Starting /dee2/code/volunteer_pipeline.sh ERR3317446 current disk space = 1525115252736 free memory = 1529407600 ERR3317446 SRAfilesize ed3a2e9902b12039d01f3ff543abd44a ERR3317446.sra ERR3317446.sra file validated ERR3317446 is paired end ERR3317446 is conventional basespace ERR3317446 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317446_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5055 34.0 31.0 34.0 31.0 34.0 2 32.30325 34.0 31.0 34.0 31.0 34.0 3 32.92025 34.0 33.0 34.0 31.0 34.0 4 36.45225 37.0 37.0 37.0 35.0 37.0 5 36.44825 37.0 37.0 37.0 35.0 37.0 6 36.49925 37.0 37.0 37.0 35.0 37.0 7 36.4985 37.0 37.0 37.0 35.0 37.0 8 36.47375 37.0 37.0 37.0 35.0 37.0 9 38.2715 39.0 39.0 39.0 37.0 39.0 10-11 38.25425 39.0 39.0 39.0 37.0 39.0 12-13 38.184 39.0 39.0 39.0 37.0 39.0 14-15 39.822874999999996 41.0 40.0 41.0 38.0 41.0 16-17 39.837625 41.0 40.0 41.0 38.0 41.0 18-19 39.781 41.0 40.0 41.0 38.0 41.0 20-21 39.75125 41.0 40.0 41.0 37.5 41.0 22-23 39.63875 41.0 40.0 41.0 37.0 41.0 24-25 39.571625 41.0 40.0 41.0 37.0 41.0 26-27 39.40325 41.0 39.5 41.0 36.5 41.0 28-29 39.250375000000005 41.0 39.0 41.0 36.0 41.0 30-31 39.050125 40.5 39.0 41.0 35.0 41.0 32-33 38.750375 40.0 38.5 41.0 34.5 41.0 34-35 38.642 40.0 38.0 41.0 35.0 41.0 36-37 38.394 40.0 38.0 41.0 34.0 41.0 38-39 38.161375 40.0 38.0 41.0 33.5 41.0 40-41 37.953625 40.0 38.0 41.0 33.0 41.0 42-43 37.930375 40.0 38.0 41.0 33.0 41.0 44-45 37.7685 40.0 37.0 41.0 33.0 41.0 46-47 37.541 40.0 37.0 41.0 33.0 41.0 48-49 37.176 40.0 36.0 41.0 32.0 41.0 50-51 37.485125 40.0 36.0 41.0 33.0 41.0 52-53 37.372125 40.0 35.5 41.0 33.0 41.0 54-55 37.095625 39.0 35.0 41.0 32.5 41.0 56-57 36.746375 39.0 35.0 41.0 32.0 41.0 58-59 36.414625 38.5 35.0 41.0 31.5 41.0 60-61 35.963125000000005 37.5 35.0 40.5 31.0 41.0 62-63 35.632000000000005 37.0 35.0 40.0 30.5 41.0 64-65 35.3095 36.0 35.0 39.5 30.0 41.0 66-67 35.016625000000005 36.0 35.0 39.0 30.0 41.0 68-69 34.553 35.0 34.0 39.0 29.0 41.0 70-71 34.166 35.0 34.0 37.5 29.0 40.0 72-73 33.74025 35.0 34.0 37.0 29.0 39.0 74-75 33.411625 35.0 34.0 36.5 29.0 39.0 76-77 32.170375 34.5 32.0 35.5 26.0 37.0 78-79 32.669 35.0 33.0 35.5 27.0 37.0 80-81 32.491 35.0 33.0 35.0 27.0 37.0 82-83 32.211625 35.0 33.0 35.0 26.5 36.5 84-85 31.98825 35.0 33.0 35.0 25.5 36.0 86-87 31.814625 35.0 33.0 35.0 25.0 36.0 88-89 31.56575 35.0 33.0 35.0 25.0 35.0 90-91 31.289125 35.0 33.0 35.0 24.0 35.0 92-93 31.09875 35.0 33.0 35.0 23.0 35.0 94-95 30.886249999999997 35.0 32.0 35.0 21.5 35.0 96-97 30.486874999999998 35.0 32.0 35.0 17.0 35.0 98-99 30.148875 35.0 32.0 35.0 4.5 35.0 100-101 27.960375 33.0 28.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 3.0 10 8.0 11 4.0 12 8.0 13 8.0 14 7.0 15 7.0 16 8.0 17 12.0 18 8.0 19 10.0 20 12.0 21 15.0 22 12.0 23 17.0 24 18.0 25 22.0 26 26.0 27 32.0 28 43.0 29 42.0 30 81.0 31 67.0 32 90.0 33 138.0 34 195.0 35 323.0 36 576.0 37 1054.0 38 1008.0 39 143.