Starting /dee2/code/volunteer_pipeline.sh ERR3317441 current disk space = 1525062344704 free memory = 1528118980 ERR3317441 SRAfilesize 048f78c17ec6aa370792ff9106a06722 ERR3317441.sra ERR3317441.sra file validated ERR3317441 is paired end ERR3317441 is conventional basespace ERR3317441 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317441_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.75225 34.0 31.0 34.0 31.0 34.0 2 32.40625 34.0 31.0 34.0 31.0 34.0 3 32.8425 34.0 31.0 34.0 31.0 34.0 4 36.243 37.0 37.0 37.0 35.0 37.0 5 36.3245 37.0 37.0 37.0 35.0 37.0 6 36.391 37.0 37.0 37.0 35.0 37.0 7 36.35125 37.0 37.0 37.0 35.0 37.0 8 36.336 37.0 37.0 37.0 35.0 37.0 9 38.1315 39.0 39.0 39.0 37.0 39.0 10-11 38.125875 39.0 39.0 39.0 37.0 39.0 12-13 38.14175 39.0 39.0 39.0 37.0 39.0 14-15 39.666 41.0 40.0 41.0 37.0 41.0 16-17 39.674125000000004 41.0 40.0 41.0 37.0 41.0 18-19 39.598875 41.0 40.0 41.0 37.0 41.0 20-21 39.47975 41.0 39.5 41.0 36.5 41.0 22-23 39.387625 41.0 39.0 41.0 36.0 41.0 24-25 39.341875 41.0 39.0 41.0 36.0 41.0 26-27 39.229875 41.0 39.0 41.0 36.0 41.0 28-29 38.959625 40.0 39.0 41.0 35.0 41.0 30-31 38.762375 40.0 38.0 41.0 35.0 41.0 32-33 38.695125000000004 40.0 38.0 41.0 35.0 41.0 34-35 38.466125000000005 40.0 38.0 41.0 34.5 41.0 36-37 38.2505 40.0 38.0 41.0 34.0 41.0 38-39 38.16275 40.0 38.0 41.0 33.0 41.0 40-41 37.865375 40.0 37.5 41.0 33.0 41.0 42-43 37.907875 40.0 37.5 41.0 33.0 41.0 44-45 37.650125 40.0 37.0 41.0 33.0 41.0 46-47 37.49275 40.0 37.0 41.0 32.0 41.0 48-49 37.25325 40.0 36.0 41.0 32.0 41.0 50-51 37.476 40.0 36.5 41.0 33.0 41.0 52-53 37.455375000000004 40.0 36.0 41.0 33.0 41.0 54-55 37.209999999999994 39.5 35.5 41.0 32.5 41.0 56-57 36.861000000000004 39.0 35.0 41.0 32.0 41.0 58-59 36.551 39.0 35.0 41.0 31.0 41.0 60-61 36.14 38.0 35.0 41.0 30.5 41.0 62-63 35.809875 37.0 35.0 40.0 30.0 41.0 64-65 35.495374999999996 37.0 35.0 40.0 30.0 41.0 66-67 35.097125 36.0 35.0 39.0 30.0 41.0 68-69 34.693375 35.5 34.5 39.0 29.5 41.0 70-71 34.198750000000004 35.0 34.0 38.5 29.0 40.0 72-73 33.886250000000004 35.0 34.0 37.0 29.0 39.5 74-75 33.4925 35.0 34.0 37.0 29.0 39.0 76-77 32.31175 34.5 32.0 35.5 26.5 37.0 78-79 32.69025 35.0 33.0 36.0 27.0 37.0 80-81 32.445625 35.0 33.0 35.0 26.5 37.0 82-83 32.199375 35.0 33.0 35.0 26.0 36.5 84-85 31.85625 35.0 33.0 35.0 25.5 36.0 86-87 31.45525 35.0 33.0 35.0 24.0 36.0 88-89 31.36825 35.0 33.0 35.0 24.0 35.5 90-91 31.155875 35.0 32.5 35.0 23.5 35.0 92-93 30.8155 35.0 32.0 35.0 20.0 35.0 94-95 30.613125 35.0 32.0 35.0 19.5 35.0 96-97 30.375625 35.0 32.0 35.0 14.0 35.0 98-99 29.906625 34.5 31.5 35.0 2.0 35.0 100-101 27.571375 32.5 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 6.0 11 10.0 12 9.0 13 9.0 14 8.0 15 6.0 16 8.0 17 8.0 18 13.0 19 12.0 20 9.0 21 11.0 22 14.0 23 23.0 24 19.0 25 23.0 26 28.0 27 38.0 28 38.0 29 52.0 30 65.0 31 92.0 32 107.0 33 139.0 34 195.0 35 306.0 36 564.0 37 1013.0 38 1029.0 39 143.