Starting /dee2/code/volunteer_pipeline.sh ERR3317442 current disk space = 1525089599488 free memory = 1598822320 ERR3317442 SRAfilesize 86be7c0d9c29df04bc45843b532508a0 ERR3317442.sra ERR3317442.sra file validated ERR3317442 is paired end ERR3317442 is conventional basespace ERR3317442 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317442_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.49075 34.0 31.0 34.0 31.0 34.0 2 32.28025 34.0 31.0 34.0 31.0 34.0 3 32.86075 34.0 33.0 34.0 31.0 34.0 4 36.3875 37.0 37.0 37.0 35.0 37.0 5 36.3925 37.0 37.0 37.0 35.0 37.0 6 36.4815 37.0 37.0 37.0 35.0 37.0 7 36.451 37.0 37.0 37.0 35.0 37.0 8 36.4475 37.0 37.0 37.0 35.0 37.0 9 38.26675 39.0 39.0 39.0 37.0 39.0 10-11 38.249750000000006 39.0 39.0 39.0 37.0 39.0 12-13 38.199 39.0 39.0 39.0 37.0 39.0 14-15 39.809375 41.0 40.0 41.0 38.0 41.0 16-17 39.770125 41.0 40.0 41.0 38.0 41.0 18-19 39.773125 41.0 40.0 41.0 37.5 41.0 20-21 39.682125 41.0 40.0 41.0 37.5 41.0 22-23 39.575874999999996 41.0 40.0 41.0 37.0 41.0 24-25 39.524125 41.0 40.0 41.0 37.0 41.0 26-27 39.323625 41.0 39.5 41.0 36.0 41.0 28-29 39.174375 41.0 39.0 41.0 36.0 41.0 30-31 39.01675 41.0 39.0 41.0 35.0 41.0 32-33 38.7295 40.0 38.5 41.0 34.5 41.0 34-35 38.569374999999994 40.0 38.0 41.0 34.5 41.0 36-37 38.40925 40.0 38.0 41.0 34.0 41.0 38-39 38.202625 40.0 38.0 41.0 34.0 41.0 40-41 37.937875000000005 40.0 38.0 41.0 33.0 41.0 42-43 37.919375 40.0 38.0 41.0 33.0 41.0 44-45 37.721125 40.0 37.0 41.0 33.0 41.0 46-47 37.52925 40.0 37.0 41.0 32.5 41.0 48-49 37.13825 40.0 36.0 41.0 32.0 41.0 50-51 37.529875000000004 40.0 36.0 41.0 33.0 41.0 52-53 37.32525 40.0 36.0 41.0 33.0 41.0 54-55 37.088 39.5 35.0 41.0 32.5 41.0 56-57 36.773875000000004 39.0 35.0 41.0 32.0 41.0 58-59 36.457375 39.0 35.0 41.0 31.5 41.0 60-61 36.02875 37.5 35.0 40.5 31.0 41.0 62-63 35.713125 37.0 35.0 40.0 31.0 41.0 64-65 35.29275 37.0 35.0 39.5 30.0 41.0 66-67 34.951499999999996 36.0 35.0 39.0 30.0 41.0 68-69 34.579125 35.5 34.5 39.0 30.0 41.0 70-71 34.11 35.0 34.0 37.5 29.0 40.5 72-73 33.690625 35.0 34.0 37.0 29.0 39.0 74-75 33.33775 35.0 34.0 37.0 28.5 39.0 76-77 32.198125000000005 34.5 32.5 36.0 25.5 37.0 78-79 32.603875 35.0 33.5 36.0 27.0 37.0 80-81 32.454625 35.0 33.5 35.5 27.0 37.0 82-83 32.192499999999995 35.0 33.0 35.0 27.0 36.5 84-85 31.9415 35.0 33.0 35.0 25.5 36.0 86-87 31.7115 35.0 33.0 35.0 25.0 36.0 88-89 31.431874999999998 35.0 33.0 35.0 24.5 36.0 90-91 31.234375 35.0 33.0 35.0 23.5 35.0 92-93 31.084875 35.0 33.0 35.0 23.0 35.0 94-95 30.846625 35.0 32.0 35.0 20.0 35.0 96-97 30.643250000000002 35.0 32.0 35.0 19.0 35.0 98-99 30.203 35.0 32.0 35.0 4.5 35.0 100-101 27.8945 33.0 27.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 4.0 9 3.0 10 9.0 11 3.0 12 6.0 13 9.0 14 10.0 15 10.0 16 9.0 17 12.0 18 16.0 19 19.0 20 16.0 21 15.0 22 15.0 23 14.0 24 23.0 25 20.0 26 21.0 27 24.0 28 31.0 29 37.0 30 44.0 31 79.0 32 95.0 33 123.0 34 192.0 35 318.0 36 537.0 37 1052.0 38 1101.0 39 128.