Starting /dee2/code/volunteer_pipeline.sh ERR3317445 current disk space = 1525161127936 free memory = 1528039192 ERR3317445 SRAfilesize cea253dab91afd32fef213e3a2728d56 ERR3317445.sra ERR3317445.sra file validated ERR3317445 is paired end ERR3317445 is conventional basespace ERR3317445 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317445_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4835 34.0 31.0 34.0 31.0 34.0 2 32.3055 34.0 31.0 34.0 31.0 34.0 3 32.90075 34.0 33.0 34.0 31.0 34.0 4 36.43625 37.0 37.0 37.0 35.0 37.0 5 36.4255 37.0 37.0 37.0 35.0 37.0 6 36.48325 37.0 37.0 37.0 35.0 37.0 7 36.50325 37.0 37.0 37.0 35.0 37.0 8 36.46825 37.0 37.0 37.0 35.0 37.0 9 38.3235 39.0 39.0 39.0 37.0 39.0 10-11 38.299 39.0 39.0 39.0 37.0 39.0 12-13 38.229749999999996 39.0 39.0 39.0 37.0 39.0 14-15 39.82225 41.0 40.0 41.0 38.0 41.0 16-17 39.797 41.0 40.0 41.0 38.0 41.0 18-19 39.809375 41.0 40.0 41.0 38.0 41.0 20-21 39.763875 41.0 40.0 41.0 38.0 41.0 22-23 39.660124999999994 41.0 40.0 41.0 37.0 41.0 24-25 39.5475 41.0 40.0 41.0 37.0 41.0 26-27 39.37375 41.0 39.5 41.0 36.5 41.0 28-29 39.161125 41.0 39.0 41.0 36.0 41.0 30-31 39.024125 41.0 39.0 41.0 35.5 41.0 32-33 38.714625 40.0 38.5 41.0 34.5 41.0 34-35 38.579875 40.0 38.0 41.0 35.0 41.0 36-37 38.413624999999996 40.0 38.0 41.0 34.0 41.0 38-39 38.224000000000004 40.0 38.0 41.0 33.5 41.0 40-41 38.017250000000004 40.0 38.0 41.0 33.5 41.0 42-43 38.033500000000004 40.0 38.0 41.0 33.5 41.0 44-45 37.84 40.0 37.5 41.0 33.0 41.0 46-47 37.570499999999996 40.0 37.0 41.0 33.0 41.0 48-49 37.2615 40.0 36.0 41.0 32.0 41.0 50-51 37.5535 40.0 36.0 41.0 33.0 41.0 52-53 37.428375 40.0 36.0 41.0 33.0 41.0 54-55 37.150625 39.0 35.0 41.0 33.0 41.0 56-57 36.8635 39.0 35.0 41.0 33.0 41.0 58-59 36.593875 39.0 35.0 41.0 32.0 41.0 60-61 36.173125 38.0 35.0 41.0 31.5 41.0 62-63 35.876000000000005 37.0 35.0 40.0 31.0 41.0 64-65 35.444625 36.5 35.0 40.0 30.5 41.0 66-67 35.1265 36.0 35.0 39.0 30.5 41.0 68-69 34.776 35.5 35.0 39.0 30.0 41.0 70-71 34.349375 35.0 34.0 37.5 30.0 40.0 72-73 33.911249999999995 35.0 34.0 37.0 29.0 39.0 74-75 33.53075 35.0 34.0 36.5 29.0 39.0 76-77 32.306124999999994 34.5 32.5 35.5 26.5 37.0 78-79 32.660250000000005 35.0 33.5 36.0 26.5 37.0 80-81 32.544250000000005 35.0 33.5 35.0 27.0 37.0 82-83 32.297375 35.0 33.0 35.0 27.0 36.5 84-85 32.0355 35.0 33.0 35.0 26.0 36.0 86-87 31.88875 35.0 33.0 35.0 25.0 36.0 88-89 31.721249999999998 35.0 33.0 35.0 25.5 35.5 90-91 31.34975 35.0 33.0 35.0 24.0 35.0 92-93 31.19525 35.0 33.0 35.0 23.5 35.0 94-95 30.855625 35.0 32.0 35.0 21.5 35.0 96-97 30.475875000000002 35.0 32.0 35.0 14.5 35.0 98-99 30.113374999999998 35.0 32.0 35.0 2.0 35.0 100-101 27.843 33.0 27.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 6.0 10 5.0 11 7.0 12 6.0 13 11.0 14 10.0 15 9.0 16 8.0 17 7.0 18 11.0 19 12.0 20 12.0 21 11.0 22 11.0 23 19.0 24 7.0 25 20.0 26 30.0 27 31.0 28 43.0 29 51.0 30 48.0 31 68.0 32 107.0 33 121.0 34 197.0 35 299.0 36 563.0 37 1048.0 38 1085.0 39 133.