Starting /dee2/code/volunteer_pipeline.sh ERR3317447 current disk space = 1525115252736 free memory = 1529594176 ERR3317447 SRAfilesize 9b8f11fcf6a932b5db0ea118b59aa31a ERR3317447.sra ERR3317447.sra file validated ERR3317447 is paired end ERR3317447 is conventional basespace ERR3317447 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317447_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.60375 34.0 31.0 34.0 31.0 34.0 2 32.30475 34.0 31.0 34.0 30.0 34.0 3 32.77525 34.0 31.0 34.0 31.0 34.0 4 36.26875 37.0 37.0 37.0 35.0 37.0 5 36.3265 37.0 37.0 37.0 35.0 37.0 6 36.408 37.0 37.0 37.0 35.0 37.0 7 36.42025 37.0 37.0 37.0 35.0 37.0 8 36.3535 37.0 37.0 37.0 35.0 37.0 9 38.12275 39.0 39.0 39.0 37.0 39.0 10-11 38.08675 39.0 39.0 39.0 35.0 39.0 12-13 38.11625 39.0 39.0 39.0 37.0 39.0 14-15 39.657250000000005 41.0 40.0 41.0 37.0 41.0 16-17 39.631875 41.0 40.0 41.0 37.0 41.0 18-19 39.597875 41.0 40.0 41.0 37.0 41.0 20-21 39.40025 41.0 39.5 41.0 36.5 41.0 22-23 39.333749999999995 41.0 39.0 41.0 36.0 41.0 24-25 39.2955 41.0 39.0 41.0 36.0 41.0 26-27 39.139624999999995 41.0 39.0 41.0 36.0 41.0 28-29 38.787625 40.0 38.5 41.0 35.0 41.0 30-31 38.68537499999999 40.0 38.0 41.0 35.0 41.0 32-33 38.621375 40.0 38.0 41.0 34.5 41.0 34-35 38.388999999999996 40.0 38.0 41.0 34.0 41.0 36-37 38.248875 40.0 38.0 41.0 34.0 41.0 38-39 38.080875 40.0 38.0 41.0 33.0 41.0 40-41 37.91 40.0 38.0 41.0 33.0 41.0 42-43 37.934 40.0 38.0 41.0 33.0 41.0 44-45 37.611999999999995 40.0 37.0 41.0 32.5 41.0 46-47 37.459 40.0 37.0 41.0 32.5 41.0 48-49 37.232 40.0 36.0 41.0 31.5 41.0 50-51 37.45 40.0 36.0 41.0 33.0 41.0 52-53 37.423249999999996 40.0 36.0 41.0 33.0 41.0 54-55 37.158874999999995 39.5 35.0 41.0 32.0 41.0 56-57 36.73225 39.0 35.0 41.0 31.5 41.0 58-59 36.418875 39.0 35.0 41.0 31.0 41.0 60-61 36.030875 38.0 35.0 40.5 31.0 41.0 62-63 35.67175 37.0 35.0 40.0 30.0 41.0 64-65 35.27475 37.0 35.0 39.5 29.5 41.0 66-67 34.887 36.0 34.0 39.0 29.5 41.0 68-69 34.519 35.5 34.0 39.0 29.0 41.0 70-71 34.06675 35.0 34.0 37.5 28.5 40.0 72-73 33.632000000000005 35.0 34.0 37.0 27.5 39.0 74-75 33.236375 35.0 33.5 37.0 27.0 39.0 76-77 32.10625 34.5 31.5 35.5 25.5 37.5 78-79 32.466750000000005 35.0 33.0 36.0 26.0 37.0 80-81 32.263374999999996 35.0 33.0 35.0 26.0 37.0 82-83 32.025125 35.0 33.0 35.0 26.0 36.5 84-85 31.7805 35.0 33.0 35.0 25.0 36.0 86-87 31.416125 35.0 32.5 35.0 24.0 36.0 88-89 31.2695 35.0 32.0 35.0 24.0 35.5 90-91 30.9815 35.0 32.0 35.0 21.5 35.0 92-93 30.61975 35.0 31.5 35.0 19.5 35.0 94-95 30.451875 35.0 32.0 35.0 18.5 35.0 96-97 30.110125 34.5 31.0 35.0 6.0 35.0 98-99 29.733375 34.0 31.0 35.0 2.0 35.0 100-101 27.470875 32.5 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 2.0 8 2.0 9 6.0 10 9.0 11 6.0 12 4.0 13 7.0 14 14.0 15 3.0 16 12.0 17 5.0 18 9.0 19 10.0 20 15.0 21 16.0 22 19.0 23 22.0 24 23.0 25 26.0 26 33.0 27 37.0 28 47.0 29 47.0 30 65.0 31 85.0 32 96.0 33 152.0 34 186.0 35 337.0 36 513.0 37 1024.0 38 1042.0 39 125.