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.290508652333507 26.27163083377032 18.51074986890404 26.927110644992137 2 27.025 23.45 18.8 30.725 3 26.775 25.474999999999998 17.8 29.95 4 28.675 24.224999999999998 15.9 31.2 5 28.599999999999998 26.375 15.45 29.575000000000003 6 30.475 26.3 17.849999999999998 25.374999999999996 7 30.875000000000004 24.175 20.525 24.425 8 32.975 25.45 23.375 18.2 9 33.650000000000006 25.900000000000002 24.15 16.3 10-11 33.5875 26.3 21.224999999999998 18.8875 12-13 29.462500000000002 27.125 23.674999999999997 19.7375 14-15 27.9375 26.1 24.4125 21.55 16-17 26.224999999999998 26.137500000000003 25.474999999999998 22.162499999999998 18-19 26.150000000000002 25.75 26.0 22.1 20-21 25.424999999999997 26.150000000000002 26.137500000000003 22.287499999999998 22-23 26.2875 25.912499999999998 24.875 22.925 24-25 25.05 26.85 24.9875 23.1125 26-27 25.7625 26.2625 24.725 23.25 28-29 25.7875 25.6 25.4375 23.175 30-31 25.887500000000003 26.5625 25.275 22.275 32-33 25.05 26.0 25.587500000000002 23.3625 34-35 25.874999999999996 25.7375 24.725 23.6625 36-37 25.587500000000002 25.937500000000004 25.25 23.225 38-39 25.4875 26.3 25.3125 22.900000000000002 40-41 26.487500000000004 25.2875 24.7 23.525 42-43 25.75 26.787499999999998 25.1875 22.275 44-45 26.625 25.074999999999996 25.650000000000002 22.650000000000002 46-47 25.387500000000003 26.450000000000003 25.412499999999998 22.75 48-49 26.05 25.525 25.5125 22.912499999999998 50-51 25.7125 26.724999999999998 25.074999999999996 22.4875 52-53 26.987499999999997 26.0625 24.4375 22.5125 54-55 26.137500000000003 25.4625 25.974999999999998 22.425 56-57 26.35 25.5625 24.337500000000002 23.75 58-59 26.224999999999998 25.7875 24.875 23.1125 60-61 24.712500000000002 25.624999999999996 26.137500000000003 23.525 62-63 25.825 25.7875 25.4875 22.900000000000002 64-65 25.75 25.587500000000002 25.4625 23.200000000000003 66-67 25.8 26.400000000000002 24.95 22.85 68-69 24.6875 26.150000000000002 26.075 23.0875 70-71 26.474999999999998 26.5 24.1125 22.912499999999998 72-73 26.087500000000002 26.5 25.0 22.412499999999998 74-75 25.424999999999997 26.737499999999997 23.8875 23.95 76-77 26.174999999999997 26.650000000000002 24.2375 22.9375 78-79 25.624999999999996 26.825 24.4375 23.1125 80-81 26.437500000000004 25.687500000000004 24.5375 23.3375 82-83 26.3125 26.924999999999997 24.175 22.5875 84-85 25.662499999999998 26.237500000000004 25.662499999999998 22.4375 86-87 25.362499999999997 26.8375 25.174999999999997 22.625 88-89 26.125 27.037499999999998 22.75 24.087500000000002 90-91 25.7875 27.712500000000002 24.3125 22.1875 92-93 25.95 26.025 24.712500000000002 23.3125 94-95 25.95 26.187500000000004 24.0125 23.849999999999998 96-97 26.224999999999998 27.224999999999998 23.9125 22.6375 98-99 25.7875 26.325 24.337500000000002 23.549999999999997 100-101 26.974999999999998 26.325 23.35 23.