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.843446283162592 26.004728132387704 19.38534278959811 26.766482794851587 2 25.900000000000002 24.0 19.475 30.625000000000004 3 27.05 26.25 17.349999999999998 29.349999999999998 4 27.825 24.55 16.875 30.75 5 28.557139284821204 25.206301575393848 16.65416354088522 29.582395598899723 6 29.9 27.6 19.425 23.075000000000003 7 29.599999999999998 22.725 21.675 26.0 8 33.15 23.474999999999998 24.25 19.125 9 32.05 26.75 25.2 16.0 10-11 33.550000000000004 26.075 22.0625 18.3125 12-13 30.7125 25.074999999999996 24.887500000000003 19.325 14-15 28.999999999999996 25.7 24.1125 21.1875 16-17 25.8625 26.625 25.124999999999996 22.3875 18-19 25.5 26.125 25.587500000000002 22.787499999999998 20-21 25.6 26.575 24.587500000000002 23.2375 22-23 25.687500000000004 27.275 24.775 22.2625 24-25 24.962500000000002 25.7375 26.187500000000004 23.1125 26-27 25.7375 27.175 24.65 22.4375 28-29 25.974999999999998 25.337500000000002 25.387500000000003 23.3 30-31 25.6 26.6 25.324999999999996 22.475 32-33 25.087500000000002 26.5 24.775 23.6375 34-35 25.587500000000002 26.1625 24.2875 23.962500000000002 36-37 26.137500000000003 25.75 25.5 22.6125 38-39 25.687500000000004 25.825 25.174999999999997 23.3125 40-41 25.4375 26.25 24.775 23.5375 42-43 25.25 25.7375 25.424999999999997 23.5875 44-45 26.4625 26.3 25.650000000000002 21.587500000000002 46-47 26.775 25.7375 24.425 23.0625 48-49 26.375 25.45 25.6 22.575 50-51 25.424999999999997 26.974999999999998 25.15 22.45 52-53 26.387500000000003 26.0375 24.7 22.875 54-55 25.424999999999997 26.900000000000002 24.887500000000003 22.787499999999998 56-57 25.7375 26.437500000000004 25.2625 22.5625 58-59 25.7625 26.674999999999997 24.0 23.5625 60-61 24.775 26.337500000000002 26.0 22.8875 62-63 25.25 26.337500000000002 25.3125 23.1 64-65 25.6125 26.0375 24.55 23.799999999999997 66-67 25.137500000000003 26.137500000000003 25.374999999999996 23.35 68-69 24.775 27.075 24.75 23.400000000000002 70-71 26.3125 26.0625 24.1625 23.4625 72-73 25.424999999999997 26.387500000000003 24.65 23.5375 74-75 25.9625 26.5625 24.9875 22.4875 76-77 25.674999999999997 26.5 24.175 23.65 78-79 25.7625 26.9125 25.2625 22.0625 80-81 25.8125 26.700000000000003 24.3625 23.125 82-83 25.324999999999996 26.2125 24.5125 23.95 84-85 25.662499999999998 26.900000000000002 24.349999999999998 23.0875 86-87 25.5125 25.7375 25.15 23.599999999999998 88-89 27.237499999999997 26.3 23.6375 22.825 90-91 25.7375 26.1125 24.575 23.575 92-93 25.112499999999997 26.987499999999997 24.15 23.75 94-95 25.3 26.825 24.325 23.549999999999997 96-97 25.674999999999997 27.6125 23.925 22.787499999999998 98-99 25.112499999999997 27.6875 24.15 23.05 100-101 26.424999999999997 26.787499999999998 23.4375 23.