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.826862539349424 25.36726128016789 18.38929695697796 26.416579223504723 2 27.400000000000002 24.05 17.875 30.675 3 26.775 26.375 18.099999999999998 28.749999999999996 4 26.3 25.35 15.9 32.45 5 28.975 25.724999999999998 14.325 30.975 6 31.2 27.675 17.775 23.35 7 33.525 23.25 20.3 22.925 8 34.925 24.349999999999998 22.2 18.525 9 33.675 25.55 24.7 16.075 10-11 33.95 26.337500000000002 22.3375 17.375 12-13 30.5 26.35 24.0 19.15 14-15 28.1 26.7625 24.5375 20.599999999999998 16-17 27.2625 25.637500000000003 25.2625 21.837500000000002 18-19 26.1 26.8125 25.775 21.3125 20-21 26.224999999999998 26.3 26.05 21.425 22-23 26.7625 26.237500000000004 24.5375 22.4625 24-25 25.412499999999998 27.3 25.7125 21.575 26-27 25.724999999999998 27.05 24.712500000000002 22.5125 28-29 26.8375 25.7125 24.6125 22.8375 30-31 25.874999999999996 26.200000000000003 25.2125 22.7125 32-33 25.687500000000004 26.674999999999997 24.825 22.8125 34-35 26.075 26.400000000000002 23.75 23.775 36-37 26.474999999999998 25.874999999999996 25.2375 22.412499999999998 38-39 26.737499999999997 26.625 25.35 21.2875 40-41 26.1625 26.437500000000004 24.4 23.0 42-43 26.474999999999998 25.7625 25.7875 21.975 44-45 25.887500000000003 25.95 25.275 22.8875 46-47 27.375 26.1125 23.474999999999998 23.0375 48-49 26.2125 25.9625 24.95 22.875 50-51 25.837500000000002 25.887500000000003 25.525 22.75 52-53 26.2625 26.8375 23.7 23.200000000000003 54-55 25.9625 26.0125 25.9875 22.037499999999998 56-57 24.85 27.075 24.3625 23.7125 58-59 26.775 26.450000000000003 23.8625 22.912499999999998 60-61 25.8 26.737499999999997 24.8625 22.6 62-63 25.275 26.325 25.05 23.35 64-65 26.150000000000002 27.35 24.0375 22.4625 66-67 25.937500000000004 25.575 25.337500000000002 23.150000000000002 68-69 25.937500000000004 26.787499999999998 24.075 23.200000000000003 70-71 27.125 26.637499999999996 23.075000000000003 23.1625 72-73 25.924999999999997 26.900000000000002 25.1 22.075 74-75 25.8 26.8375 24.275 23.0875 76-77 26.2625 26.737499999999997 23.6875 23.3125 78-79 26.1625 27.150000000000002 24.1875 22.5 80-81 26.075 26.737499999999997 24.5625 22.625 82-83 26.5375 26.525 23.7625 23.175 84-85 26.1125 26.9125 23.65 23.325000000000003 86-87 26.3125 26.6 24.2375 22.85 88-89 26.025 27.800000000000004 23.225 22.95 90-91 25.75 27.575 23.65 23.025000000000002 92-93 26.05 26.724999999999998 24.025 23.200000000000003 94-95 25.9625 26.55 24.2 23.2875 96-97 25.95 26.5125 24.4125 23.125 98-99 26.35 26.1 23.9125 23.6375 100-101 26.8625 26.5125 22.4625 24.1625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.5 8 3.0 9 3.5 10 1.5 11 0.5 12 0.0 13 0.5 14 1.0 15 2.0 16 2.0 17 0.5 18 1.5 19 1.5 20 0.0 21 0.5 22 1.5 23 3.5 24 3.0 25 2.0 26 1.5 27 1.5 28 4.0 29 6.0 30 8.0 31 12.0 32 11.5 33 15.5 34 25.5 35 26.0 36 43.5 