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 1.0 22 1.0 23 0.0 24 1.5 25 2.5 26 3.5 27 4.0 28 6.5 29 7.0 30 7.5 31 11.0 32 13.5 33 19.5 34 28.0 35 35.5 36 41.0 37 51.0 38 76.0 39 93.5 40 118.0 41 139.5 42 162.5 43 198.0 44 213.5 45 217.0 46 198.0 47 196.0 48 197.0 49 170.0 50 161.5 51 167.5 52 147.0 53 117.5 54 103.5 55 102.0 56 97.0 57 79.5 58 73.5 59 70.5 60 63.0 61 52.5 62 43.5 63 47.0 64 50.0 65 50.0 66 42.5 67 35.5 68 40.5 69 34.0 70 23.5 71 24.5 72 26.5 73 25.0 74 20.0 75 12.5 76 8.5 77 9.5 78 7.5 79 6.0 80 6.5 81 6.0 82 5.5 83 5.0 84 3.0 85 1.5 86 1.5 87 2.0 88 2.5 89 1.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.875 #Duplication Level Percentage of deduplicated Percentage of total 1 98.39080459770115 96.3 2 1.1749680715197957 2.3 3 0.33205619412515963 0.975 4 0.07662835249042146 0.3 5 0.02554278416347382 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCCCTACCAAGCAGCAGCCATGGCAGCGTCTCTCCAGGCCGCCGCCACC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.1125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.1875 0.0 0.0 0.0 0.0 36-37 0.2375 0.0 0.0 0.0 0.0 38-39 0.325 0.0 0.0 0.0 0.0 40-41 0.4 0.0 0.0 0.0 0.0 42-43 0.48750000000000004 0.0 0.0 0.0 0.0 44-45 0.7 0.0 0.0 0.0 0.0 46-47 0.7375 0.0 0.0 0.0 0.0 48-49 0.8125 0.0 0.0 0.0 0.0 50-51 0.975 0.0 0.0 0.0 0.0 52-53 1.0375 0.0 0.0 0.0 0.0 54-55 1.125 0.0 0.0 0.0 0.0 56-57 1.2999999999999998 0.0 0.0 0.0 0.0 58-59 1.475 0.0 0.0 0.0 0.0 60-61 1.6625 0.0 0.0 0.0 0.0 62-63 1.9 0.0 0.0 0.0 0.0 64-65 2.225 0.0 0.0 0.0 0.0 66-67 2.5625 0.0 0.0 0.0 0.0 68-69 2.8 0.0 0.0 0.0 0.0 70-71 3.0 0.0 0.0 0.0 0.0 72-73 3.4125 0.0 0.0 0.0 0.0 74-75 3.675 0.0 0.0 0.0 0.0 76-77 4.2625 0.0 0.0 0.0 0.0 78-79 4.7125 0.0 0.0 0.0 0.0 80-81 5.0875 0.0 0.0 0.0 0.0 82-83 5.4375 0.0 0.0 0.0 0.0 84-85 6.0375 0.0 0.0 0.0 0.0 86-87 6.4125 0.0 0.0 0.0 0.0 88-89 7.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317442 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317442_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3905 34.0 31.0 34.0 31.0 34.0 2 31.9555 34.0 31.0 34.0 30.0 34.0 3 32.515 34.0 31.0 34.0 31.0 34.0 4 35.77825 37.0 37.0 37.0 35.0 37.0 5 35.944 37.0 37.0 37.0 35.0 37.0 6 35.93625 37.0 37.0 37.0 35.0 37.0 7 35.97225 37.0 37.0 37.0 35.0 37.0 8 36.036 37.0 37.0 37.0 35.0 37.0 9 37.82325 39.0 39.0 39.0 37.0 39.0 10-11 37.816625 39.0 39.0 39.0 36.0 39.0 12-13 37.772999999999996 39.0 39.0 39.0 37.0 39.0 14-15 39.402125 41.0 40.0 41.0 37.0 41.0 16-17 39.337375 41.0 40.0 41.0 37.0 41.0 18-19 39.258375 41.0 40.0 41.0 36.5 41.0 20-21 39.15975 41.0 40.0 41.0 36.5 41.0 22-23 39.085 41.0 40.0 41.0 36.0 41.0 24-25 38.99225 41.0 40.0 41.0 36.0 41.0 26-27 38.997749999999996 41.0 39.5 41.0 35.5 