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.0 18 1.0 19 2.5 20 3.5 21 2.0 22 1.0 23 2.5 24 2.5 25 3.5 26 3.0 27 2.0 28 6.0 29 8.5 30 13.5 31 16.0 32 14.5 33 13.0 34 15.5 35 27.0 36 46.0 37 64.5 38 81.0 39 104.5 40 134.0 41 154.5 42 163.0 43 173.0 44 188.5 45 196.5 46 193.5 47 194.0 48 184.5 49 165.0 50 166.0 51 157.5 52 142.0 53 132.0 54 119.0 55 109.0 56 105.0 57 97.0 58 83.5 59 79.5 60 68.5 61 53.0 62 47.0 63 50.5 64 48.0 65 42.5 66 37.0 67 34.0 68 31.0 69 29.0 70 29.0 71 25.5 72 20.0 73 19.5 74 19.0 75 13.5 76 11.0 77 6.5 78 5.5 79 8.0 80 4.5 81 2.0 82 3.5 83 4.0 84 2.0 85 2.0 86 3.5 87 2.0 88 0.5 89 0.5 90 0.0 91 1.0 92 1.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.825 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.70229007633587 96.975 2 0.9923664122137404 1.95 3 0.2035623409669211 0.6 4 0.05089058524173028 0.2 5 0.02544529262086514 0.125 6 0.02544529262086514 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTTAACTGGGGGATTCACCGCAAATACTACTTTGGCTCATTATTGCCGC 6 0.15 No Hit CAGCCTGCTAACTAGCTATGCGGAGCCATCCCTCCGCAGCTAGCTTCTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.0625 0.0 0.0 0.0 0.0 22-23 0.0875 0.0 0.0 0.0 0.0 24-25 0.1125 0.0 0.0 0.0 0.0 26-27 0.16249999999999998 0.0 0.0 0.0 0.0 28-29 0.1875 0.0 0.0 0.0 0.0 30-31 0.2 0.0 0.0 0.0 0.0 32-33 0.25 0.0 0.0 0.0 0.0 34-35 0.275 0.0 0.0 0.0 0.0 36-37 0.36250000000000004 0.0 0.0 0.0 0.0 38-39 0.425 0.0 0.0 0.0 0.0 40-41 0.4875 0.0 0.0 0.0 0.0 42-43 0.55 0.0 0.0 0.0 0.0 44-45 0.625 0.0 0.0 0.0 0.0 46-47 0.725 0.0 0.0 0.0 0.0 48-49 0.8375 0.0 0.0 0.0 0.0 50-51 1.0499999999999998 0.0 0.0 0.0 0.0 52-53 1.1625 0.0 0.0 0.0 0.0 54-55 1.3375 0.0 0.0 0.0 0.0 56-57 1.65 0.0 0.0 0.0 0.0 58-59 1.8875000000000002 0.0 0.0 0.0 0.0 60-61 2.2625 0.0 0.0 0.0 0.0 62-63 2.4625 0.0 0.0 0.0 0.0 64-65 2.575 0.0 0.0 0.0 0.0 66-67 2.8499999999999996 0.0 0.0 0.0 0.0 68-69 3.1624999999999996 0.0 0.0 0.0 0.0 70-71 3.4625 0.0 0.0 0.0 0.0 72-73 3.875 0.0 0.0 0.0 0.0 74-75 4.2625 0.0 0.0 0.0 0.0 76-77 4.75 0.0 0.0 0.0 0.0 78-79 5.237500000000001 0.0 0.0 0.0 0.0 80-81 5.8625 0.0 0.0 0.0 0.0 82-83 6.3875 0.0 0.0 0.0 0.0 84-85 6.9125 0.0 0.0 0.0 0.0 86-87 7.5 0.0 0.0 0.0 0.0 88-89 8.212499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317445 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317445_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.19375 34.0 31.0 34.0 31.0 34.0 2 31.8195 34.0 31.0 34.0 30.0 34.0 3 32.3775 34.0 31.0 34.0 31.0 34.0 4 35.5155 37.0 37.0 37.0 35.0 37.0 5 35.7075 37.0 37.0 37.0 35.0 37.0 6 35.767 37.0 37.0 37.0 35.0 37.0 7 35.82525 37.0 37.0 37.0 35.0 37.0 8 35.83275 37.0 37.0 37.0 35.0 37.0 9 37.571 39.0 39.0 39.0 35.0 39.0 10-11 37.602125 39.0 39.0 39.0 36.0 39.0 12-13 37.557 39.0 39.0 39.0 35.5 39.0 14-15 39.161874999999995 41.0 40.0 41.0 37.0 41.0 16-17 39.112875 41.0 40.0 41.0 37.0 41.0 18-19 39.032375 41.0 40.0 41.0 36.5 41.0 20-21 