Starting /dee2/code/volunteer_pipeline.sh ERR3317444 current disk space = 1525179637760 free memory = 1407005804 ERR3317444 SRAfilesize ad0bc907de64297f0d14e878dadc45b4 ERR3317444.sra ERR3317444.sra file validated ERR3317444 is paired end ERR3317444 is conventional basespace ERR3317444 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317444_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.53475 34.0 31.0 34.0 31.0 34.0 2 32.31525 34.0 31.0 34.0 31.0 34.0 3 32.91575 34.0 33.0 34.0 31.0 34.0 4 36.43425 37.0 37.0 37.0 35.0 37.0 5 36.43 37.0 37.0 37.0 35.0 37.0 6 36.482 37.0 37.0 37.0 35.0 37.0 7 36.507 37.0 37.0 37.0 35.0 37.0 8 36.485 37.0 37.0 37.0 35.0 37.0 9 38.338 39.0 39.0 39.0 37.0 39.0 10-11 38.303625 39.0 39.0 39.0 37.0 39.0 12-13 38.271125 39.0 39.0 39.0 37.0 39.0 14-15 39.77425 41.0 40.0 41.0 38.0 41.0 16-17 39.800625 41.0 40.0 41.0 38.0 41.0 18-19 39.82875 41.0 40.0 41.0 38.0 41.0 20-21 39.750375 41.0 40.0 41.0 37.5 41.0 22-23 39.589625 41.0 40.0 41.0 37.0 41.0 24-25 39.5155 41.0 40.0 41.0 37.0 41.0 26-27 39.398624999999996 41.0 40.0 41.0 36.0 41.0 28-29 39.215625 41.0 39.0 41.0 36.0 41.0 30-31 39.047875000000005 41.0 39.0 41.0 35.0 41.0 32-33 38.802625000000006 40.0 38.5 41.0 35.0 41.0 34-35 38.67475 40.0 38.0 41.0 35.0 41.0 36-37 38.525625000000005 40.0 38.0 41.0 35.0 41.0 38-39 38.193125 40.0 38.0 41.0 33.5 41.0 40-41 38.00775 40.0 38.0 41.0 33.0 41.0 42-43 37.991749999999996 40.0 38.0 41.0 33.0 41.0 44-45 37.84125 40.0 37.5 41.0 33.0 41.0 46-47 37.537625000000006 40.0 37.0 41.0 32.5 41.0 48-49 37.151250000000005 40.0 36.0 41.0 31.5 41.0 50-51 37.518125 40.0 36.0 41.0 33.0 41.0 52-53 37.405125 40.0 36.0 41.0 33.0 41.0 54-55 37.114375 39.5 35.0 41.0 32.5 41.0 56-57 36.7535 39.0 35.0 41.0 32.0 41.0 58-59 36.545125 39.0 35.0 41.0 31.5 41.0 60-61 36.177375 38.0 35.0 41.0 31.0 41.0 62-63 35.908500000000004 37.0 35.0 40.0 31.0 41.0 64-65 35.487624999999994 37.0 35.0 40.0 31.0 41.0 66-67 35.15275 36.0 35.0 39.0 30.0 41.0 68-69 34.767250000000004 36.0 34.5 39.0 30.0 41.0 70-71 34.279375 35.0 34.0 38.0 29.0 40.0 72-73 33.917625 35.0 34.0 37.0 29.0 39.0 74-75 33.544875 35.0 34.0 37.0 29.0 39.0 76-77 32.306625 34.5 32.5 36.0 26.0 37.0 78-79 32.679249999999996 35.0 33.5 36.0 27.0 37.0 80-81 32.53875 35.0 33.0 35.5 27.0 37.0 82-83 32.33025 35.0 33.0 35.0 27.0 36.5 84-85 32.099374999999995 35.0 33.0 35.0 26.5 36.0 86-87 31.876125000000002 35.0 33.0 35.0 25.0 36.0 88-89 31.723625 35.0 33.0 35.0 25.0 36.0 90-91 31.491999999999997 35.0 33.0 35.0 24.0 35.0 92-93 31.233375 35.0 33.0 35.0 23.5 35.0 94-95 31.033375 35.0 33.0 35.0 23.0 35.0 96-97 30.76975 35.0 32.0 35.0 20.0 35.0 98-99 30.398375 35.0 32.0 35.0 9.5 35.0 100-101 28.103125 33.0 28.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 4.0 9 4.0 10 2.0 11 6.0 12 9.0 13 10.0 14 8.0 15 14.0 16 7.0 17 9.0 18 8.0 19 11.0 20 15.0 21 11.0 22 14.0 23 14.0 24 17.0 25 26.0 26 19.0 27 35.0 28 39.0 29 40.0 30 60.0 31 79.0 32 87.0 33 127.0 34 158.0 35 284.0 36 591.0 37 1024.0 38 1121.0 39 145.