41.0 28-29 38.90375 41.0 39.5 41.0 35.5 41.0 30-31 38.697374999999994 41.0 39.0 41.0 35.0 41.0 32-33 38.598 41.0 39.0 41.0 35.0 41.0 34-35 38.494749999999996 40.5 39.0 41.0 35.0 41.0 36-37 38.252624999999995 40.0 38.0 41.0 34.0 41.0 38-39 38.262125 40.0 38.0 41.0 34.0 41.0 40-41 38.398250000000004 41.0 38.5 41.0 35.0 41.0 42-43 38.324625 41.0 38.0 41.0 35.0 41.0 44-45 38.091 40.0 38.0 41.0 33.5 41.0 46-47 37.94575 40.0 38.0 41.0 33.0 41.0 48-49 37.841499999999996 40.0 37.5 41.0 33.0 41.0 50-51 37.108875 39.5 36.5 40.5 32.0 41.0 52-53 37.04675 39.5 36.0 40.5 32.5 41.0 54-55 37.21025 40.0 36.0 41.0 32.5 41.0 56-57 37.101124999999996 40.0 35.5 41.0 33.0 41.0 58-59 36.781 39.0 35.0 41.0 32.0 41.0 60-61 36.551249999999996 39.0 35.0 41.0 31.5 41.0 62-63 36.222625 38.5 35.0 41.0 31.0 41.0 64-65 35.785250000000005 37.5 35.0 40.5 31.0 41.0 66-67 35.862125000000006 37.0 35.0 40.0 31.0 41.0 68-69 35.596500000000006 37.0 35.0 39.5 31.5 41.0 70-71 35.313 36.0 35.0 39.0 31.5 41.0 72-73 34.90625 36.0 35.0 39.0 31.0 41.0 74-75 34.507875 35.0 35.0 37.5 31.0 39.5 76-77 34.15325 35.0 35.0 37.0 30.5 39.0 78-79 33.761125 35.0 35.0 36.5 30.5 39.0 80-81 33.402249999999995 35.0 34.5 36.0 29.0 37.0 82-83 33.147875 35.0 34.0 36.0 29.0 37.0 84-85 32.831 35.0 34.0 35.0 29.0 36.5 86-87 32.618875 35.0 34.0 35.0 29.0 36.0 88-89 32.469875 35.0 34.0 35.0 29.0 36.0 90-91 32.262375000000006 35.0 34.0 35.0 27.0 36.0 92-93 32.177125000000004 35.0 34.0 35.0 28.0 35.5 94-95 32.012375 35.0 34.0 35.0 27.0 35.0 96-97 31.822625000000002 35.0 33.5 35.0 26.0 35.0 98-99 31.660375000000002 35.0 33.0 35.0 27.0 35.0 100-101 29.809375000000003 34.0 30.0 35.0 13.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 36.0 3 4.0 4 3.0 5 2.0 6 5.0 7 2.0 8 6.0 9 1.0 10 3.0 11 5.0 12 5.0 13 7.0 14 8.0 15 6.0 16 4.0 17 4.0 18 12.0 19 5.0 20 3.0 21 8.0 22 3.0 23 17.0 24 21.0 25 19.0 26 13.0 27 31.0 28 28.0 29 33.0 30 45.0 31 34.0 32 69.0 33 84.0 34 126.0 35 256.0 36 421.0 37 967.0 38 1393.0 39 311.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.475 11.075 28.175 30.275000000000002 2 26.950000000000003 11.625 25.650000000000002 35.775 3 23.825 13.450000000000001 29.325000000000003 33.4 4 23.775 10.775 26.8 38.65 5 24.275 14.674999999999999 25.124999999999996 35.925000000000004 6 26.325 18.125 30.825000000000003 24.725 7 18.45 23.849999999999998 38.925 18.775 8 17.75 25.7 35.325 21.224999999999998 9 19.400000000000002 27.725 33.625 19.25 10-11 19.8375 27.474999999999998 31.624999999999996 21.0625 12-13 20.1375 26.1625 31.874999999999996 21.825 14-15 20.0125 26.075 30.475 23.4375 16-17 20.75 26.6 28.9375 23.7125 18-19 20.502562820352544 26.62832854106763 29.053631703962996 23.81547693461683 20-21 20.962500000000002 25.8625 28.499999999999996 24.675 22-23 21.425 24.45 29.212500000000002 24.9125 24-25 20.5125 26.450000000000003 28.237499999999997 24.8 