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 25.773732119635888 27.334200260078024 20.44213263979194 26.44993498049415 2 25.624999999999996 26.724999999999998 18.775 28.875 3 25.0 28.000000000000004 18.95 28.050000000000004 4 25.4 26.5 18.3 29.799999999999997 5 28.499999999999996 24.825 17.2 29.475 6 28.249999999999996 27.825 19.425 24.5 7 28.425 22.825 23.150000000000002 25.6 8 30.2 26.150000000000002 26.150000000000002 17.5 9 30.175 27.725 25.8 16.3 10-11 31.5375 26.937499999999996 22.537499999999998 18.987499999999997 12-13 29.15 26.7125 25.337500000000002 18.8 14-15 27.5125 26.5625 24.85 21.075 16-17 26.8625 26.237500000000004 25.424999999999997 21.475 18-19 26.05 27.037499999999998 25.2625 21.65 20-21 25.55 27.037499999999998 25.174999999999997 22.237499999999997 22-23 26.0 26.174999999999997 25.1875 22.6375 24-25 24.7875 27.1125 25.4875 22.6125 26-27 25.99074884360545 26.815851981497683 24.62807850981373 22.565320665083135 28-29 25.374999999999996 26.787499999999998 25.3125 22.525000000000002 30-31 26.0125 26.025 25.974999999999998 21.987499999999997 32-33 25.2875 27.1125 24.712500000000002 22.8875 34-35 25.7125 27.237499999999997 24.725 22.325 36-37 25.6125 26.8375 25.724999999999998 21.825 38-39 25.662499999999998 26.987499999999997 25.5125 21.837500000000002 40-41 26.237500000000004 25.9875 25.5 22.275 42-43 26.724999999999998 25.637500000000003 25.0 22.6375 44-45 26.3625 27.3125 24.4875 21.837500000000002 46-47 25.687500000000004 26.687499999999996 24.349999999999998 23.275000000000002 48-49 26.05 25.5625 25.25 23.1375 50-51 25.924999999999997 26.737499999999997 24.9 22.4375 52-53 26.424999999999997 25.7125 25.5125 22.35 54-55 25.650000000000002 26.8625 25.324999999999996 22.162499999999998 56-57 25.2125 27.3625 24.125 23.3 58-59 25.6125 26.5125 24.45 23.425 60-61 26.4625 26.724999999999998 24.9875 21.825 62-63 25.825 26.0375 24.712500000000002 23.425 64-65 25.974999999999998 26.9625 24.5 22.5625 66-67 25.275 26.7125 25.35 22.662499999999998 68-69 25.687500000000004 26.150000000000002 25.412499999999998 22.75 70-71 26.200000000000003 26.5625 24.8625 22.375 72-73 25.662499999999998 27.175 24.9 22.2625 74-75 25.8625 26.674999999999997 25.424999999999997 22.037499999999998 76-77 26.174999999999997 27.5875 24.0625 22.175 78-79 25.674999999999997 26.787499999999998 24.975 22.5625 80-81 25.887500000000003 27.537499999999998 24.45 22.125 82-83 26.650000000000002 25.724999999999998 24.6 23.025000000000002 84-85 25.837500000000002 27.025 25.637500000000003 21.5 86-87 25.0375 27.3 24.7375 22.925 88-89 26.1 26.3 24.525 23.075000000000003 90-91 25.887500000000003 27.150000000000002 25.4875 21.475 92-93 25.900000000000002 27.287499999999998 24.4875 22.325 94-95 25.5125 26.8375 23.974999999999998 23.674999999999997 96-97 26.025 27.125 24.625 22.225 98-99 25.587500000000002 27.0125 24.25 23.150000000000002 100-101 26.875 25.8125 23.6375 23.674999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 1.0 12 1.0 13 1.0 14 0.5 15 0.5 16 1.0 17 1.0 18 0.5 19 1.5 20 2.5 21 1.0 22 1.0 23 1.5 24 1.0 25 2.5 26 4.0 27 6.0 28 6.5 29 8.0 30 20.5 31 21.0 32 13.0 33 19.0 34 33.5 35 