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.34686926905947 25.229237621168455 18.758187057898873 27.6657060518732 2 26.625 24.65 19.45 29.275000000000002 3 26.575 27.55 17.675 28.199999999999996 4 25.75 25.3 17.075000000000003 31.874999999999996 5 27.63881940970485 25.41270635317659 16.408204102051023 30.540270135067534 6 27.6 27.675 19.35 25.374999999999996 7 29.849999999999998 23.65 23.35 23.150000000000002 8 31.900000000000002 24.425 25.324999999999996 18.35 9 32.225 26.200000000000003 25.224999999999998 16.35 10-11 32.35 26.424999999999997 23.1375 18.087500000000002 12-13 29.7375 26.6 23.9375 19.725 14-15 27.275 26.5125 25.624999999999996 20.5875 16-17 26.950000000000003 26.237500000000004 25.124999999999996 21.6875 18-19 26.1 26.9125 25.087500000000002 21.9 20-21 24.3125 27.5625 25.3125 22.8125 22-23 26.137500000000003 26.137500000000003 24.9125 22.8125 24-25 24.3625 26.1 26.0125 23.525 26-27 25.3 26.8125 25.15 22.7375 28-29 26.6625 26.2625 24.5125 22.5625 30-31 25.162499999999998 27.175 25.124999999999996 22.537499999999998 32-33 24.762500000000003 27.125 25.900000000000002 22.2125 34-35 25.4875 26.687499999999996 24.65 23.175 36-37 26.237500000000004 25.7875 25.4375 22.537499999999998 38-39 25.2 26.6625 25.474999999999998 22.662499999999998 40-41 25.724999999999998 25.825 24.75 23.7 42-43 26.487500000000004 24.962500000000002 25.525 23.025000000000002 44-45 26.5625 26.650000000000002 24.975 21.8125 46-47 26.35 26.3 24.675 22.675 48-49 25.974999999999998 26.2875 24.9375 22.8 50-51 25.5 26.8375 25.624999999999996 22.037499999999998 52-53 25.874999999999996 25.9875 25.124999999999996 23.0125 54-55 26.0625 26.200000000000003 26.125 21.6125 56-57 25.124999999999996 26.3 24.3875 24.1875 58-59 24.9 25.8125 25.112499999999997 24.175 60-61 24.962500000000002 25.724999999999998 26.387500000000003 22.925 62-63 25.124999999999996 26.575 25.2875 23.0125 64-65 26.187500000000004 25.45 25.75 22.6125 66-67 26.437500000000004 26.424999999999997 24.175 22.9625 68-69 25.575 26.875 24.975 22.575 70-71 25.624999999999996 26.75 24.337500000000002 23.2875 72-73 25.5 26.2875 25.0625 23.150000000000002 74-75 25.775 27.0125 24.2375 22.975 76-77 26.3625 26.387500000000003 24.3625 22.8875 78-79 25.587500000000002 27.55 24.175 22.6875 80-81 25.575 27.3375 24.337500000000002 22.75 82-83 25.25 27.3125 24.0625 23.375 84-85 25.275 26.7625 24.375 23.5875 86-87 25.674999999999997 26.674999999999997 24.349999999999998 23.3 88-89 25.224999999999998 27.800000000000004 23.45 23.525 90-91 26.1625 26.424999999999997 25.137500000000003 22.275 92-93 26.087500000000002 27.037499999999998 23.3625 23.5125 94-95 25.087500000000002 27.474999999999998 24.1375 23.3 96-97 26.087500000000002 26.6 23.799999999999997 23.5125 98-99 25.412499999999998 26.137500000000003 24.65 23.799999999999997 100-101 26.237500000000004 26.2875 23.925 23.549999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 1.0 9 1.5 10 1.5 11 1.0 12 1.0 13 2.0 14 1.5 15 1.5 16 3.0 17 2.5 18 1.5 19 1.5 20 