37 60.0 38 61.0 39 95.0 40 126.5 41 139.5 42 157.0 43 164.0 44 178.0 45 195.5 46 199.5 47 205.0 48 190.5 49 177.5 50 181.0 51 174.5 52 155.5 53 139.5 54 133.0 55 112.5 56 96.0 57 86.5 58 72.5 59 72.0 60 76.0 61 66.0 62 57.5 63 45.5 64 33.5 65 32.5 66 29.5 67 26.5 68 33.5 69 43.0 70 33.0 71 25.5 72 24.0 73 18.5 74 16.5 75 11.5 76 12.0 77 12.0 78 12.0 79 9.0 80 3.0 81 3.0 82 4.5 83 3.0 84 1.5 85 2.0 86 1.5 87 1.5 88 1.5 89 0.5 90 0.5 91 0.5 92 1.0 93 1.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.7 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.95 #Duplication Level Percentage of deduplicated Percentage of total 1 98.59622256253189 96.575 2 0.9954058192955589 1.95 3 0.20418580908626852 0.6 4 0.1531393568147014 0.6 5 0.025523226135783564 0.125 6 0.025523226135783564 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAACATCTTAGTAGCCAGAGGAAAAGAAAGCAAAAGCGATTCCCGTAGT 6 0.15 No Hit ACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.0875 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.1375 0.0 0.0 0.0 0.0 24-25 0.15 0.0 0.0 0.0 0.0 26-27 0.16249999999999998 0.0 0.0 0.0 0.0 28-29 0.2 0.0 0.0 0.0 0.0 30-31 0.2375 0.0 0.0 0.0 0.0 32-33 0.275 0.0 0.0 0.0 0.0 34-35 0.32499999999999996 0.0 0.0 0.0 0.0 36-37 0.3875 0.0 0.0 0.0 0.0 38-39 0.48750000000000004 0.0 0.0 0.0 0.0 40-41 0.6125 0.0 0.0 0.0 0.0 42-43 0.7124999999999999 0.0 0.0 0.0 0.0 44-45 0.775 0.0 0.0 0.0 0.0 46-47 0.7875000000000001 0.0 0.0 0.0 0.0 48-49 0.8 0.0 0.0 0.0 0.0 50-51 0.9 0.0 0.0 0.0 0.0 52-53 1.0125 0.0 0.0 0.0 0.0 54-55 1.125 0.0 0.0 0.0 0.0 56-57 1.275 0.0 0.0 0.0 0.0 58-59 1.4375 0.0 0.0 0.0 0.0 60-61 1.6 0.0 0.0 0.0 0.0 62-63 1.8875000000000002 0.0 0.0 0.0 0.0 64-65 2.2625 0.0 0.0 0.0 0.0 66-67 2.5 0.0 0.0 0.0 0.0 68-69 2.7625 0.0 0.0 0.0 0.0 70-71 3.0625 0.0 0.0 0.0 0.0 72-73 3.3875 0.0 0.0 0.0 0.0 74-75 3.8 0.0 0.0 0.0 0.0 76-77 4.125 0.0 0.0 0.0 0.0 78-79 4.675 0.0 0.0 0.0 0.0 80-81 5.0375 0.0 0.0 0.0 0.0 82-83 5.6125 0.0 0.0 0.0 0.0 84-85 6.0375 0.0 0.0 0.0 0.0 86-87 6.8 0.0 0.0 0.0 0.0 88-89 7.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317446 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317446_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.298 34.0 31.0 34.0 31.0 34.0 2 31.926 34.0 31.0 34.0 30.0 34.0 3 32.4145 34.0 31.0 34.0 31.0 34.0 4 35.5765 37.0 35.0 37.0 35.0 37.0 5 35.8325 37.0 37.0 37.0 35.0 37.0 6 35.867 37.0 37.0 37.0 35.0 37.0 7 35.89025 37.0 37.0 37.0 35.0 37.0 8 35.887 37.0 37.0 37.0 35.0 37.0 9 37.72175 39.0 39.0 39.0 37.0 39.0 10-11 37.701875 39.0 39.0 39.0 36.0 39.0 12-13 37.684 39.0 39.0 39.0 37.0 39.0 14-15 39.2885 41.0 40.0 41.0 37.0 41.0 16-17 39.214875 41.0 40.0 41.0 37.0 41.0 18-19 39.138125 41.0 40.0 41.0 36.0 41.0 20-21 39.046875 41.0 40.0 41.0 36.0 41.0 22-23 39.000625 41.0 40.0 41.0 36.0 41.0 24-25 38.878625 41.0 40.0 41.0 35.5 41.0 26-27 38.852875 41.0 39.0 41.0 35.0 