38.957 41.0 40.0 41.0 36.0 41.0 22-23 38.869875 41.0 40.0 41.0 35.5 41.0 24-25 38.846500000000006 41.0 40.0 41.0 36.0 41.0 26-27 38.7985 41.0 40.0 41.0 36.0 41.0 28-29 38.7005 41.0 39.5 41.0 35.5 41.0 30-31 38.485749999999996 41.0 39.0 41.0 35.0 41.0 32-33 38.401125 41.0 39.0 41.0 35.0 41.0 34-35 38.298625 41.0 39.0 41.0 35.0 41.0 36-37 38.0115 40.0 38.0 41.0 34.0 41.0 38-39 37.98775 40.0 38.0 41.0 34.0 41.0 40-41 38.145875000000004 41.0 39.0 41.0 35.0 41.0 42-43 38.079875 41.0 39.0 41.0 34.0 41.0 44-45 37.88125 40.5 38.0 41.0 33.5 41.0 46-47 37.702625 40.0 38.0 41.0 33.0 41.0 48-49 37.618625 40.0 37.5 41.0 33.0 41.0 50-51 36.82575 39.5 36.0 40.5 32.5 41.0 52-53 36.73175 39.5 36.0 40.5 32.0 41.0 54-55 36.898624999999996 40.0 36.0 41.0 33.0 41.0 56-57 36.701875 39.5 35.0 41.0 32.0 41.0 58-59 36.4335 39.0 35.0 41.0 31.0 41.0 60-61 36.171375 39.0 35.0 41.0 31.0 41.0 62-63 35.829625 38.0 35.0 40.5 31.0 41.0 64-65 35.593 37.0 35.0 40.0 31.0 41.0 66-67 35.57725 37.0 35.0 40.0 31.0 41.0 68-69 35.260374999999996 37.0 35.0 39.5 31.0 41.0 70-71 34.92975 36.0 35.0 39.0 31.0 41.0 72-73 34.556625 35.5 35.0 39.0 31.0 40.5 74-75 34.14825 35.0 35.0 37.0 30.0 39.5 76-77 33.813625 35.0 35.0 37.0 30.0 39.0 78-79 33.48875 35.0 34.5 36.5 30.0 39.0 80-81 33.141875 35.0 34.0 36.0 29.0 37.0 82-83 32.935125 35.0 34.0 36.0 29.0 37.0 84-85 32.6315 35.0 34.0 35.0 28.5 36.5 86-87 32.455375000000004 35.0 34.0 35.0 28.5 36.0 88-89 32.23475 35.0 34.0 35.0 27.0 36.0 90-91 32.044250000000005 35.0 34.0 35.0 26.5 36.0 92-93 31.947874999999996 35.0 34.0 35.0 26.5 35.5 94-95 31.834000000000003 35.0 34.0 35.0 26.5 35.0 96-97 31.72 35.0 33.5 35.0 26.0 35.0 98-99 31.46975 35.0 33.0 35.0 25.5 35.0 100-101 29.66875 33.5 30.0 35.0 13.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 58.0 3 8.0 4 6.0 5 2.0 6 3.0 7 2.0 8 6.0 9 3.0 10 7.0 11 7.0 12 4.0 13 6.0 14 7.0 15 8.0 16 10.0 17 12.0 18 7.0 19 5.0 20 6.0 21 5.0 22 2.0 23 11.0 24 12.0 25 15.0 26 18.0 27 15.0 28 25.0 29 32.0 30 38.0 31 48.0 32 69.0 33 81.0 34 129.0 35 246.0 36 442.0 37 961.0 38 1401.0 39 283.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.025000000000002 11.225 30.375000000000004 29.375 2 25.674999999999997 11.575000000000001 25.575 37.175000000000004 3 23.3 12.5 29.475 34.725 4 24.45 11.725 28.050000000000004 35.775 5 25.75 15.35 24.25 34.65 6 26.825 18.675 28.125 26.375 7 19.55 24.9 38.525 17.025000000000002 8 19.05 24.0 36.199999999999996 20.75 9 18.375 28.025 34.25 19.35 10-11 20.349999999999998 27.55 30.575000000000003 21.525 12-13 18.95 26.3125 32.875 21.8625 14-15 20.724999999999998 26.174999999999997 29.4875 23.6125 16-17 20.724999999999998 27.037499999999998 28.849999999999998 23.3875 18-19 19.78997374671834 27.365920740092513 29.966245780722588 22.877859732466558 20-21 20.5 25.775 29.675 24.05 22-23 20.5125 25.3 29.3875 24.8 24-25 20.0 26.450000000000003 28.999999999999996 