26-27 21.912499999999998 25.6125 27.762500000000003 24.712500000000002 28-29 21.099999999999998 25.7375 26.737499999999997 26.424999999999997 30-31 20.849999999999998 25.937500000000004 27.9375 25.275 32-33 22.275 25.912499999999998 27.1375 24.675 34-35 21.15 25.2875 27.825 25.7375 36-37 21.637500000000003 25.6125 26.937499999999996 25.8125 38-39 22.55 25.525 25.674999999999997 26.25 40-41 22.3 25.112499999999997 26.2875 26.3 42-43 20.6625 26.1 27.474999999999998 25.7625 44-45 23.0125 26.325 25.924999999999997 24.7375 46-47 22.0 25.6 26.950000000000003 25.45 48-49 21.8 26.525 27.800000000000004 23.875 50-51 22.6375 25.7625 26.85 24.75 52-53 21.925 24.95 26.8375 26.2875 54-55 20.7 25.162499999999998 29.3875 24.75 56-57 22.75 25.75 25.974999999999998 25.525 58-59 22.1 25.3 26.700000000000003 25.900000000000002 60-61 22.2125 25.937500000000004 27.450000000000003 24.4 62-63 22.4625 26.525 25.624999999999996 25.387500000000003 64-65 22.6875 24.7375 26.5625 26.0125 66-67 22.5 26.7625 26.337500000000002 24.4 68-69 22.912499999999998 25.4625 25.900000000000002 25.724999999999998 70-71 23.1125 25.275 25.775 25.837500000000002 72-73 23.175 25.4 26.55 24.875 74-75 23.400000000000002 25.7375 26.125 24.7375 76-77 22.6875 26.2125 25.4875 25.6125 78-79 22.5625 26.8625 25.474999999999998 25.1 80-81 23.4375 26.0625 25.687500000000004 24.8125 82-83 22.400000000000002 25.825 25.4 26.375 84-85 23.4125 26.2125 25.7 24.675 86-87 23.5375 26.887499999999996 25.324999999999996 24.25 88-89 24.099999999999998 24.85 25.5 25.55 90-91 24.025 26.5 25.7125 23.7625 92-93 23.9125 26.3 24.5125 25.275 94-95 24.95 24.75 25.0625 25.2375 96-97 24.224999999999998 26.7125 24.975 24.087500000000002 98-99 25.124999999999996 25.162499999999998 25.2875 24.425 100-101 24.2375 24.712500000000002 25.912499999999998 25.137500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 14.0 1 9.5 2 4.5 3 3.5 4 2.5 5 1.0 6 2.5 7 3.5 8 1.0 9 0.5 10 1.0 11 3.5 12 3.0 13 1.0 14 1.0 15 0.5 16 1.0 17 1.0 18 0.5 19 1.5 20 2.0 21 1.5 22 1.0 23 1.0 24 2.5 25 6.0 26 9.0 27 7.0 28 6.0 29 6.5 30 9.5 31 16.0 32 21.0 33 27.0 34 42.5 35 50.0 36 60.5 37 73.5 38 86.5 39 111.0 40 151.0 41 178.0 42 190.0 43 215.0 44 223.5 45 200.0 46 180.5 47 177.0 48 168.5 49 160.5 50 157.0 51 157.5 52 135.0 53 108.0 54 99.5 55 85.0 56 78.0 57 78.5 58 64.5 59 57.5 60 59.5 61 57.5 62 48.0 63 39.0 64 38.0 65 34.5 66 28.5 67 31.0 68 27.5 69 16.5 70 19.5 71 26.5 72 24.5 73 21.0 74 15.0 75 10.0 76 10.0 77 10.0 78 10.0 79 7.5 80 4.0 81 2.0 82 1.0 83 0.5 84 0.5 85 0.0 86 0.5 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 1.0 97 1.