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 26.307612635939925 26.07457276022786 19.05748316934231 28.5603314344899 2 26.775 25.3 18.175 29.75 3 25.124999999999996 26.3 18.875 29.7 4 25.974999999999998 25.900000000000002 17.849999999999998 30.275000000000002 5 27.450000000000003 24.575 18.15 29.825000000000003 6 28.975 27.750000000000004 19.425 23.849999999999998 7 28.375 23.400000000000002 23.3 24.925 8 30.099999999999998 25.575 25.85 18.475 9 30.775000000000002 27.800000000000004 25.025 16.400000000000002 10-11 32.925 25.7875 22.9875 18.3 12-13 29.012500000000003 27.2625 23.849999999999998 19.875 14-15 26.9625 26.887499999999996 24.925 21.224999999999998 16-17 26.025 25.8625 25.7625 22.35 18-19 26.424999999999997 26.375 25.624999999999996 21.575 20-21 25.2625 26.85 26.337500000000002 21.55 22-23 25.5375 26.174999999999997 25.687500000000004 22.6 24-25 25.624999999999996 25.8625 25.424999999999997 23.0875 26-27 24.515564445555693 26.503312914114264 26.803350418802353 22.177772221527693 28-29 26.400000000000002 25.4 25.0625 23.1375 30-31 24.925 26.1 26.2875 22.6875 32-33 25.374999999999996 26.5375 26.0125 22.075 34-35 26.200000000000003 26.137500000000003 25.5625 22.1 36-37 25.275 26.7625 25.75 22.2125 38-39 25.474999999999998 26.737499999999997 25.275 22.5125 40-41 26.5625 26.575 25.55 21.3125 42-43 25.7625 25.337500000000002 26.187500000000004 22.7125 44-45 24.887500000000003 27.1625 25.15 22.8 46-47 26.2125 25.8 25.6 22.3875 48-49 24.725 25.6 26.1125 23.5625 50-51 25.4625 26.0375 25.4625 23.0375 52-53 26.174999999999997 25.7 25.2625 22.8625 54-55 25.074999999999996 26.3625 25.674999999999997 22.8875 56-57 25.2375 26.25 25.4625 23.05 58-59 25.900000000000002 26.1 24.85 23.150000000000002 60-61 24.5625 26.987499999999997 25.624999999999996 22.825 62-63 24.9125 25.912499999999998 25.5625 23.6125 64-65 25.5 26.137500000000003 24.8625 23.5 66-67 25.2625 26.2625 25.2625 23.2125 68-69 25.112499999999997 26.5375 25.7625 22.5875 70-71 25.074999999999996 26.8125 25.15 22.9625 72-73 25.374999999999996 26.0375 26.2125 22.375 74-75 25.3 27.125 24.75 22.825 76-77 26.075 26.487500000000004 24.212500000000002 23.225 78-79 26.575 26.6625 24.5625 22.2 80-81 25.674999999999997 26.5 25.1875 22.6375 82-83 26.0375 26.437500000000004 24.3125 23.2125 84-85 25.35 26.525 25.924999999999997 22.2 86-87 25.137500000000003 27.6875 24.212500000000002 22.9625 88-89 25.7375 26.937499999999996 23.95 23.375 90-91 24.4 27.400000000000002 25.2 23.0 92-93 26.0 26.5625 24.7375 22.7 94-95 24.875 27.237499999999997 25.0 22.8875 96-97 24.775 26.8625 25.3 23.0625 98-99 24.762500000000003 27.425 25.15 22.662499999999998 100-101 25.724999999999998 26.8 24.125 23.