24.55 26-27 20.9375 26.325 27.5625 25.174999999999997 28-29 21.6125 25.387500000000003 26.787499999999998 26.2125 30-31 19.9875 26.424999999999997 29.2875 24.3 32-33 22.537499999999998 25.074999999999996 27.2625 25.124999999999996 34-35 21.475 25.4375 26.924999999999997 26.1625 36-37 21.475 26.2125 27.787499999999998 24.525 38-39 21.875 25.412499999999998 27.400000000000002 25.3125 40-41 22.5125 25.1875 26.7125 25.587500000000002 42-43 20.875 25.8625 27.537499999999998 25.724999999999998 44-45 22.625 26.987499999999997 26.025 24.3625 46-47 22.275 25.412499999999998 26.075 26.237500000000004 48-49 21.1625 27.2625 26.887499999999996 24.6875 50-51 23.05 25.974999999999998 25.8125 25.162499999999998 52-53 22.175 24.975 26.650000000000002 26.200000000000003 54-55 22.775000000000002 25.624999999999996 27.125 24.474999999999998 56-57 21.712500000000002 25.825 27.212500000000002 25.25 58-59 22.775000000000002 24.925 26.487500000000004 25.8125 60-61 21.9 25.6 28.549999999999997 23.95 62-63 21.7875 26.325 27.037499999999998 24.85 64-65 22.3625 25.124999999999996 26.5875 25.924999999999997 66-67 21.762500000000003 25.874999999999996 27.8875 24.474999999999998 68-69 23.2875 25.8125 26.437500000000004 24.462500000000002 70-71 22.3375 25.2375 25.5 26.924999999999997 72-73 23.025000000000002 25.837500000000002 26.4125 24.725 74-75 22.2625 25.825 26.424999999999997 25.4875 76-77 23.4875 24.7875 25.7875 25.937500000000004 78-79 22.55 26.224999999999998 26.5625 24.6625 80-81 23.575 26.125 26.1625 24.1375 82-83 23.0875 25.825 25.674999999999997 25.412499999999998 84-85 23.375 25.937500000000004 26.387500000000003 24.3 86-87 24.3125 26.150000000000002 24.75 24.7875 88-89 23.45 25.624999999999996 25.4375 25.4875 90-91 24.3125 25.974999999999998 26.125 23.5875 92-93 24.0375 26.787499999999998 25.35 23.825 94-95 24.2 25.474999999999998 25.3 25.025 96-97 24.9375 26.087500000000002 26.137500000000003 22.8375 98-99 24.9375 25.275 25.424999999999997 24.3625 100-101 25.0125 24.9125 25.724999999999998 24.349999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 20.0 1 15.5 2 7.5 3 4.0 4 2.5 5 0.5 6 1.0 7 1.5 8 1.0 9 0.5 10 1.0 11 1.5 12 1.0 13 0.5 14 1.0 15 2.0 16 2.0 17 1.0 18 0.5 19 1.0 20 1.5 21 4.0 22 4.0 23 1.5 24 3.5 25 4.5 26 4.0 27 5.5 28 7.5 29 8.0 30 8.5 31 16.5 32 24.5 33 28.5 34 40.5 35 47.5 36 55.0 37 74.0 38 85.5 39 114.5 40 147.0 41 167.5 42 196.5 43 212.5 44 206.0 45 197.0 46 201.5 47 181.0 48 154.5 49 156.5 50 171.5 51 167.0 52 137.5 53 122.0 54 104.5 55 86.5 56 79.0 57 75.5 58 72.0 59 69.0 60 66.0 61 56.0 62 43.5 63 40.0 64 39.0 65 31.5 66 29.5 67 31.5 68 30.0 69 24.5 70 17.5 71 15.5 72 13.0 73 9.0 74 9.5 75 9.0 76 6.0 77 6.5 78 7.0 79 4.0 80 2.5 81 2.5 82 2.5 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0125 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.95514780835882 97.075 2 0.764525993883792 1.5 3 0.1783893985728848 