1.5 21 1.0 22 1.5 23 1.5 24 2.0 25 2.0 26 1.5 27 3.0 28 6.0 29 9.5 30 9.5 31 11.5 32 16.5 33 20.5 34 27.5 35 30.0 36 43.5 37 65.0 38 75.0 39 92.5 40 122.0 41 160.5 42 192.0 43 192.5 44 198.5 45 212.5 46 203.0 47 190.0 48 183.5 49 171.5 50 158.0 51 148.5 52 131.5 53 119.0 54 110.0 55 104.5 56 93.5 57 80.0 58 83.5 59 74.5 60 58.5 61 57.5 62 54.0 63 45.0 64 49.5 65 48.0 66 37.0 67 32.5 68 32.5 69 31.0 70 20.0 71 18.5 72 26.0 73 24.5 74 14.5 75 11.0 76 12.0 77 9.5 78 9.5 79 7.5 80 4.0 81 4.0 82 5.0 83 3.0 84 3.0 85 3.5 86 2.5 87 2.5 88 1.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.575 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.875 #Duplication Level Percentage of deduplicated Percentage of total 1 97.96129032258064 94.89999999999999 2 1.5225806451612902 2.9499999999999997 3 0.2838709677419355 0.8250000000000001 4 0.07741935483870968 0.3 5 0.05161290322580645 0.25 6 0.025806451612903226 0.15 7 0.025806451612903226 0.17500000000000002 8 0.025806451612903226 0.2 9 0.0 0.0 >10 0.025806451612903226 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCGAGTTCGCGCCGG 10 0.25 No Hit TTGGGGATGATTCTGTATTACAATTTGGTGGAGGAACTTTAGGACATCCT 8 0.2 No Hit TGCTCGTGAAGGTAATGAAATTATCCGAGCAGCTTGCAAATGGAGTCCTG 7 0.17500000000000002 No Hit CCACGCCGGTACAGTAGTAGGTAAGTTAGAAGGGGAACGCGAAATCACTT 6 0.15 No Hit ACTTAACTGGGGGATTCACCGCAAATACTACTTTGGCTCATTATTGCCGC 5 0.125 No Hit TGCAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.0875 0.0 0.0 0.0 0.0 26-27 0.1125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.15 0.0 0.0 0.0 0.0 36-37 0.16249999999999998 0.0 0.0 0.0 0.0 38-39 0.225 0.0 0.0 0.0 0.0 40-41 0.25 0.0 0.0 0.0 0.0 42-43 0.3125 0.0 0.0 0.0 0.0 44-45 0.35 0.0 0.0 0.0 0.0 46-47 0.475 0.0 0.0 0.0 0.0 48-49 0.55 0.0 0.0 0.0 0.0 50-51 0.5874999999999999 0.0 0.0 0.0 0.0 52-53 0.6875 0.0 0.0 0.0 0.0 54-55 0.8 0.0 0.0 0.0 0.0 56-57 0.8625 0.0 0.0 0.0 0.0 58-59 0.95 0.0 0.0 0.0 0.0 60-61 1.0750000000000002 0.0 0.0 0.0 0.0 62-63 1.275 0.0 0.0 0.0 0.0 64-65 1.45 0.0 0.0 0.0 0.0 66-67 1.75 0.0 0.0 0.0 0.0 68-69 2.075 0.0 0.0 0.0 0.0 70-71 2.3625 0.0 0.0 0.0 0.0 72-73 2.7375 0.0 0.0 0.0 0.0 74-75 3.2 0.0 0.0 0.0 0.0 76-77 3.5250000000000004 0.0 0.0 0.0 0.0 78-79 3.875 0.0 0.0 0.0 0.0 80-81 4.5625 0.0 0.0 0.0 0.0 82-83 5.175 0.0 0.0 0.0 0.0 84-85 5.6875 0.0 0.0 0.0 0.0 86-87 6.2125 0.0 0.0 0.0 0.0 88-89 6.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317444 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317444_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.194 34.0 31.0 34.0 31.0 34.0 2 31.819 34.0 31.0 34.0 30.0 34.0 3 32.32075 34.0 31.0 34.0 30.0 34.0 4 35.53 37.0 35.0 37.0 33.0 37.0 5 35.726 37.0 37.0 37.0 35.0 37.0 6 35.81575 37.0 37.0 37.0 35.0 37.0 7 35.8115 37.0 37.0 37.0 35.0 37.0 8 35.841 37.0 37.0 37.0 35.0 37.0 9 37.599 39.0 39.0 39.0 35.0 39.0 10-11 37.593875 39.0 39.0 39.0 36.0 39.0 12-13 37.564375 39.0 39.0 39.0 35.0 39.0 14-15 39.16475 41.0 40.0 41.0 36.5 41.0 16-17 39.106875 41.0 40.0 41.0 36.5 41.0 18-19 38.99175 41.0 