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 2.0 2 2.5 3 1.5 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.5 10 0.5 11 0.5 12 0.5 13 1.0 14 1.0 15 0.5 16 1.0 17 1.0 18 1.0 19 1.0 20 1.5 21 1.0 22 0.5 23 0.5 24 1.0 25 2.0 26 3.5 27 4.0 28 6.5 29 12.0 30 12.0 31 12.5 32 11.5 33 15.5 34 28.5 35 34.5 36 44.5 37 59.5 38 83.5 39 121.5 40 139.0 41 145.0 42 159.0 43 176.5 44 190.5 45 215.0 46 225.0 47 205.5 48 196.5 49 190.0 50 181.0 51 168.0 52 136.0 53 111.0 54 110.5 55 104.0 56 98.5 57 84.0 58 63.0 59 60.5 60 54.0 61 52.0 62 55.5 63 47.0 64 42.5 65 38.0 66 31.5 67 34.0 68 32.0 69 26.5 70 23.0 71 21.5 72 18.0 73 15.5 74 15.0 75 10.5 76 6.0 77 5.5 78 8.0 79 7.0 80 4.5 81 5.0 82 4.0 83 2.0 84 3.0 85 4.0 86 2.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.45 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.95965490992134 97.5 2 0.7104795737122558 1.4000000000000001 3 0.2283684344075108 0.675 4 0.07612281146917026 0.3 5 0.025374270489723422 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1125 0.0 0.0 0.0 0.0 24-25 0.1375 0.0 0.0 0.0 0.0 26-27 0.16249999999999998 0.0 0.0 0.0 0.0 28-29 0.1875 0.0 0.0 0.0 0.0 30-31 0.21250000000000002 0.0 0.0 0.0 0.0 32-33 0.225 0.0 0.0 0.0 0.0 34-35 0.275 0.0 0.0 0.0 0.0 36-37 0.375 0.0 0.0 0.0 0.0 38-39 0.5125 0.0 0.0 0.0 0.0 40-41 0.5625 0.0 0.0 0.0 0.0 42-43 0.5874999999999999 0.0 0.0 0.0 0.0 44-45 0.7124999999999999 0.0 0.0 0.0 0.0 46-47 0.8125 0.0 0.0 0.0 0.0 48-49 0.9125000000000001 0.0 0.0 0.0 0.0 50-51 1.025 0.0 0.0 0.0 0.0 52-53 1.1749999999999998 0.0 0.0 0.0 0.0 54-55 1.2625 0.0 0.0 0.0 0.0 56-57 1.325 0.0 0.0 0.0 0.0 58-59 1.575 0.0 0.0 0.0 0.0 60-61 1.8125 0.0 0.0 0.0 0.0 62-63 2.0 0.0 0.0 0.0 0.0 64-65 2.3 0.0 0.0 0.0 0.0 66-67 2.5875 0.0 0.0 0.0 0.0 68-69 2.825 0.0 0.0 0.0 0.0 70-71 3.1125 0.0 0.0 0.0 0.0 72-73 3.5125 0.0 0.0 0.0 0.0 74-75 3.925 0.0 0.0 0.0 0.0 76-77 4.525 0.0 0.0 0.0 0.0 78-79 4.862500000000001 0.0 0.0 0.0 0.0 80-81 5.1875 0.0 0.0 0.0 0.0 82-83 5.612500000000001 0.0 0.0 0.0 0.0 84-85 5.9375 0.0 0.0 0.0 0.0 86-87 6.4375 0.0 0.0 0.0 0.0 88-89 7.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317441 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317441_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5795 33.0 31.0 34.0 30.0 34.0 2 31.41625 33.0 31.0 34.0 28.0 34.0 3 31.8435 34.0 31.0 34.0 30.0 34.0 4 35.38925 37.0 35.0 37.0 33.0 37.0 5 35.4125 37.0 35.0 37.0 35.0 37.0 6 35.55975 37.0 37.0 37.0 35.0 37.0 7 35.60125 37.0 37.0 37.0 35.0 37.0 8 35.65875 37.0 37.0 37.0 35.0 37.0 9 37.384 39.0 39.0 39.0 35.0 39.0 10-11 37.3805 39.0 38.5 39.0 35.0 39.0 12-13 37.34525 39.0 38.0 39.0 35.0 39.0 14-15 38.88175 41.0 40.0 41.0 36.0 41.0 16-17 38.84075 41.0 39.5 41.0 36.0 41.0 18-19 38.701499999999996 41.0 39.0 41.0 35.0 41.0 20-21 38.587 41.0 39.0 41.0 35.0 41.0 22-23 38.524874999999994 41.0 39.0 41.0 35.0 41.0 24-25 38.50775 41.0 39.0 41.0 35.0 41.0 26-27 38.414500000000004 41.0 39.0 41.0 35.0 41.0 28-29 38.296375 41.0 38.5 41.0 34.5 41.0 30-31 38.042125 40.0 38.0 41.0 34.0 41.0 32-33 38.020875000000004 40.0 38.0 41.0 34.0 41.0 34-35 37.998625000000004 40.0 38.0 41.0 33.5 41.0 36-37 37.924875 40.0 38.0 