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0125 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08163265306122 97.1 2 0.6377551020408163 1.25 3 0.15306122448979592 0.44999999999999996 4 0.0 0.0 5 0.025510204081632654 0.125 6 0.025510204081632654 0.15 7 0.025510204081632654 0.17500000000000002 8 0.025510204081632654 0.2 9 0.0 0.0 >10 0.025510204081632654 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 22 0.5499999999999999 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 8 0.2 No Hit TGGGGGTGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 7 0.17500000000000002 No Hit CCACCGAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGG 6 0.15 No Hit CTGACTTTCACATGCAACATCTATCAGTCCTGACTCCTGACTCAATCTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.1125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.1875 0.0 0.0 0.0 0.0 36-37 0.2375 0.0 0.0 0.0 0.0 38-39 0.325 0.0 0.0 0.0 0.0 40-41 0.4 0.0 0.0 0.0 0.0 42-43 0.48750000000000004 0.0 0.0 0.0 0.0 44-45 0.7 0.0 0.0 0.0 0.0 46-47 0.7375 0.0 0.0 0.0 0.0 48-49 0.8125 0.0 0.0 0.0 0.0 50-51 0.975 0.0 0.0 0.0 0.0 52-53 1.0375 0.0 0.0 0.0 0.0 54-55 1.125 0.0 0.0 0.0 0.0 56-57 1.2999999999999998 0.0 0.0 0.0 0.0 58-59 1.475 0.0 0.0 0.0 0.0 60-61 1.6625 0.0 0.0 0.0 0.0 62-63 1.9 0.0 0.0 0.0 0.0 64-65 2.2 0.0 0.0 0.0 0.0 66-67 2.5375 0.0 0.0 0.0 0.0 68-69 2.7750000000000004 0.0 0.0 0.0 0.0 70-71 2.9749999999999996 0.0 0.0 0.0 0.0 72-73 3.3875 0.0 0.0 0.0 0.0 74-75 3.65 0.0 0.0 0.0 0.0 76-77 4.2625 0.0 0.0 0.0 0.0 78-79 4.699999999999999 0.0 0.0 0.0 0.0 80-81 5.075 0.0 0.0 0.0 0.0 82-83 5.4625 0.0 0.0 0.0 0.0 84-85 6.0875 0.0 0.0 0.0 0.0 86-87 6.5 0.0 0.0 0.0 0.0 88-89 7.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1799723 spots for ERR3317442.sra Written 1799723 spots for ERR3317442.sra Read 1799723 spots for ERR3317442.sra Written 1799723 spots for ERR3317442.sra Read 1799723 spots for ERR3317442.sra Written 1799723 spots for ERR3317442.sra Read 1799723 spots for ERR3317442.sra Written 1799723 spots for ERR3317442.sra Read 1799723 spots for ERR3317442.sra Written 1799723 spots for ERR3317442.sra Read 1799723 spots for ERR3317442.sra Written 1799723 spots for ERR3317442.sra Read 1799723 spots for ERR3317442.sra Written 1799723 spots for ERR3317442.sra Read 1799723 spots for ERR3317442.sra Written 1799723 spots for ERR3317442.sra Read 1799723 spots for ERR3317442.sra Written 1799723 spots for ERR3317442.sra Read 1799723 spots for ERR3317442.sra Written 1799723 spots for ERR3317442.sra Read 1799742 spots for ERR3317442.sra Written 1799742 spots for ERR3317442.sra Read 1799723 spots for ERR3317442.sra Written 1799723 spots for ERR3317442.sra Read 1799723 spots for ERR3317442.sra Written 1799723 spots for ERR3317442.sra Read 1799723 spots for ERR3317442.sra Written 1799723 spots for ERR3317442.sra Read 1799723 spots for ERR3317442.sra Written 1799723 spots for ERR3317442.sra Read 1799723 spots for ERR3317442.sra Written 1799723 spots for ERR3317442.sra Read 1799723 spots for ERR3317442.sra Written 1799723 spots for ERR3317442.sra Read 1799723 spots for ERR3317442.sra Written 1799723 spots for ERR3317442.sra Read 1799723 spots for ERR3317442.sra Written 1799723 spots for ERR3317442.sra Read 1799723 spots for ERR3317442.sra Written 1799723 spots for ERR3317442.sra SRR ids: ['ERR3317442.