0.525 4 0.0 0.0 5 0.0764525993883792 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025484199796126403 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 21 0.525 No Hit TTTTTCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit TGGGGCTGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 5 0.125 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.037500000000000006 0.0 0.0 0.0 0.0 26-27 0.0875 0.0 0.0 0.0 0.0 28-29 0.1125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.175 0.0 0.0 0.0 0.0 36-37 0.25 0.0 0.0 0.0 0.0 38-39 0.275 0.0 0.0 0.0 0.0 40-41 0.3375 0.0 0.0 0.0 0.0 42-43 0.4 0.0 0.0 0.0 0.0 44-45 0.475 0.0 0.0 0.0 0.0 46-47 0.575 0.0 0.0 0.0 0.0 48-49 0.6875 0.0 0.0 0.0 0.0 50-51 0.8875 0.0 0.0 0.0 0.0 52-53 1.0 0.0 0.0 0.0 0.0 54-55 1.1875 0.0 0.0 0.0 0.0 56-57 1.5 0.0 0.0 0.0 0.0 58-59 1.7374999999999998 0.0 0.0 0.0 0.0 60-61 2.1125 0.0 0.0 0.0 0.0 62-63 2.3125 0.0 0.0 0.0 0.0 64-65 2.425 0.0 0.0 0.0 0.0 66-67 2.675 0.0 0.0 0.0 0.0 68-69 2.9875 0.0 0.0 0.0 0.0 70-71 3.2625 0.0 0.0 0.0 0.0 72-73 3.6375 0.0 0.0 0.0 0.0 74-75 4.025 0.0 0.0 0.0 0.0 76-77 4.512499999999999 0.0 0.0 0.0 0.0 78-79 5.012499999999999 0.0 0.0 0.0 0.0 80-81 5.6375 0.0 0.0 0.0 0.0 82-83 6.1375 0.0 0.0 0.0 0.0 84-85 6.65 0.0 0.0 0.0 0.0 86-87 7.2 0.0 0.0 0.0 0.0 88-89 7.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1895371 spots for ERR3317445.sra Written 1895371 spots for ERR3317445.sra Read 1895371 spots for ERR3317445.sra Written 1895371 spots for ERR3317445.sra Read 1895371 spots for ERR3317445.sra Written 1895371 spots for ERR3317445.sra Read 1895371 spots for ERR3317445.sra Written 1895371 spots for ERR3317445.sra Read 1895371 spots for ERR3317445.sra Written 1895371 spots for ERR3317445.sra Read 1895371 spots for ERR3317445.sra Written 1895371 spots for ERR3317445.sra Read 1895371 spots for ERR3317445.sra Written 1895371 spots for ERR3317445.sra Read 1895371 spots for ERR3317445.sra Written 1895371 spots for ERR3317445.sra Read 1895371 spots for ERR3317445.sra Written 1895371 spots for ERR3317445.sra Read 1895371 spots for ERR3317445.sra Written 1895371 spots for ERR3317445.sra Read 1895371 spots for ERR3317445.sra Written 1895371 spots for ERR3317445.sra Read 1895371 spots for ERR3317445.sra Written 1895371 spots for ERR3317445.sra Read 1895371 spots for ERR3317445.sra Written 1895371 spots for ERR3317445.sra Read 1895371 spots for ERR3317445.sra Written 1895371 spots for ERR3317445.sra Read 1895371 spots for ERR3317445.sra Written 1895371 spots for ERR3317445.sra Read 1895371 spots for ERR3317445.sra Written 1895371 spots for ERR3317445.sra Read 1895371 spots for ERR3317445.sra Written 1895371 spots for ERR3317445.sra Read 1895371 spots for ERR3317445.sra Written 1895371 spots for ERR3317445.sra Read 1895390 spots for ERR3317445.sra Written 1895390 spots for ERR3317445.sra Read 1895371 spots for ERR3317445.sra Written 1895371 spots for ERR3317445.sra SRR ids: ['ERR3317445.