41.0 33.5 41.0 38-39 37.767125 40.0 38.0 41.0 33.0 41.0 40-41 37.852875 40.0 38.0 41.0 33.0 41.0 42-43 37.75375 40.0 38.0 41.0 33.0 41.0 44-45 37.577125 40.0 38.0 41.0 33.0 41.0 46-47 37.436125000000004 40.0 37.0 41.0 33.0 41.0 48-49 37.254000000000005 40.0 37.0 41.0 32.5 41.0 50-51 36.531875 39.5 36.0 40.5 31.0 41.0 52-53 36.451125000000005 39.0 35.0 40.5 31.0 41.0 54-55 36.588125000000005 39.5 35.0 41.0 31.0 41.0 56-57 36.425 39.0 35.0 41.0 31.0 41.0 58-59 36.196625 39.0 35.0 41.0 31.0 41.0 60-61 35.866875 38.5 35.0 41.0 30.0 41.0 62-63 35.542375 38.0 35.0 40.5 29.5 41.0 64-65 35.204750000000004 37.0 35.0 40.0 29.0 41.0 66-67 35.092375000000004 37.0 35.0 40.0 29.5 41.0 68-69 35.021375 36.5 35.0 39.5 30.0 41.0 70-71 34.637874999999994 36.0 35.0 39.0 29.5 41.0 72-73 34.12325 35.5 34.5 39.0 29.0 40.5 74-75 33.827875 35.0 34.0 37.0 29.0 39.5 76-77 33.452875 35.0 34.0 37.0 28.5 39.0 78-79 33.11425 35.0 34.0 36.5 28.0 38.5 80-81 32.785875000000004 35.0 34.0 36.0 27.5 37.0 82-83 32.537000000000006 35.0 34.0 36.0 27.0 37.0 84-85 32.289249999999996 35.0 34.0 35.0 27.0 36.5 86-87 31.986624999999997 35.0 33.5 35.0 26.0 36.0 88-89 31.737375 35.0 33.0 35.0 25.0 36.0 90-91 31.62925 35.0 33.0 35.0 25.0 36.0 92-93 31.52725 35.0 33.0 35.0 24.5 35.0 94-95 31.33875 35.0 33.0 35.0 24.0 35.0 96-97 31.197000000000003 35.0 33.0 35.0 23.5 35.0 98-99 30.944625000000002 35.0 33.0 35.0 20.5 35.0 100-101 29.126125000000002 33.5 29.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 54.0 3 7.0 4 3.0 5 9.0 6 3.0 7 5.0 8 6.0 9 5.0 10 4.0 11 9.0 12 10.0 13 2.0 14 6.0 15 10.0 16 8.0 17 8.0 18 8.0 19 17.0 20 8.0 21 11.0 22 10.0 23 9.0 24 18.0 25 19.0 26 25.0 27 23.0 28 28.0 29 46.0 30 43.0 31 43.0 32 77.0 33 112.0 34 162.0 35 269.0 36 460.0 37 880.0 38 1336.0 39 247.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.049999999999997 12.174999999999999 29.2 28.575 2 25.75 10.8 27.375 36.075 3 23.05 12.5 29.75 34.699999999999996 4 24.025 12.1 27.700000000000003 36.175000000000004 5 25.6128064032016 15.132566283141571 23.836918459229615 35.41770885442722 6 25.1 18.224999999999998 29.099999999999998 27.575 7 19.72993248312078 24.18104526131533 39.05976494123531 17.029257314328582 8 18.42960740185046 24.781195298824706 36.98424606151538 19.80495123780945 9 17.95448862215554 28.457114278569644 33.033258314578646 20.555138784696176 10-11 19.3875 27.575 32.1125 20.925 12-13 19.21490186273284 27.628453556694588 31.766470808851103 21.390173771721464 14-15 19.5125 27.237499999999997 30.599999999999998 22.650000000000002 16-17 19.939992499062384 27.165895736967123 29.303662957869737 23.590448806100763 18-19 20.655163790947736 26.131532883220803 30.145036259064767 23.068267066766694 20-21 20.64266066516629 25.55638909727432 29.694923730932732 24.10602650662666 22-23 20.202525315664456 25.490686335791974 29.44118014751844 24.86560820102513 24-25 20.175 26.55 29.1625 24.1125 26-27 21.025 26.2625 