40.0 41.0 36.0 41.0 20-21 38.958124999999995 41.0 40.0 41.0 35.5 41.0 22-23 38.8825 41.0 40.0 41.0 35.0 41.0 24-25 38.78375 41.0 39.0 41.0 35.0 41.0 26-27 38.8055 41.0 39.0 41.0 35.0 41.0 28-29 38.676375 41.0 39.0 41.0 35.0 41.0 30-31 38.508875 41.0 39.0 41.0 35.0 41.0 32-33 38.4215 41.0 39.0 41.0 35.0 41.0 34-35 38.312375 40.5 38.0 41.0 34.5 41.0 36-37 38.004125 40.0 38.0 41.0 33.5 41.0 38-39 38.076499999999996 40.0 38.0 41.0 34.0 41.0 40-41 38.103624999999994 40.0 38.0 41.0 34.0 41.0 42-43 38.085375 41.0 38.0 41.0 34.0 41.0 44-45 37.945 40.0 38.0 41.0 33.5 41.0 46-47 37.705749999999995 40.0 37.5 41.0 33.0 41.0 48-49 37.569375 40.0 37.0 41.0 33.0 41.0 50-51 36.869125 39.5 36.0 40.5 32.0 41.0 52-53 36.716875 39.5 35.5 40.5 31.5 41.0 54-55 36.841875 40.0 35.5 41.0 31.5 41.0 56-57 36.758125 39.5 35.0 41.0 32.0 41.0 58-59 36.443375 39.0 35.0 41.0 31.0 41.0 60-61 36.22775 39.0 35.0 41.0 31.0 41.0 62-63 35.929125 38.0 35.0 41.0 31.0 41.0 64-65 35.577625 37.5 35.0 40.0 30.0 41.0 66-67 35.61775 37.0 35.0 40.0 31.0 41.0 68-69 35.365125 37.0 35.0 39.5 31.0 41.0 70-71 34.93125 36.0 35.0 39.0 30.5 41.0 72-73 34.571375 35.5 35.0 39.0 30.0 40.5 74-75 34.223 35.0 35.0 37.5 30.0 39.5 76-77 33.829750000000004 35.0 35.0 37.0 30.0 39.0 78-79 33.468875 35.0 34.0 36.5 29.5 39.0 80-81 33.067625 35.0 34.0 36.0 28.5 37.0 82-83 32.81699999999999 35.0 34.0 36.0 29.0 37.0 84-85 32.549 35.0 34.0 35.0 28.0 36.5 86-87 32.366 35.0 34.0 35.0 28.0 36.0 88-89 32.132875 35.0 34.0 35.0 27.0 36.0 90-91 31.905875 35.0 34.0 35.0 26.0 36.0 92-93 31.822375 35.0 34.0 35.0 26.0 35.0 94-95 31.7345 35.0 33.5 35.0 25.5 35.0 96-97 31.50475 35.0 33.0 35.0 24.0 35.0 98-99 31.295375 35.0 33.0 35.0 24.5 35.0 100-101 29.493625 33.5 30.0 34.5 12.5 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 50.0 3 4.0 4 0.0 5 3.0 6 2.0 7 5.0 8 3.0 9 4.0 10 6.0 11 6.0 12 6.0 13 7.0 14 9.0 15 8.0 16 4.0 17 6.0 18 8.0 19 6.0 20 7.0 21 12.0 22 9.0 23 17.0 24 19.0 25 23.0 26 20.0 27 16.0 28 33.0 29 28.0 30 44.0 31 58.0 32 69.0 33 95.0 34 145.0 35 231.0 36 454.0 37 922.0 38 1382.0 39 279.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.975 11.600000000000001 30.425 28.999999999999996 2 26.224999999999998 10.775 25.124999999999996 37.875 3 22.975 12.75 28.975 35.3 4 24.2 11.55 29.2 35.05 5 25.15 14.149999999999999 24.025 36.675000000000004 6 25.724999999999998 19.275000000000002 29.075 25.924999999999997 7 18.4 24.825 39.825 16.950000000000003 8 19.225 25.074999999999996 35.4 20.3 9 18.675 28.475 33.575 19.275000000000002 10-11 19.4375 27.325 32.425 20.8125 12-13 20.125 27.8125 31.162499999999998 20.9 14-15 20.2625 26.200000000000003 31.474999999999998 22.0625 16-17 21.1625 25.224999999999998 30.162499999999998 23.45 18-19 20.26756689172293 26.76919229807452 29.707426856714182 23.25581395348837 20-21 21.0375 25.162499999999998 29.2875 24.5125 22-23 21.375 25.25 28.812500000000004 24.5625 24-25 20.7125 26.650000000000002 29.5875 23.05 26-27 21.8 25.937500000000004 27.450000000000003 24.8125 28-29 