written 826317 spots for ERR3317440.sra Read 826317 spots for ERR3317440.sra Written 826317 spots for ERR3317440.sra Read 826317 spots for ERR3317440.sra Written 826317 spots for ERR3317440.sra Read 826317 spots for ERR3317440.sra Written 826317 spots for ERR3317440.sra Read 826317 spots for ERR3317440.sra Written 826317 spots for ERR3317440.sra Read 826317 spots for ERR3317440.sra Written 826317 spots for ERR3317440.sra Read 826317 spots for ERR3317440.sra Written 826317 spots for ERR3317440.sra Read 826317 spots for ERR3317440.sra Written 826317 spots for ERR3317440.sra Read 826317 spots for ERR3317440.sra Written 826317 spots for ERR3317440.sra Read 826317 spots for ERR3317440.sra Written 826317 spots for ERR3317440.sra Read 826317 spots for ERR3317440.sra Written 826317 spots for ERR3317440.sra Read 826317 spots for ERR3317440.sra Written 826317 spots for ERR3317440.sra Read 826327 spots for ERR3317440.sra Written 826327 spots for ERR3317440.sra Read 826317 spots for ERR3317440.sra Written 826317 spots for ERR3317440.sra Read 826317 spots for ERR3317440.sra Written 826317 spots for ERR3317440.sra Read 826317 spots for ERR3317440.sra Written 826317 spots for ERR3317440.sra Read 826317 spots for ERR3317440.sra Written 826317 spots for ERR3317440.sra SRR ids: ['ERR3317440.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_459b7vqv ERR3317440.sra spots: 16526350 blocks: [[1, 826317], [826318, 1652634], [1652635, 2478951], [2478952, 3305268], [3305269, 4131585], [4131586, 4957902], [4957903, 5784219], [5784220, 6610536], [6610537, 7436853], [7436854, 8263170], [8263171, 9089487], [9089488, 9915804], [9915805, 10742121], [10742122, 11568438], [11568439, 12394755], [12394756, 13221072], [13221073, 14047389], [14047390, 14873706], [14873707, 15700023], [15700024, 16526350]] ERR3317440 file size 4739308 ERR3317440 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317440 ERR3317440_1.fastq ERR3317440_2.fastq Input file: ERR3317440_1.fastq Paired file: ERR3317440_2.fastq trimmed: ERR3317440-trimmed-pair1.fastq, ERR3317440-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:21:58 2024 >> started Tue Dec 10 09:22:15 2024 >> done (17.804s) 16526350 read pairs processed; of these: 263902 ( 1.60%) short read pairs filtered out after trimming by size control 140995 ( 0.85%) empty read pairs filtered out after trimming by size control 16121453 (97.55%) read pairs available; of these: 4436819 (27.52%) trimmed read pairs available after processing 11684634 (72.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 632 0.00% 19 2317 0.01% 20 2512 0.02% 21 4818 0.03% 22 1596 0.01% 23 1586 0.01% 24 855 0.01% 25 987 0.01% 26 1137 0.01% 27 1479 0.01% 28 1524 0.01% 29 1267 0.01% 30 1045 0.01% 31 1712 0.01% 32 1378 0.01% 33 1735 0.01% 34 1952 0.01% 35 3483 0.02% 36 1880 0.01% 37 1740 0.01% 38 2020 0.01% 39 2339 0.01% 40 2399 0.01% 41 2485 0.02% 42 2834 0.02% 43 3092 0.02% 44 3539 0.02% 45 3316 0.02% 46 3523 0.02% 47 3674 0.02% 48 3802 0.02% 49 4005 0.02% 50 4391 0.03% 51 4241 0.03% 52 4764 0.03% 53 5101 0.03% 54 5409 0.03% 55 5303 0.03% 56 5418 0.03% 57 5951 0.04% 58 6151 0.04% 59 6707 0.04% 60 7427 0.05% 61 7518 0.05% 62 7913 0.05% 63 8663 0.05% 64 9651 0.06% 65 8232 0.05% 66 9064 0.06% 67 9667 0.06% 68 9632 0.06% 69 9944 0.06% 70 10485 0.07% 71 13798 0.09% 72 15829 0.10% 73 17505 0.11% 74 17488 0.11% 75 16859 0.10% 76 17470 0.11% 77 17970 0.11% 78 17682 0.11% 79 17904 0.11% 80 19045 0.12% 81 18775 