28.487499999999997 24.224999999999998 28-29 21.25 25.662499999999998 27.150000000000002 25.937500000000004 30-31 20.4375 26.35 29.325000000000003 23.8875 32-33 20.6625 26.650000000000002 28.1875 24.5 34-35 20.974999999999998 25.874999999999996 28.0625 25.087500000000002 36-37 22.225 26.3125 28.5625 22.900000000000002 38-39 21.2 26.625 26.825 25.35 40-41 22.125 25.6125 27.1125 25.15 42-43 22.35 25.974999999999998 27.5875 24.087500000000002 44-45 22.05551387846962 26.91922980745186 27.219304826206553 23.80595148787197 46-47 22.043010752688172 25.681420355088775 26.25656414103526 26.019004751187797 48-49 20.8625 28.1375 26.6 24.4 50-51 22.375 25.8625 27.0625 24.7 52-53 22.4375 25.1 27.55 24.9125 54-55 20.4875 26.3625 28.812500000000004 24.337500000000002 56-57 22.412499999999998 26.75 26.575 24.2625 58-59 21.625 25.874999999999996 27.287499999999998 25.2125 60-61 21.425 26.3 27.762500000000003 24.5125 62-63 21.775 25.937500000000004 27.55 24.7375 64-65 22.975 25.05 27.474999999999998 24.5 66-67 21.4125 26.575 27.962500000000002 24.05 68-69 21.925 26.5 26.75 24.825 70-71 22.0625 26.5375 26.3 25.1 72-73 22.052756594574323 27.19089886235779 25.828228528566072 24.928116014501814 74-75 21.827728466058257 26.778347293411674 26.903362920365048 24.49056132016502 76-77 23.575 25.95 26.224999999999998 24.25 78-79 21.7875 26.5 27.025 24.6875 80-81 23.225 26.650000000000002 26.1 24.025 82-83 23.0625 25.6125 26.375 24.95 84-85 24.3625 26.2125 25.387500000000003 24.0375 86-87 23.9 26.387500000000003 25.7375 23.974999999999998 88-89 23.724999999999998 25.7125 25.624999999999996 24.9375 90-91 22.875 26.6625 25.7125 24.75 92-93 23.599999999999998 26.2625 26.5625 23.575 94-95 24.25 26.437500000000004 25.825 23.4875 96-97 23.4625 26.974999999999998 25.900000000000002 23.6625 98-99 24.1375 27.0875 24.85 23.925 100-101 24.0625 26.5125 25.637500000000003 23.7875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 19.0 1 13.5 2 5.0 3 2.5 4 4.0 5 5.5 6 6.5 7 5.0 8 2.5 9 1.0 10 1.0 11 1.0 12 0.5 13 2.0 14 2.5 15 1.5 16 0.5 17 0.5 18 1.5 19 2.0 20 2.0 21 1.0 22 2.5 23 4.5 24 4.5 25 6.5 26 7.0 27 6.0 28 8.5 29 14.0 30 15.5 31 20.0 32 26.5 33 32.0 34 40.0 35 50.0 36 63.5 37 82.5 38 99.5 39 109.0 40 143.5 41 192.0 42 209.5 43 186.5 44 193.5 45 234.5 46 228.0 47 194.5 48 166.0 49 152.0 50 156.5 51 142.0 52 123.0 53 123.5 54 107.5 55 90.0 56 74.5 57 63.5 58 62.0 59 55.0 60 48.0 61 45.0 62 47.5 63 34.0 64 22.5 65 27.0 66 31.0 67 27.0 68 20.5 69 18.5 70 19.5 71 19.0 72 14.0 73 13.0 74 12.0 75 10.5 76 9.0 77 7.0 78 4.0 79 2.5 80 3.0 81 1.