21.0125 25.2625 27.450000000000003 26.275 30-31 20.7125 26.087500000000002 28.675 24.525 32-33 22.4625 25.5 28.462500000000002 23.575 34-35 21.675 24.6125 28.249999999999996 25.4625 36-37 21.337500000000002 26.5 27.962500000000002 24.2 38-39 22.05 25.912499999999998 27.925 24.1125 40-41 21.712500000000002 25.324999999999996 27.825 25.137500000000003 42-43 21.675 24.8625 28.125 25.337500000000002 44-45 22.25 25.587500000000002 27.0125 25.15 46-47 22.05 25.5125 26.075 26.3625 48-49 21.425 26.5 27.962500000000002 24.1125 50-51 21.512500000000003 25.424999999999997 27.450000000000003 25.6125 52-53 21.9375 24.9 27.35 25.8125 54-55 21.4875 25.974999999999998 28.549999999999997 23.9875 56-57 21.1875 26.25 27.725 24.837500000000002 58-59 21.925 25.05 27.787499999999998 25.2375 60-61 21.2625 25.2 27.275 26.2625 62-63 22.45 25.75 27.212500000000002 24.587500000000002 64-65 21.775 24.875 26.8375 26.5125 66-67 20.5625 27.1375 28.0875 24.212500000000002 68-69 22.6 26.337500000000002 27.025 24.0375 70-71 22.8125 26.1625 25.575 25.45 72-73 22.1 26.0375 26.875 24.9875 74-75 22.3125 25.75 26.974999999999998 24.962500000000002 76-77 23.8375 25.2 25.424999999999997 25.5375 78-79 22.075 25.825 28.000000000000004 24.099999999999998 80-81 22.75 26.950000000000003 25.85 24.45 82-83 23.2125 25.662499999999998 25.174999999999997 25.95 84-85 23.3375 26.1625 26.087500000000002 24.4125 86-87 24.775 24.7 25.825 24.7 88-89 23.474999999999998 25.424999999999997 26.125 24.975 90-91 23.65 26.6 26.3125 23.4375 92-93 23.4625 26.2125 26.7125 23.6125 94-95 24.325 25.5125 26.1125 24.05 96-97 25.5125 26.0375 25.825 22.625 98-99 23.3625 26.487500000000004 26.3 23.849999999999998 100-101 25.662499999999998 25.8125 24.8125 23.7125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 19.0 1 16.0 2 10.5 3 6.0 4 2.5 5 3.5 6 3.5 7 1.0 8 1.0 9 1.5 10 1.5 11 1.5 12 2.0 13 2.0 14 2.0 15 1.5 16 0.5 17 0.5 18 1.0 19 0.5 20 1.0 21 2.0 22 2.0 23 3.5 24 6.0 25 7.0 26 6.0 27 6.0 28 11.0 29 13.5 30 13.5 31 19.5 32 26.5 33 29.0 34 37.0 35 48.0 36 60.0 37 76.0 38 90.5 39 108.5 40 137.0 41 182.0 42 216.0 43 210.0 44 209.5 45 206.0 46 189.0 47 178.0 48 181.0 49 162.0 50 149.5 51 156.5 52 129.5 53 111.5 54 97.0 55 80.0 56 70.0 57 60.5 58 53.5 59 59.0 60 63.0 61 60.5 62 49.5 63 41.0 64 44.5 65 41.0 66 35.0 67 29.0 68 24.0 69 25.0 70 22.0 71 16.5 72 12.5 73 9.5 74 10.0 75 8.5 76 8.0 77 9.0 78 7.5 79 4.0 80 2.0 81 1.5 82 0.5 83 0.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.025 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.15 #Duplication Level Percentage of deduplicated Percentage of total 1 98.76479670612454 95.95 2 0.8749356664951106 1.7000000000000002 3 0.1544004117344313 0.44999999999999996 4 0.0514668039114771 0.2 5 0.0 0.0 6 0.07720020586721565 0.44999999999999996 7 0.02573340195573855 0.17500000000000002 8 0.02573340195573855 0.2 9 0.0 0.0 >10 0.02573340195573855 0.8750000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 35 0.8750000000000001 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 