41.0 28-29 38.82575 41.0 39.5 41.0 35.0 41.0 30-31 38.582375 41.0 39.0 41.0 35.0 41.0 32-33 38.54075 41.0 39.0 41.0 35.0 41.0 34-35 38.43075 41.0 39.0 41.0 35.0 41.0 36-37 38.23225 40.0 38.0 41.0 34.5 41.0 38-39 38.195625 40.0 38.0 41.0 34.0 41.0 40-41 38.342375 41.0 38.0 41.0 35.0 41.0 42-43 38.2365 41.0 38.0 41.0 34.5 41.0 44-45 38.0035 40.5 38.0 41.0 34.0 41.0 46-47 37.88675 40.0 38.0 41.0 33.0 41.0 48-49 37.78125 40.0 37.5 41.0 33.0 41.0 50-51 37.000625 39.5 36.0 40.5 32.0 41.0 52-53 36.916624999999996 39.5 36.0 40.5 32.0 41.0 54-55 37.1485 40.0 36.0 41.0 33.0 41.0 56-57 36.914249999999996 39.5 35.5 41.0 32.0 41.0 58-59 36.6295 39.0 35.0 41.0 31.0 41.0 60-61 36.352625 39.0 35.0 41.0 31.5 41.0 62-63 35.996625 38.0 35.0 41.0 31.0 41.0 64-65 35.680875 37.0 35.0 40.0 31.0 41.0 66-67 35.727875 37.0 35.0 40.0 32.0 41.0 68-69 35.426500000000004 36.5 35.0 39.5 31.5 41.0 70-71 35.139875 36.0 35.0 39.0 31.5 41.0 72-73 34.730875 35.5 35.0 38.5 31.0 41.0 74-75 34.3925 35.0 35.0 37.0 31.0 39.5 76-77 34.030249999999995 35.0 35.0 37.0 30.5 39.0 78-79 33.698750000000004 35.0 34.5 36.5 30.5 38.5 80-81 33.352374999999995 35.0 34.0 36.0 29.5 37.0 82-83 33.15075 35.0 34.0 36.0 29.0 37.0 84-85 32.836124999999996 35.0 34.0 35.0 29.0 36.5 86-87 32.721875 35.0 34.0 35.0 29.0 36.0 88-89 32.49625 35.0 34.0 35.0 28.5 36.0 90-91 32.29025 35.0 34.0 35.0 28.5 36.0 92-93 32.125 35.0 33.5 35.0 27.0 35.0 94-95 32.014125 35.0 34.0 35.0 27.0 35.0 96-97 31.847375 35.0 33.0 35.0 27.0 35.0 98-99 31.6615 35.0 33.0 35.0 26.0 35.0 100-101 29.803874999999998 33.5 30.0 34.5 13.5 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 44.0 3 4.0 4 2.0 5 3.0 6 5.0 7 4.0 8 2.0 9 7.0 10 3.0 11 6.0 12 6.0 13 3.0 14 9.0 15 7.0 16 6.0 17 5.0 18 5.0 19 8.0 20 5.0 21 10.0 22 4.0 23 15.0 24 12.0 25 15.0 26 18.0 27 14.0 28 27.0 29 31.0 30 28.0 31 50.0 32 73.0 33 109.0 34 145.0 35 234.0 36 445.0 37 1004.0 38 1358.0 39 274.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.65 11.15 29.75 29.45 2 26.325 10.9 25.374999999999996 37.4 3 22.5 12.7 29.125 35.675000000000004 4 23.35 12.425 25.974999999999998 38.25 5 25.95 14.499999999999998 23.35 36.199999999999996 6 24.474999999999998 17.599999999999998 29.15 28.775000000000002 7 18.925 24.55 38.775 17.75 8 18.425 24.95 35.625 21.0 9 18.375 27.05 34.949999999999996 19.625 10-11 19.4625 27.650000000000002 31.15 21.7375 12-13 19.675 27.787499999999998 30.725 21.8125 14-15 20.1 26.525 29.9625 23.4125 16-17 21.3 25.887500000000003 27.950000000000003 24.8625 18-19 19.9625 26.275 29.612500000000004 24.15 20-21 21.8 25.25 28.1875 24.762500000000003 22-23 21.9 24.9125 27.875 25.3125 24-25 20.575 25.8625 28.999999999999996 24.5625 26-27 21.6 25.85 27.0 25.55 28-29 21.7 24.9125 26.3 27.0875 30-31 20.5625 25.8 28.8375 24.8 32-33 22.662499999999998 25.4625 26.700000000000003 25.174999999999997 34-35 22.0 24.975 26.700000000000003 