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i1ukxp9_ ERR3317442.sra spots: 35994479 blocks: [[1, 1799723], [1799724, 3599446], [3599447, 5399169], [5399170, 7198892], [7198893, 8998615], [8998616, 10798338], [10798339, 12598061], [12598062, 14397784], [14397785, 16197507], [16197508, 17997230], [17997231, 19796953], [19796954, 21596676], [21596677, 23396399], [23396400, 25196122], [25196123, 26995845], [26995846, 28795568], [28795569, 30595291], [30595292, 32395014], [32395015, 34194737], [34194738, 35994479]] ERR3317442 file size 8660561 ERR3317442 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317442 ERR3317442_1.fastq ERR3317442_2.fastq Input file: ERR3317442_1.fastq Paired file: ERR3317442_2.fastq trimmed: ERR3317442-trimmed-pair1.fastq, ERR3317442-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:29:36 2024 >> started Tue Dec 10 09:30:41 2024 >> done (64.778s) 35994479 read pairs processed; of these: 204730 ( 0.57%) short read pairs filtered out after trimming by size control 478528 ( 1.33%) empty read pairs filtered out after trimming by size control 35311221 (98.10%) read pairs available; of these: 10189048 (28.85%) trimmed read pairs available after processing 25122173 (71.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1308 0.00% 19 1236 0.00% 20 1636 0.00% 21 1929 0.01% 22 2277 0.01% 23 3122 0.01% 24 3740 0.01% 25 4400 0.01% 26 5143 0.01% 27 5850 0.02% 28 6047 0.02% 29 7100 0.02% 30 7483 0.02% 31 9667 0.03% 32 9397 0.03% 33 9492 0.03% 34 10930 0.03% 35 11590 0.03% 36 12818 0.04% 37 13393 0.04% 38 15688 0.04% 39 16478 0.05% 40 16539 0.05% 41 18186 0.05% 42 18862 0.05% 43 19789 0.06% 44 21043 0.06% 45 21690 0.06% 46 23308 0.07% 47 26301 0.07% 48 27197 0.08% 49 28287 0.08% 50 32089 0.09% 51 31684 0.09% 52 32955 0.09% 53 35843 0.10% 54 41283 0.12% 55 46142 0.13% 56 44853 0.13% 57 45629 0.13% 58 49700 0.14% 59 63981 0.18% 60 74055 0.21% 61 78924 0.22% 62 84771 0.24% 63 88548 0.25% 64 93991 0.27% 65 99173 0.28% 66 109302 0.31% 67 109282 0.31% 68 110851 0.31% 69 114618 0.32% 70 123456 0.35% 71 131584 0.37% 72 133390 0.38% 73 136887 0.39% 74 134965 0.38% 75 135292 0.38% 76 136227 0.39% 77 143837 0.41% 78 153290 0.43% 79 152577 0.43% 80 156918 0.44% 81 162115 0.46% 82 162679 0.46% 83 170195 0.48% 84 175530 0.50% 85 186594 0.53% 86 196679 0.56% 87 202616 0.57% 88 203217 0.58% 89 225728 0.64% 90 218422 0.62% 91 227104 0.64% 92 239919 0.68% 93 255381 0.72% 94 277052 0.78% 95 298503 0.85% 96 330884 0.94% 97 389027 1.10% 98 504552 1.43% 99 664868 1.88% 100 1789960 5.07% 101 25122173 71.15% 35311221 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=3.16 fanout-score-rank=14 