8 0.2 No Hit TGGGGGTGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 7 0.17500000000000002 No Hit TCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 6 0.15 No Hit TCTTCGTATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 6 0.15 No Hit CCACCGAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.0875 0.0 0.0 0.0 0.0 26-27 0.1125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.15 0.0 0.0 0.0 0.0 36-37 0.16249999999999998 0.0 0.0 0.0 0.0 38-39 0.225 0.0 0.0 0.0 0.0 40-41 0.275 0.0 0.0 0.0 0.0 42-43 0.3375 0.0 0.0 0.0 0.0 44-45 0.3625 0.0 0.0 0.0 0.0 46-47 0.5 0.0 0.0 0.0 0.0 48-49 0.575 0.0 0.0 0.0 0.0 50-51 0.6125 0.0 0.0 0.0 0.0 52-53 0.7124999999999999 0.0 0.0 0.0 0.0 54-55 0.825 0.0 0.0 0.0 0.0 56-57 0.8875 0.0 0.0 0.0 0.0 58-59 0.975 0.0 0.0 0.0 0.0 60-61 1.1 0.0 0.0 0.0 0.0 62-63 1.275 0.0 0.0 0.0 0.0 64-65 1.45 0.0 0.0 0.0 0.0 66-67 1.75 0.0 0.0 0.0 0.0 68-69 2.1 0.0 0.0 0.0 0.0 70-71 2.4 0.0 0.0 0.0 0.0 72-73 2.8 0.0 0.0 0.0 0.0 74-75 3.25 0.0 0.0 0.0 0.0 76-77 3.55 0.0 0.0 0.0 0.0 78-79 3.925 0.0 0.0 0.0 0.0 80-81 4.5875 0.0 0.0 0.0 0.0 82-83 5.175 0.0 0.0 0.0 0.0 84-85 5.6875 0.0 0.0 0.0 0.0 86-87 6.2125 0.0 0.0 0.0 0.0 88-89 6.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTAGTT 15 6.142176E-4 95.0 9 TATTTAG 15 6.142176E-4 95.0 7 ATTTAGT 15 6.142176E-4 95.0 8 TCGATAG 15 0.009957196 47.5 26-27 ATCTACC 15 0.009957196 47.5 34-35 GTATCTA 15 0.009957196 47.5 32-33 TCTATTA 15 0.009957196 47.5 18-19 TCTACCG 15 0.009957196 47.5 36-37 AGTATCT 15 0.009957196 47.5 32-33 TAGTATC 15 0.009957196 47.5 30-31 ATTAATC 15 0.009957196 47.5 22-23 TAATCGA 15 0.009957196 47.5 24-25 TATTAAT 15 0.009957196 47.5 20-21 TTAATCG 15 0.009957196 47.5 22-23 ATCGATA 15 0.009957196 47.5 26-27 AATCGAT 15 0.009957196 47.5 24-25 CTACCGG 15 0.009957196 47.5 36-37 GATAGTA 15 0.009957196 47.5 28-29 CTATTAA 15 0.009957196 47.5 20-21 >>END_MODULE Read 1943577 spots for ERR3317444.sra Written 1943577 spots for ERR3317444.sra Read 1943577 spots for ERR3317444.sra Written 1943577 spots for ERR3317444.sra Read 1943577 spots for ERR3317444.sra Written 1943577 spots for ERR3317444.sra Read 1943577 spots for ERR3317444.sra Written 1943577 spots for ERR3317444.sra Read 1943577 spots for ERR3317444.sra Written 1943577 spots for ERR3317444.sra Read 1943577 spots for ERR3317444.sra Written 1943577 spots for ERR3317444.sra Read 1943577 spots for ERR3317444.sra Written 1943577 spots for ERR3317444.sra Read 1943577 spots for ERR3317444.sra Written 1943577 spots for ERR3317444.sra Read 1943577 spots for ERR3317444.sra Written 1943577 spots for ERR3317444.sra Read 1943577 spots for ERR3317444.sra Written 1943577 spots for ERR3317444.sra Read 1943577 spots for ERR3317444.sra Written 1943577 spots for ERR3317444.sra Read 1943577 spots for ERR3317444.sra Written 1943577 spots for ERR3317444.sra Read 1943577 spots for ERR3317444.sra Written 1943577 spots for ERR3317444.sra Read 1943577 spots for ERR3317444.sra Written 1943577 spots for ERR3317444.sra