26.325 36-37 21.75 25.25 27.6625 25.337500000000002 38-39 22.400000000000002 26.3125 26.2875 25.0 40-41 22.45 26.2125 25.924999999999997 25.412499999999998 42-43 21.8875 27.025 26.5125 24.575 44-45 21.9625 25.95 25.55 26.5375 46-47 22.0875 25.4875 26.3 26.125 48-49 21.912499999999998 25.85 27.3625 24.875 50-51 23.1 25.687500000000004 26.174999999999997 25.0375 52-53 22.537499999999998 25.525 26.150000000000002 25.7875 54-55 21.175 25.912499999999998 27.8875 25.025 56-57 21.85 25.7875 27.250000000000004 25.112499999999997 58-59 22.775000000000002 24.4875 27.0 25.7375 60-61 21.3625 24.875 27.950000000000003 25.8125 62-63 22.775000000000002 25.5625 26.575 25.087500000000002 64-65 22.8 25.2 26.337500000000002 25.662499999999998 66-67 21.7375 27.287499999999998 26.150000000000002 24.825 68-69 23.6625 25.525 26.3125 24.5 70-71 22.35 25.95 25.575 26.125 72-73 22.575 25.412499999999998 26.174999999999997 25.837500000000002 74-75 23.1125 25.4 25.7875 25.7 76-77 22.75 26.1125 26.087500000000002 25.05 78-79 23.3125 26.150000000000002 25.775 24.762500000000003 80-81 21.6125 26.887499999999996 26.375 25.124999999999996 82-83 23.2875 24.4375 25.55 26.724999999999998 84-85 24.0625 26.937499999999996 25.5375 23.4625 86-87 24.975 26.387500000000003 24.962500000000002 23.674999999999997 88-89 23.25 25.0125 25.4875 26.25 90-91 24.0375 26.200000000000003 25.674999999999997 24.087500000000002 92-93 23.400000000000002 25.687500000000004 26.224999999999998 24.6875 94-95 24.099999999999998 25.474999999999998 24.837500000000002 25.587500000000002 96-97 24.462500000000002 25.937500000000004 25.85 23.75 98-99 24.3 25.937500000000004 25.687500000000004 24.075 100-101 24.875 25.337500000000002 25.112499999999997 24.675 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 15.0 1 11.0 2 4.5 3 2.5 4 2.0 5 1.5 6 2.0 7 3.5 8 3.5 9 1.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.5 17 2.0 18 1.5 19 1.5 20 1.5 21 1.0 22 1.5 23 3.0 24 5.5 25 4.5 26 3.5 27 4.0 28 6.5 29 8.5 30 9.0 31 17.0 32 20.0 33 24.0 34 37.5 35 47.0 36 57.0 37 72.5 38 88.5 39 115.0 40 139.5 41 159.0 42 178.0 43 181.0 44 190.5 45 195.5 46 196.0 47 197.5 48 187.0 49 173.5 50 155.5 51 147.5 52 149.5 53 140.0 54 119.5 55 102.5 56 94.5 57 81.0 58 63.5 59 59.5 60 62.5 61 57.5 62 44.0 63 38.0 64 35.5 65 32.0 66 31.0 67 31.5 68 26.5 69 23.0 70 28.5 71 26.0 72 16.0 73 10.5 74 9.5 75 9.5 76 9.0 77 5.5 78 4.0 79 5.0 80 3.0 81 1.5 82 1.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03357070193286 97.35000000000001 2 0.8392675483214649 1.6500000000000001 3 0.025432349949135298 0.075 4 0.025432349949135298 0.1 5 0.0 0.0 6 0.025432349949135298 0.15 7 0.025432349949135298 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025432349949135298 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 20 0.5 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 7 0.17500000000000002 