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.025 8 0.025 9 0.025 10-11 0.0 12-13 0.0125 14-15 0.0 16-17 0.0125 18-19 0.025 20-21 0.025 22-23 0.0125 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.025 46-47 0.025 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0125 74-75 0.0125 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36386768447836 97.625 2 0.4071246819338422 0.8 3 0.1272264631043257 0.375 4 0.05089058524173028 0.2 5 0.02544529262086514 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02544529262086514 0.8750000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 35 0.8750000000000001 No Hit TCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1125 0.0 0.0 0.0 0.0 24-25 0.1375 0.0 0.0 0.0 0.0 26-27 0.16249999999999998 0.0 0.0 0.0 0.0 28-29 0.1875 0.0 0.0 0.0 0.0 30-31 0.21250000000000002 0.0 0.0 0.0 0.0 32-33 0.225 0.0 0.0 0.0 0.0 34-35 0.275 0.0 0.0 0.0 0.0 36-37 0.375 0.0 0.0 0.0 0.0 38-39 0.5125 0.0 0.0 0.0 0.0 40-41 0.5625 0.0 0.0 0.0 0.0 42-43 0.5874999999999999 0.0 0.0 0.0 0.0 44-45 0.7124999999999999 0.0 0.0 0.0 0.0 46-47 0.8125 0.0 0.0 0.0 0.0 48-49 0.9125000000000001 0.0 0.0 0.0 0.0 50-51 1.025 0.0 0.0 0.0 0.0 52-53 1.1749999999999998 0.0 0.0 0.0 0.0 54-55 1.2625 0.0 0.0 0.0 0.0 56-57 1.325 0.0 0.0 0.0 0.0 58-59 1.55 0.0 0.0 0.0 0.0 60-61 1.7625 0.0 0.0 0.0 0.0 62-63 1.95 0.0 0.0 0.0 0.0 64-65 2.25 0.0 0.0 0.0 0.0 66-67 2.5250000000000004 0.0 0.0 0.0 0.0 68-69 2.75 0.0 0.0 0.0 0.0 70-71 3.0125 0.0 0.0 0.0 0.0 72-73 3.3625 0.0 0.0 0.0 0.0 74-75 3.75 0.0 0.0 0.0 0.0 76-77 4.3 0.0 0.0 0.0 0.0 78-79 4.637499999999999 0.0 0.0 0.0 0.0 80-81 4.987500000000001 0.0 0.0 0.0 0.0 82-83 5.449999999999999 0.0 0.0 0.0 0.0 84-85 5.8 0.0 0.0 0.0 0.0 86-87 6.3125 0.0 0.0 0.0 0.0 88-89 6.987500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCCGCC 15 0.009957196 47.5 32-33 GCGGCTA 15 0.009957196 47.5 84-85 GACATAG 15 0.009957196 47.5 14-15 TATTAAT 15 0.009957196 47.5 20-21 CGGCTAG 15 0.009957196 47.5 84-85 >>END_MODULE Read 2002583 spots for ERR3317441.sra Written 2002583 spots for ERR3317441.sra Read 2002583 spots for ERR3317441.sra Written 2002583 spots for ERR3317441.sra Read 2002583 spots for ERR3317441.sra Written 2002583 spots for ERR3317441.sra Read 2002583 spots for ERR3317441.sra Written 2002583 spots for ERR3317441.sra Read 2002583 spots for ERR3317441.sra Written 2002583 spots for ERR3317441.sra Read 2002583 spots for ERR3317441.sra Written 2002583 spots for ERR3317441.sra Read 2002583 spots for ERR3317441.sra Written 2002583 spots for ERR3317441.sra Read 2002583 spots for ERR3317441.sra Written 2002583 spots for ERR3317441.sra Read 2002583 spots for ERR3317441.sra Written 2002583 spots for ERR3317441.sra Read 2002583 spots for ERR3317441.sra Written 2002583 spots for ERR3317441.sra Read 2002583 spots for ERR3317441.sra Written 2002583 spots for ERR3317441.sra Read 2002592 spots for ERR3317441.sra Written 2002592 spots for ERR3317441.sra Read 2002583 spots for ERR3317441.sra Written 2002583 spots for ERR3317441.sra Read 2002583 spots for ERR3317441.sra Written 2002583 spots for ERR3317441.sra Read 2002583 spots for ERR3317441.sra Written 2002583 spots for ERR3317441.sra Read 2002583 spots for ERR3317441.sra Written 2002583 spots for ERR3317441.sra Read 2002583 spots for ERR3317441.sra Written 2002583 spots for ERR3317441.sra Read 2002583 spots for ERR3317441.sra Written 2002583 spots for ERR3317441.sra Read 2002583 spots for ERR3317441.sra Written 2002583 spots for ERR3317441.sra Read 2002583 spots for ERR3317441.sra Written 2002583 spots for ERR3317441.sra SRR ids: ['ERR3317441.