Read 1943577 spots for ERR3317444.sra Written 1943577 spots for ERR3317444.sra Read 1943577 spots for ERR3317444.sra Written 1943577 spots for ERR3317444.sra Read 1943577 spots for ERR3317444.sra Written 1943577 spots for ERR3317444.sra Read 1943581 spots for ERR3317444.sra Written 1943581 spots for ERR3317444.sra Read 1943577 spots for ERR3317444.sra Written 1943577 spots for ERR3317444.sra Read 1943577 spots for ERR3317444.sra Written 1943577 spots for ERR3317444.sra SRR ids: ['ERR3317444.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bm81x7rg ERR3317444.sra spots: 38871544 blocks: [[1, 1943577], [1943578, 3887154], [3887155, 5830731], [5830732, 7774308], [7774309, 9717885], [9717886, 11661462], [11661463, 13605039], [13605040, 15548616], [15548617, 17492193], [17492194, 19435770], [19435771, 21379347], [21379348, 23322924], [23322925, 25266501], [25266502, 27210078], [27210079, 29153655], [29153656, 31097232], [31097233, 33040809], [33040810, 34984386], [34984387, 36927963], [36927964, 38871544]] ERR3317444 file size 9354541 ERR3317444 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317444 ERR3317444_1.fastq ERR3317444_2.fastq Input file: ERR3317444_1.fastq Paired file: ERR3317444_2.fastq trimmed: ERR3317444-trimmed-pair1.fastq, ERR3317444-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:30:16 2024 >> started Tue Dec 10 09:31:00 2024 >> done (44.351s) 38871544 read pairs processed; of these: 226500 ( 0.58%) short read pairs filtered out after trimming by size control 581062 ( 1.49%) empty read pairs filtered out after trimming by size control 38063982 (97.92%) read pairs available; of these: 10812320 (28.41%) trimmed read pairs available after processing 27251662 (71.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 728 0.00% 19 813 0.00% 20 1130 0.00% 21 1345 0.00% 22 1677 0.00% 23 2353 0.01% 24 2794 0.01% 25 3605 0.01% 26 3730 0.01% 27 4442 0.01% 28 4792 0.01% 29 5723 0.02% 30 6723 0.02% 31 10361 0.03% 32 8356 0.02% 33 9059 0.02% 34 11355 0.03% 35 11312 0.03% 36 12562 0.03% 37 13251 0.03% 38 15460 0.04% 39 16314 0.04% 40 16607 0.04% 41 18151 0.05% 42 19609 0.05% 43 20405 0.05% 44 21647 0.06% 45 22545 0.06% 46 24401 0.06% 47 28451 0.07% 48 28752 0.08% 49 30364 0.08% 50 34114 0.09% 51 33121 0.09% 52 34927 0.09% 53 39149 0.10% 54 43580 0.11% 55 49204 0.13% 56 47732 0.13% 57 48778 0.13% 58 50940 0.13% 59 66294 0.17% 60 78624 0.21% 61 81394 0.21% 62 89821 0.24% 63 92599 0.24% 64 100312 0.26% 65 103371 0.27% 66 114374 0.30% 67 114597 0.30% 68 117414 0.31% 69 118692 0.31% 70 129737 0.34% 71 138658 0.36% 72 140606 0.37% 73 146005 0.38% 74 143731 0.38% 75 143576 0.38% 76 144521 0.38% 77 151534 0.40% 78 164519 0.43% 79 163954 0.43% 80 168495 0.44% 81 172149 0.45% 82 172975 0.45% 83 180800 0.47% 84 188659 0.50% 85 204299 0.54% 86 211685 0.56% 87 217708 0.57% 88 219541 0.58% 89 248932 0.65% 90 232105 0.61% 91 239136 0.63% 92 254196 0.67% 93 265520 0.70% 94 289908 0.76% 95 316306 0.83% 96 354045 0.93% 97 414879 1.09% 98 539734 