0.12% 82 18851 0.12% 83 20262 0.13% 84 20418 0.13% 85 21064 0.13% 86 21472 0.13% 87 22008 0.14% 88 22891 0.14% 89 24707 0.15% 90 23793 0.15% 91 23369 0.14% 92 24762 0.15% 93 24503 0.15% 94 25691 0.16% 95 26984 0.17% 96 27868 0.17% 97 29165 0.18% 98 30569 0.19% 99 32522 0.20% 100 33682 0.21% 101 34001 0.21% 102 31410 0.19% 103 30976 0.19% 104 31832 0.20% 105 32329 0.20% 106 33288 0.21% 107 33819 0.21% 108 33575 0.21% 109 35436 0.22% 110 36160 0.22% 111 37856 0.23% 112 40067 0.25% 113 42402 0.26% 114 44825 0.28% 115 47646 0.30% 116 50059 0.31% 117 55048 0.34% 118 61719 0.38% 119 70990 0.44% 120 85815 0.53% 121 108977 0.68% 122 157886 0.98% 123 308589 1.91% 124 2102913 13.04% 125 11684634 72.48% 16121453 reads passed initial QC criterion=sequence-density sequence-density=0.98 sequence-density-rank=1 fanout-score=60.04 fanout-score-rank=5 prefix-density=1.12 prefix-fanout=52.7 sequence=AGATCGGAAGAGCACACC criterion=fanout-score sequence-density=0.13 sequence-density-rank=21 fanout-score=151.13 fanout-score-rank=1 prefix-density=1.07 prefix-fanout=18.5 sequence=CGCCGCCGCCGC criterion=sequence-density sequence-density=7.02 sequence-density-rank=1 fanout-score=34.67 fanout-score-rank=2 prefix-density=7.14 prefix-fanout=34.1 sequence=GGTGTGCTCTTCCGATCT criterion=fanout-score sequence-density=0.56 sequence-density-rank=18 fanout-score=40.81 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=40.8 sequence=CCGTGTGCTCTTC Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACC -y GGTGTGCTCTTCCGATCT -o ERR3317440 ERR3317440_1.fastq ERR3317440_2.fastq Input file: ERR3317440_1.fastq Paired file: ERR3317440_2.fastq trimmed: ERR3317440-trimmed-pair1.fastq, ERR3317440-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACC -- paired 3' end adapter sequence (-y): GGTGTGCTCTTCCGATCT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:23:28 2024 >> started Tue Dec 10 09:23:38 2024 >> done (9.875s) 9672872 read pairs processed; of these: 2151 ( 0.02%) short read pairs filtered out after trimming by size control 741 ( 0.01%) empty read pairs filtered out after trimming by size control 9669980 (99.97%) read pairs available; of these: 2226 ( 0.02%) trimmed read pairs available after processing 9667754 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 394 0.00% 19 1441 0.01% 20 1505 0.02% 21 2901 0.03% 22 988 0.01% 23 827 0.01% 24 527 0.01% 25 606 0.01% 26 693 0.01% 27 928 0.01% 28 960 0.01% 29 788 0.01% 30 620 0.01% 31 1034 0.01% 32 848 0.01% 33 1051 0.01% 34 1184 0.01% 35 2115 0.02% 36 1147 0.01% 37 1013 0.01% 38 1191 0.01% 39 1433 0.01% 40 1444 0.01% 41 1479 0.02% 42 1694 0.02% 43 1841 0.02% 44 2102 0.02% 45 1977 0.02% 46 2101 0.02% 47 2189 0.02% 48 2244 0.02% 49 2474 0.03% 50 2625 0.03% 51 2585 0.03% 52 2867 0.03% 53 3047 0.03% 54 3317 0.03% 55 3235 0.03% 56 3238 0.03% 57 3595 0.04% 58 3744 0.04% 59 4017 0.04% 60 4478 0.05% 61 4498 0.05% 62 4749 0.05% 63 5295 0.05% 64 5808 0.06% 65 5002 0.05% 66 5380 0.06% 67 5828 0.06% 68 5874 0.06% 69 5936 0.06% 70 6322 0.07% 71 8296 0.09% 72 9554 0.10% 73 10401 0.11% 74 10573 0.11% 75 10199 0.11% 76 10592 0.11% 77 10753 0.11% 78 10670 0.11% 79 10793 0.11% 80 11445 0.12% 81 11291 0.12% 82 11254 0.12% 83 12218 0.13% 84 12350 0.13% 85 12666 0.13% 86 12876 0.13% 87 13129 0.14% 88 13696 0.14% 89 14722 0.15% 90 14249 0.15% 91 14057 0.15% 92 14857 0.15% 93 14641 0.15% 94 15311 0.16% 95 16105 0.17% 96 16736 0.17% 97 17414 0.18% 98 18376 0.19% 99 19352 0.20% 100 20187 0.21% 