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_22oq809_ ERR3317441.sra spots: 40051669 blocks: [[1, 2002583], [2002584, 4005166], [4005167, 6007749], [6007750, 8010332], [8010333, 10012915], [10012916, 12015498], [12015499, 14018081], [14018082, 16020664], [16020665, 18023247], [18023248, 20025830], [20025831, 22028413], [22028414, 24030996], [24030997, 26033579], [26033580, 28036162], [28036163, 30038745], [30038746, 32041328], [32041329, 34043911], [34043912, 36046494], [36046495, 38049077], [38049078, 40051669]] ERR3317441 file size 9639200 ERR3317441 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317441 ERR3317441_1.fastq ERR3317441_2.fastq Input file: ERR3317441_1.fastq Paired file: ERR3317441_2.fastq trimmed: ERR3317441-trimmed-pair1.fastq, ERR3317441-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:29:47 2024 >> started Tue Dec 10 09:30:33 2024 >> done (45.586s) 40051669 read pairs processed; of these: 290330 ( 0.72%) short read pairs filtered out after trimming by size control 719924 ( 1.80%) empty read pairs filtered out after trimming by size control 39041415 (97.48%) read pairs available; of these: 12087472 (30.96%) trimmed read pairs available after processing 26953943 (69.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 675 0.00% 19 802 0.00% 20 1178 0.00% 21 1422 0.00% 22 1840 0.00% 23 2477 0.01% 24 3053 0.01% 25 3611 0.01% 26 4220 0.01% 27 5164 0.01% 28 5328 0.01% 29 6426 0.02% 30 7045 0.02% 31 9318 0.02% 32 9982 0.03% 33 10397 0.03% 34 11694 0.03% 35 12486 0.03% 36 13861 0.04% 37 14800 0.04% 38 17000 0.04% 39 19201 0.05% 40 18828 0.05% 41 20949 0.05% 42 22508 0.06% 43 24477 0.06% 44 26212 0.07% 45 27640 0.07% 46 29149 0.07% 47 33380 0.09% 48 34144 0.09% 49 36234 0.09% 50 38970 0.10% 51 40597 0.10% 52 41738 0.11% 53 45619 0.12% 54 50286 0.13% 55 56205 0.14% 56 55161 0.14% 57 58848 0.15% 58 63268 0.16% 59 81990 0.21% 60 92730 0.24% 61 100598 0.26% 62 106463 0.27% 63 112260 0.29% 64 119582 0.31% 65 123661 0.32% 66 135889 0.35% 67 135966 0.35% 68 139265 0.36% 69 145322 0.37% 70 148011 0.38% 71 156259 0.40% 72 162189 0.42% 73 169031 0.43% 74 170701 0.44% 75 171013 0.44% 76 170584 0.44% 77 178243 0.46% 78 192550 0.49% 79 190622 0.49% 80 194015 0.50% 81 197537 0.51% 82 200303 0.51% 83 209060 0.54% 84 217876 0.56% 85 229585 0.59% 86 237043 0.61% 87 242937 0.62% 88 244594 0.63% 89 264731 0.68% 90 262519 0.67% 91 267644 0.69% 92 280770 0.72% 93 294586 0.75% 94 320310 0.82% 95 347262 0.89% 96 389888 1.00% 97 457243 1.17% 98 576040 1.48% 99 791883 2.03% 100 1972524 5.05% 101 26953943 69.04% 39041415 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=3.65 