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hjv9rhu4 ERR3317445.sra spots: 37907439 blocks: [[1, 1895371], [1895372, 3790742], [3790743, 5686113], [5686114, 7581484], [7581485, 9476855], [9476856, 11372226], [11372227, 13267597], [13267598, 15162968], [15162969, 17058339], [17058340, 18953710], [18953711, 20849081], [20849082, 22744452], [22744453, 24639823], [24639824, 26535194], [26535195, 28430565], [28430566, 30325936], [30325937, 32221307], [32221308, 34116678], [34116679, 36012049], [36012050, 37907439]] ERR3317445 file size 9121988 ERR3317445 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317445 ERR3317445_1.fastq ERR3317445_2.fastq Input file: ERR3317445_1.fastq Paired file: ERR3317445_2.fastq trimmed: ERR3317445-trimmed-pair1.fastq, ERR3317445-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:31:34 2024 >> started Tue Dec 10 09:32:12 2024 >> done (37.856s) 37907439 read pairs processed; of these: 219286 ( 0.58%) short read pairs filtered out after trimming by size control 562784 ( 1.48%) empty read pairs filtered out after trimming by size control 37125369 (97.94%) read pairs available; of these: 11015226 (29.67%) trimmed read pairs available after processing 26110143 (70.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 855 0.00% 19 906 0.00% 20 1303 0.00% 21 1539 0.00% 22 2003 0.01% 23 2554 0.01% 24 3189 0.01% 25 3837 0.01% 26 4412 0.01% 27 5012 0.01% 28 5425 0.01% 29 5986 0.02% 30 6638 0.02% 31 8539 0.02% 32 8696 0.02% 33 9306 0.03% 34 11594 0.03% 35 11932 0.03% 36 12786 0.03% 37 13940 0.04% 38 15552 0.04% 39 17193 0.05% 40 17542 0.05% 41 19430 0.05% 42 20911 0.06% 43 22192 0.06% 44 24493 0.07% 45 24652 0.07% 46 26536 0.07% 47 29761 0.08% 48 30490 0.08% 49 32405 0.09% 50 36806 0.10% 51 36719 0.10% 52 37409 0.10% 53 41482 0.11% 54 46958 0.13% 55 52574 0.14% 56 51345 0.14% 57 52341 0.14% 58 55431 0.15% 59 70359 0.19% 60 84041 0.23% 61 86910 0.23% 62 94528 0.25% 63 98573 0.27% 64 105348 0.28% 65 111660 0.30% 66 121853 0.33% 67 121095 0.33% 68 123748 0.33% 69 125649 0.34% 70 137223 0.37% 71 146274 0.39% 72 155155 0.42% 73 155434 0.42% 74 152480 0.41% 75 153643 0.41% 76 155844 0.42% 77 160669 0.43% 78 171505 0.46% 79 169957 0.46% 80 176820 0.48% 81 180391 0.49% 82 178771 0.48% 83 188211 0.51% 84 194501 0.52% 85 207677 0.56% 86 214989 0.58% 87 220339 0.59% 88 222353 0.60% 89 242960 0.65% 90 237737 0.64% 91 245201 0.66% 92 259094 0.70% 93 273354 0.74% 94 295710 0.80% 95 317866 0.86% 96 353210 0.95% 97 414809 1.12% 98 532594 1.43% 99 694331 1.87% 100 1849686 4.98% 101 26110143 70.33% 37125369 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=15 prefix-density=0.71 prefix-fanout=2.7 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.12 sequence-density-rank=22 fanout-score=23.92 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=9.2 