101 20335 0.21% 102 18853 0.19% 103 18499 0.19% 104 19062 0.20% 105 19407 0.20% 106 19914 0.21% 107 20200 0.21% 108 20243 0.21% 109 21240 0.22% 110 21855 0.23% 111 22666 0.23% 112 24109 0.25% 113 25375 0.26% 114 26880 0.28% 115 28544 0.30% 116 30142 0.31% 117 33193 0.34% 118 37113 0.38% 119 42610 0.44% 120 51620 0.53% 121 65493 0.68% 122 94442 0.98% 123 185459 1.92% 124 1260916 13.04% 125 7007868 72.47% criterion=sequence-density sequence-density=0.97 sequence-density-rank=1 fanout-score=60.26 fanout-score-rank=5 prefix-density=1.10 prefix-fanout=52.8 sequence=AGATCGGAAGAGCACACC criterion=fanout-score sequence-density=0.13 sequence-density-rank=23 fanout-score=159.80 fanout-score-rank=1 prefix-density=1.07 prefix-fanout=19.0 sequence=CGCCGCCGCCGC criterion=sequence-density sequence-density=6.93 sequence-density-rank=1 fanout-score=34.62 fanout-score-rank=3 prefix-density=7.06 prefix-fanout=34.0 sequence=GGTGTGCTCTTCCGATCT criterion=fanout-score sequence-density=0.55 sequence-density-rank=18 fanout-score=39.40 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=39.4 sequence=CCGTGTGCTCTTC ERR3317440 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:24:33 Started mapping on | Dec 10 09:24:33 Finished on | Dec 10 09:25:26 Mapping speed, Million of reads per hour | 1094.85 Number of input reads | 16118561 Average input read length | 243 UNIQUE READS: Uniquely mapped reads number | 14511966 Uniquely mapped reads % | 90.03% Average mapped length | 239.35 Number of splices: Total | 9820116 Number of splices: Annotated (sjdb) | 9300489 Number of splices: GT/AG | 9680932 Number of splices: GC/AG | 115674 Number of splices: AT/AC | 9040 Number of splices: Non-canonical | 14470 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.00% Deletion average length | 1.26 Insertion rate per base | 0.00% Insertion average length | 1.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 848944 % of reads mapped to multiple loci | 5.27% Number of reads mapped to too many loci | 68836 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.74% % of reads unmapped: other | 2.53% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 779744 779744 779744 N_multimapping 848944 848944 848944 N_noFeature 531736 3342362 11418453 N_ambiguous 431023 142000 49463 UnstrandedReadsAssigned:13549207 PositiveStrandReadsAssigned:11027604 NegativeStrandReadsAssigned:3044050 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 ERR3317440 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317440-trimmed-pair1.fastq ERR3317440-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,118,561 reads, 14,821,915 reads pseudoaligned [quant] estimated average fragment length: 272.609 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52973 ERR3317440.ke.tsv 35125 ERR3317440.se.tsv 88098 total ==> ERR3317440.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 665.567 0 0 PNS24247 1044 772.391 16.4279 1.90698 PNS24249 1928 1656.39 51.0102 2.76118 PNS24246 1044 772.391 16.4279 1.90698 PNS24248 1044 772.391 16.4279 1.90698 PNS24244 1471 1199.39 131.706 9.84568 PNS24243 293 102.173 9 7.89783 KQK14069 1603 1331.39 219.762 14.7995 KQK14071 474 236.53 1.55634 0.589954 ==> ERR3317440.se.tsv <== BRADI_1g14170v3 306 BRADI_1g53295v3 37 BRADI_1g59795v3 215 BRADI_1g07683v3 0 BRADI_1g00485v3 49 BRADI_1g20270v3 1848 BRADI_1g74790v3 50 BRADI_1g09890v3 1 BRADI_1g77505v3 165 BRADI_1g48960v3 0 ERR3317440 completed mapping pipeline successfully