fanout-score-rank=15 prefix-density=0.48 prefix-fanout=3.1 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=16 fanout-score=98.76 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=16.0 sequence=GCCGCCGCCGCCA criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=18.78 fanout-score-rank=7 prefix-density=0.23 prefix-fanout=18.8 sequence=GGTGTGCTCTTCCGATCT criterion=fanout-score sequence-density=0.08 sequence-density-rank=16 fanout-score=103.50 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=19.6 sequence=CCTTCTTCTCCT ERR3317441 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:32:03 Started mapping on | Dec 10 09:32:04 Finished on | Dec 10 09:34:13 Mapping speed, Million of reads per hour | 1089.53 Number of input reads | 39041415 Average input read length | 191 UNIQUE READS: Uniquely mapped reads number | 35189733 Uniquely mapped reads % | 90.13% Average mapped length | 190.47 Number of splices: Total | 21365890 Number of splices: Annotated (sjdb) | 20369881 Number of splices: GT/AG | 21059201 Number of splices: GC/AG | 268853 Number of splices: AT/AC | 19027 Number of splices: Non-canonical | 18809 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.00% Deletion average length | 1.20 Insertion rate per base | 0.00% Insertion average length | 1.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2241298 % of reads mapped to multiple loci | 5.74% Number of reads mapped to too many loci | 99419 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.36% % of reads unmapped: other | 1.51% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1845329 1845329 1845329 N_multimapping 2241298 2241298 2241298 N_noFeature 1273845 3260363 32496749 N_ambiguous 974790 300141 21099 UnstrandedReadsAssigned:32941098 PositiveStrandReadsAssigned:31629229 NegativeStrandReadsAssigned:2671885 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=98 echo kmer=93 ERR3317441 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317441-trimmed-pair1.fastq ERR3317441-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,041,415 reads, 33,411,941 reads pseudoaligned [quant] estimated average fragment length: 189.063 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,218 rounds 52973 ERR3317441.ke.tsv 35125 ERR3317441.se.tsv 88098 total ==> ERR3317441.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 748.149 0 0 PNS24247 1044 855.937 27.8774 1.51109 PNS24249 1928 1739.94 112.901 3.01052 PNS24246 1044 855.937 27.8774 1.51109 PNS24248 1044 855.937 27.8774 1.51109 PNS24244 1471 1282.94 275.467 9.96193 PNS24243 293 133.336 0 0 KQK14069 1603 1414.94 92.4829 3.03252 KQK14071 474 293.521 0 0 ==> ERR3317441.se.tsv <== BRADI_1g14170v3 120 BRADI_1g53295v3 49 BRADI_1g59795v3 376 BRADI_1g07683v3 0 BRADI_1g00485v3 120 BRADI_1g20270v3 3110 BRADI_1g74790v3 491 BRADI_1g09890v3 13 BRADI_1g77505v3 508 BRADI_1g48960v3 1 ERR3317441 completed mapping pipeline successfully