No Hit TGGGGGTGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.0875 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1125 0.0 0.0 0.0 0.0 28-29 0.15 0.0 0.0 0.0 0.0 30-31 0.1875 0.0 0.0 0.0 0.0 32-33 0.225 0.0 0.0 0.0 0.0 34-35 0.2625 0.0 0.0 0.0 0.0 36-37 0.3125 0.0 0.0 0.0 0.0 38-39 0.4125 0.0 0.0 0.0 0.0 40-41 0.5375 0.0 0.0 0.0 0.0 42-43 0.6375 0.0 0.0 0.0 0.0 44-45 0.7 0.0 0.0 0.0 0.0 46-47 0.7124999999999999 0.0 0.0 0.0 0.0 48-49 0.725 0.0 0.0 0.0 0.0 50-51 0.825 0.0 0.0 0.0 0.0 52-53 0.9375 0.0 0.0 0.0 0.0 54-55 1.0499999999999998 0.0 0.0 0.0 0.0 56-57 1.2 0.0 0.0 0.0 0.0 58-59 1.3625 0.0 0.0 0.0 0.0 60-61 1.5125 0.0 0.0 0.0 0.0 62-63 1.7625000000000002 0.0 0.0 0.0 0.0 64-65 2.1375 0.0 0.0 0.0 0.0 66-67 2.375 0.0 0.0 0.0 0.0 68-69 2.6375 0.0 0.0 0.0 0.0 70-71 2.9375 0.0 0.0 0.0 0.0 72-73 3.2625 0.0 0.0 0.0 0.0 74-75 3.6375 0.0 0.0 0.0 0.0 76-77 3.95 0.0 0.0 0.0 0.0 78-79 4.525 0.0 0.0 0.0 0.0 80-81 4.8625 0.0 0.0 0.0 0.0 82-83 5.425 0.0 0.0 0.0 0.0 84-85 5.9 0.0 0.0 0.0 0.0 86-87 6.675 0.0 0.0 0.0 0.0 88-89 7.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1849905 spots for ERR3317446.sra Written 1849905 spots for ERR3317446.sra Read 1849905 spots for ERR3317446.sra Written 1849905 spots for ERR3317446.sra Read 1849905 spots for ERR3317446.sra Written 1849905 spots for ERR3317446.sra Read 1849915 spots for ERR3317446.sra Written 1849915 spots for ERR3317446.sra Read 1849905 spots for ERR3317446.sra Written 1849905 spots for ERR3317446.sra Read 1849905 spots for ERR3317446.sra Written 1849905 spots for ERR3317446.sra Read 1849905 spots for ERR3317446.sra Written 1849905 spots for ERR3317446.sra Read 1849905 spots for ERR3317446.sra Written 1849905 spots for ERR3317446.sra Read 1849905 spots for ERR3317446.sra Written 1849905 spots for ERR3317446.sra Read 1849905 spots for ERR3317446.sra Written 1849905 spots for ERR3317446.sra Read 1849905 spots for ERR3317446.sra Written 1849905 spots for ERR3317446.sra Read 1849905 spots for ERR3317446.sra Written 1849905 spots for ERR3317446.sra Read 1849905 spots for ERR3317446.sra Written 1849905 spots for ERR3317446.sra Read 1849905 spots for ERR3317446.sra Written 1849905 spots for ERR3317446.sra Read 1849905 spots for ERR3317446.sra Written 1849905 spots for ERR3317446.sra Read 1849905 spots for ERR3317446.sra Written 1849905 spots for ERR3317446.sra Read 1849905 spots for ERR3317446.sra Written 1849905 spots for ERR3317446.sra Read 1849905 spots for ERR3317446.sra Written 1849905 spots for ERR3317446.sra Read 1849905 spots for ERR3317446.sra Written 1849905 spots for ERR3317446.sra Read 1849905 spots for ERR3317446.sra Written 1849905 spots for ERR3317446.sra SRR ids: ['ERR3317446.