prefix-density=0.66 prefix-fanout=2.8 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.13 sequence-density-rank=17 fanout-score=17.07 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=6.1 sequence=TCCTCCTCCTCCGCCG criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=29 prefix-density=0.43 prefix-fanout=2.2 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCT criterion=fanout-score sequence-density=0.05 sequence-density-rank=21 fanout-score=113.46 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=12.0 sequence=CCTTCTTCTCCGGGTCC ERR3317442 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:32:10 Started mapping on | Dec 10 09:32:10 Finished on | Dec 10 09:33:53 Mapping speed, Million of reads per hour | 1234.18 Number of input reads | 35311221 Average input read length | 192 UNIQUE READS: Uniquely mapped reads number | 32048843 Uniquely mapped reads % | 90.76% Average mapped length | 191.55 Number of splices: Total | 19747142 Number of splices: Annotated (sjdb) | 18775467 Number of splices: GT/AG | 19457243 Number of splices: GC/AG | 258807 Number of splices: AT/AC | 13936 Number of splices: Non-canonical | 17156 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.00% Deletion average length | 1.23 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2061267 % of reads mapped to multiple loci | 5.84% Number of reads mapped to too many loci | 81260 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.92% % of reads unmapped: other | 1.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1366898 1366898 1366898 N_multimapping 2061267 2061267 2061267 N_noFeature 1176449 2527889 30030898 N_ambiguous 943697 307328 16542 UnstrandedReadsAssigned:29928697 PositiveStrandReadsAssigned:29213626 NegativeStrandReadsAssigned:2001403 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 ERR3317442 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317442-trimmed-pair1.fastq ERR3317442-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,311,221 reads, 30,786,509 reads pseudoaligned [quant] estimated average fragment length: 183.474 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,181 rounds 52973 ERR3317442.ke.tsv 35125 ERR3317442.se.tsv 88098 total ==> ERR3317442.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 753.827 0 0 PNS24247 1044 861.526 55.5023 3.12371 PNS24249 1928 1745.53 104.208 2.8947 PNS24246 1044 861.526 55.5023 3.12371 PNS24248 1044 861.526 55.5023 3.12371 PNS24244 1471 1288.53 215.285 8.10119 PNS24243 293 134.322 0 0 KQK14069 1603 1420.53 10495.6 358.249 KQK14071 474 297.366 49.7668 8.11477 ==> ERR3317442.se.tsv <== BRADI_1g14170v3 12130 BRADI_1g53295v3 135 BRADI_1g59795v3 872 BRADI_1g07683v3 0 BRADI_1g00485v3 75 BRADI_1g20270v3 2473 BRADI_1g74790v3 293 BRADI_1g09890v3 12 BRADI_1g77505v3 427 BRADI_1g48960v3 0 ERR3317442 completed mapping pipeline successfully