1.42% 99 709033 1.86% 100 1907520 5.01% 101 27251662 71.59% 38063982 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=16 prefix-density=0.78 prefix-fanout=2.5 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.12 sequence-density-rank=18 fanout-score=19.25 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=6.7 sequence=TCCTCCTCCGCCG criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=19 prefix-density=0.75 prefix-fanout=1.0 sequence=ATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=72.25 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=16.6 sequence=CCTTCTTCTCCTCCTTGGTGGCCTTGGAGGAGATGACGGTCTTGAGGTCGTA ERR3317444 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:31:49 Started mapping on | Dec 10 09:31:50 Finished on | Dec 10 09:34:04 Mapping speed, Million of reads per hour | 1022.61 Number of input reads | 38063982 Average input read length | 193 UNIQUE READS: Uniquely mapped reads number | 33683494 Uniquely mapped reads % | 88.49% Average mapped length | 191.72 Number of splices: Total | 20986355 Number of splices: Annotated (sjdb) | 19943232 Number of splices: GT/AG | 20686005 Number of splices: GC/AG | 268584 Number of splices: AT/AC | 13868 Number of splices: Non-canonical | 17898 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.00% Deletion average length | 1.23 Insertion rate per base | 0.00% Insertion average length | 1.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 3079868 % of reads mapped to multiple loci | 8.09% Number of reads mapped to too many loci | 81917 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.91% % of reads unmapped: other | 1.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1466505 1466505 1466505 N_multimapping 3079868 3079868 3079868 N_noFeature 1294182 2892865 31336841 N_ambiguous 1032499 313782 17051 UnstrandedReadsAssigned:31356813 PositiveStrandReadsAssigned:30476847 NegativeStrandReadsAssigned:2329602 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 ERR3317444 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317444-trimmed-pair1.fastq ERR3317444-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,063,982 reads, 32,964,890 reads pseudoaligned [quant] estimated average fragment length: 187.606 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,228 rounds 52973 ERR3317444.ke.tsv 35125 ERR3317444.se.tsv 88098 total ==> ERR3317444.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 749.618 0 0 PNS24247 1044 857.394 53.6479 2.87192 PNS24249 1928 1741.39 102.818 2.71003 PNS24246 1044 857.394 53.6479 2.87192 PNS24248 1044 857.394 53.6479 2.87192 PNS24244 1471 1284.39 293.238 10.479 PNS24243 293 133.129 1 0.344767 KQK14069 1603 1416.39 5043.32 163.43 KQK14071 474 294.068 13.5396 2.11329 ==> ERR3317444.se.tsv <== BRADI_1g14170v3 5615 BRADI_1g53295v3 39 BRADI_1g59795v3 339 BRADI_1g07683v3 0 BRADI_1g00485v3 41 BRADI_1g20270v3 678 BRADI_1g74790v3 1280 BRADI_1g09890v3 17 BRADI_1g77505v3 381 BRADI_1g48960v3 1 ERR3317444 completed mapping pipeline successfully