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_db7e3ti2 ERR3317446.sra spots: 36998110 blocks: [[1, 1849905], [1849906, 3699810], [3699811, 5549715], [5549716, 7399620], [7399621, 9249525], [9249526, 11099430], [11099431, 12949335], [12949336, 14799240], [14799241, 16649145], [16649146, 18499050], [18499051, 20348955], [20348956, 22198860], [22198861, 24048765], [24048766, 25898670], [25898671, 27748575], [27748576, 29598480], [29598481, 31448385], [31448386, 33298290], [33298291, 35148195], [35148196, 36998110]] ERR3317446 file size 8902648 ERR3317446 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317446 ERR3317446_1.fastq ERR3317446_2.fastq Input file: ERR3317446_1.fastq Paired file: ERR3317446_2.fastq trimmed: ERR3317446-trimmed-pair1.fastq, ERR3317446-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:34:58 2024 >> started Tue Dec 10 09:35:36 2024 >> done (38.050s) 36998110 read pairs processed; of these: 203049 ( 0.55%) short read pairs filtered out after trimming by size control 528819 ( 1.43%) empty read pairs filtered out after trimming by size control 36266242 (98.02%) read pairs available; of these: 10663243 (29.40%) trimmed read pairs available after processing 25602999 (70.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 646 0.00% 19 690 0.00% 20 893 0.00% 21 1080 0.00% 22 1482 0.00% 23 2015 0.01% 24 2431 0.01% 25 2910 0.01% 26 3304 0.01% 27 3848 0.01% 28 4362 0.01% 29 5007 0.01% 30 5861 0.02% 31 7435 0.02% 32 7078 0.02% 33 7848 0.02% 34 9670 0.03% 35 9953 0.03% 36 11213 0.03% 37 11839 0.03% 38 13323 0.04% 39 14394 0.04% 40 15217 0.04% 41 16893 0.05% 42 17950 0.05% 43 18954 0.05% 44 20904 0.06% 45 21427 0.06% 46 23156 0.06% 47 26005 0.07% 48 26771 0.07% 49 28360 0.08% 50 32689 0.09% 51 32326 0.09% 52 33892 0.09% 53 36888 0.10% 54 41832 0.12% 55 47534 0.13% 56 46280 0.13% 57 48460 0.13% 58 51269 0.14% 59 64605 0.18% 60 77876 0.21% 61 80185 0.22% 62 87629 0.24% 63 92131 0.25% 64 99630 0.27% 65 104143 0.29% 66 115470 0.32% 67 113556 0.31% 68 115969 0.32% 69 118185 0.33% 70 130034 0.36% 71 139024 0.38% 72 149557 0.41% 73 146077 0.40% 74 143743 0.40% 75 145950 0.40% 76 147701 0.41% 77 154310 0.43% 78 163325 0.45% 79 163811 0.45% 80 169534 0.47% 81 174148 0.48% 82 174610 0.48% 83 182405 0.50% 84 190693 0.53% 85 202220 0.56% 86 208528 0.57% 87 214540 0.59% 88 215250 0.59% 89 240274 0.66% 90 231422 0.64% 91 243479 0.67% 92 257750 0.71% 93 274795 0.76% 94 300964 0.83% 95 317232 0.87% 96 347503 0.96% 97 407281 1.12% 98 523128 1.44% 99 685602 1.89% 100 1834885 5.06% 101 25602999 70.60% 36266242 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=3.09 fanout-score-rank=12 prefix-density=0.76 prefix-fanout=2.8 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=55.31 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=11.5 sequence=GAGGAGAAGAAACTTACAAGGATTCCCCTAGTAACGGCGAGCGAACCGGGAGCAGCCCAGCTTGAGAATCGGGCGGCCGTGCCGTCCGAATTGTAGTCTGGAGAGGCGTCCTCAGCGACGGACCGGGCCCAAGTCCCCTGGAAAGGGGCGCCTGGGAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGGCTAAAT criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=22 prefix-density=0.41 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=101.10 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=2.2 sequence=TTATAAGAAAGAAAGTGATTTTCTCAACTCTTTCAAACTTTTAGGAATTCACATATGCAAGCTAGCTCCTCGATCGAGAGCCAGGTTGCTACACACAACAACAATCTTGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTGAGCTGACACTTTATATATGGTCCATCTTAATACGGAGCTGTCCTTGGTTGTTTATGCCTTGCCGGATTCCTCGCAGCCCGGTGGCTT ERR3317446 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:36:15 Started mapping on | Dec 10 09:36:15 Finished on | Dec 10 09:38:11 Mapping speed, Million of reads per hour | 1125.50 Number of input reads | 36266242 Average input read length | 192 UNIQUE READS: Uniquely mapped reads number | 31840203 Uniquely mapped reads % | 87.80% Average mapped length | 191.65 Number of splices: Total | 20274877 Number of splices: Annotated (sjdb) | 19344991 Number of splices: GT/AG | 19979998 Number of splices: GC/AG | 262887 Number of splices: AT/AC | 16739 Number of splices: Non-canonical | 15253 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.00% Deletion average length | 1.21 Insertion rate per base | 0.00% Insertion average length | 1.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2467104 % of reads mapped to multiple loci | 6.80% Number of reads mapped to too many loci | 196590 % of reads mapped to too many loci | 0.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.75% % of reads unmapped: other | 3.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2082955 2082955 2082955 N_multimapping 2467104 2467104 2467104 N_noFeature 1277767 2616274 29855558 N_ambiguous 869117 250208 14088 UnstrandedReadsAssigned:29693319 PositiveStrandReadsAssigned:28973721 NegativeStrandReadsAssigned:1970557 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=99 echo kmer=95 ERR3317446 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317446-trimmed-pair1.fastq ERR3317446-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,266,242 reads, 30,561,808 reads pseudoaligned [quant] estimated average fragment length: 183.292 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,301 rounds 52973 ERR3317446.ke.tsv 35125 ERR3317446.se.tsv 88098 total ==> ERR3317446.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 753.864 0 0 PNS24247 1044 861.708 39.7527 2.30886 PNS24249 1928 1745.71 114.557 3.28427 PNS24246 1044 861.708 39.7527 2.30886 PNS24248 1044 861.708 39.7527 2.30886 PNS24244 1471 1288.71 229.185 8.90066 PNS24243 293 134.248 1 0.372806 KQK14069 1603 1420.71 472.569 16.6476 KQK14071 474 297.045 0 0 ==> ERR3317446.se.tsv <== BRADI_1g14170v3 500 BRADI_1g53295v3 57 BRADI_1g59795v3 294 BRADI_1g07683v3 0 BRADI_1g00485v3 63 BRADI_1g20270v3 2358 BRADI_1g74790v3 467 BRADI_1g09890v3 17 BRADI_1g77505v3 552 BRADI_1g48960v3 0 ERR3317446 completed mapping pipeline successfully