sequence=GGAGGAGAAGAAACTTACAAGGATTCCCCTAGTAACGGCGAGCGAACCGGGAGCAGCCCAGCTTGAGAATCGGGCGGCCGTGCCGTCCGAATTGTAGTCTGGAGAGGCGTCCTCAGCGACGGACCGGGCCCAAGTCCCCTGGAAAGGGGCGCCTGGGAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGGCTAAAT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=26 prefix-density=0.37 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=13 fanout-score=37.61 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=14.5 sequence=TCCTTCTTCTCC ERR3317445 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:32:47 Started mapping on | Dec 10 09:32:48 Finished on | Dec 10 09:34:51 Mapping speed, Million of reads per hour | 1086.60 Number of input reads | 37125369 Average input read length | 192 UNIQUE READS: Uniquely mapped reads number | 32613004 Uniquely mapped reads % | 87.85% Average mapped length | 190.94 Number of splices: Total | 20205851 Number of splices: Annotated (sjdb) | 19253125 Number of splices: GT/AG | 19914541 Number of splices: GC/AG | 257503 Number of splices: AT/AC | 14771 Number of splices: Non-canonical | 19036 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.00% Deletion average length | 1.22 Insertion rate per base | 0.00% Insertion average length | 1.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2444678 % of reads mapped to multiple loci | 6.58% Number of reads mapped to too many loci | 192387 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.14% % of reads unmapped: other | 2.91% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2222343 2222343 2222343 N_multimapping 2444678 2444678 2444678 N_noFeature 1339957 3065973 30208319 N_ambiguous 934213 282214 18019 UnstrandedReadsAssigned:30338834 PositiveStrandReadsAssigned:29264817 NegativeStrandReadsAssigned:2386666 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=99 echo kmer=95 ERR3317445 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317445-trimmed-pair1.fastq ERR3317445-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,125,369 reads, 30,927,114 reads pseudoaligned [quant] estimated average fragment length: 182.879 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,269 rounds 52973 ERR3317445.ke.tsv 35125 ERR3317445.se.tsv 88098 total ==> ERR3317445.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 754.359 0 0 PNS24247 1044 862.121 32.6975 1.88709 PNS24249 1928 1746.12 115.64 3.2952 PNS24246 1044 862.121 32.6975 1.88709 PNS24248 1044 862.121 32.6975 1.88709 PNS24244 1471 1289.12 205.267 7.92272 PNS24243 293 134.861 2 0.737891 KQK14069 1603 1421.12 1167.85 40.8887 KQK14071 474 297.594 3.05282 0.510416 ==> ERR3317445.se.tsv <== BRADI_1g14170v3 1257 BRADI_1g53295v3 35 BRADI_1g59795v3 232 BRADI_1g07683v3 0 BRADI_1g00485v3 100 BRADI_1g20270v3 2378 BRADI_1g74790v3 896 BRADI_1g09890v3 11 BRADI_1g77505v3 416 BRADI_1g48960v3 0 ERR3317445 completed mapping pipeline successfully