45.0 36 50.5 37 63.0 38 75.0 39 99.0 40 133.5 41 152.0 42 159.0 43 192.5 44 208.5 45 196.5 46 210.0 47 215.5 48 197.0 49 180.0 50 173.5 51 163.5 52 130.5 53 109.0 54 108.5 55 96.0 56 79.0 57 67.5 58 65.5 59 66.5 60 58.0 61 51.0 62 56.5 63 51.5 64 41.0 65 44.5 66 45.0 67 38.5 68 37.0 69 29.5 70 25.5 71 28.0 72 21.5 73 19.5 74 16.5 75 7.5 76 5.0 77 3.5 78 4.5 79 4.5 80 4.5 81 3.5 82 1.0 83 1.5 84 1.5 85 1.0 86 1.5 87 1.0 88 0.5 89 1.5 90 1.5 91 0.5 92 0.5 93 1.0 94 0.5 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.375 #Duplication Level Percentage of deduplicated Percentage of total 1 98.22849807445444 95.65 2 1.258023106546855 2.45 3 0.23106546854942236 0.675 4 0.20539152759948653 0.8 5 0.051347881899871634 0.25 6 0.0 0.0 7 0.025673940949935817 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGCAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGAT 7 0.17500000000000002 No Hit GACCGAAATCTTTGGGGATGATTCTGTATTACAATTTGGTGGAGGAACTT 5 0.125 No Hit TGCTCGTGAAGGTAATGAAATTATCCGAGCAGCTTGCAAATGGAGTCCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10-11 0.125 0.0 0.0 0.0 0.0 12-13 0.125 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.1375 0.0 0.0 0.0 0.0 18-19 0.15 0.0 0.0 0.0 0.0 20-21 0.15 0.0 0.0 0.0 0.0 22-23 0.15 0.0 0.0 0.0 0.0 24-25 0.15 0.0 0.0 0.0 0.0 26-27 0.15 0.0 0.0 0.0 0.0 28-29 0.15 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.16249999999999998 0.0 0.0 0.0 0.0 36-37 0.1875 0.0 0.0 0.0 0.0 38-39 0.21250000000000002 0.0 0.0 0.0 0.0 40-41 0.25 0.0 0.0 0.0 0.0 42-43 0.36250000000000004 0.0 0.0 0.0 0.0 44-45 0.4875 0.0 0.0 0.0 0.0 46-47 0.575 0.0 0.0 0.0 0.0 48-49 0.6375 0.0 0.0 0.0 0.0 50-51 0.6625000000000001 0.0 0.0 0.0 0.0 52-53 0.75 0.0 0.0 0.0 0.0 54-55 0.8625 0.0 0.0 0.0 0.0 56-57 0.975 0.0 0.0 0.0 0.0 58-59 1.0499999999999998 0.0 0.0 0.0 0.0 60-61 1.0875 0.0 0.0 0.0 0.0 62-63 1.2125 0.0 0.0 0.0 0.0 64-65 1.4 0.0 0.0 0.0 0.0 66-67 1.5625 0.0 0.0 0.0 0.0 68-69 1.6875 0.0 0.0 0.0 0.0 70-71 1.8625 0.0 0.0 0.0 0.0 72-73 2.0125 0.0 0.0 0.0 0.0 74-75 2.2125 0.0 0.0 0.0 0.0 76-77 2.5 0.0 0.0 0.0 0.0 78-79 2.7750000000000004 0.0 0.0 0.0 0.0 80-81 2.9875 0.0 0.0 0.0 0.0 82-83 3.3125 0.0 0.0 0.0 0.0 84-85 3.675 0.0 0.0 0.0 0.0 86-87 4.0375 0.0 0.0 0.0 0.0 88-89 4.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTAAT 15 0.00997274 47.481247 60-61 GTACAAG 15 0.00997274 47.481247 88-89 ATCGAGT 15 0.00997274 47.481247 64-65 >>END_MODULE ERR3317447 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317447_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.46775 33.0 31.0 34.0 30.0 34.0 2 31.36075 33.0 31.0 34.0 28.0 34.0 3 31.76075 34.0 31.0 34.0 28.0 34.0 4 35.34525 37.0 35.0 37.0 33.0 37.0 5 35.3985 37.0 35.0 37.0 35.0 37.0 6 35.48725 37.0 36.0 37.0 35.0 37.0 7 35.503 37.0 37.0 37.0 35.0 37.0 8 35.568 37.0 37.0 37.0 35.0 37.0 9 37.27825 39.0 38.0 39.0 35.0 39.0 10-11 37.334625 39.0 38.5 39.0 35.0 39.0 12-13 37.27075 39.0 38.0 39.0 35.0 39.0 14-15 38.803875 41.0 39.5 41.0 36.0 41.0 16-17 38.8 41.0 40.0 41.0 36.0 41.0 18-19 38.755750000000006 41.0 39.5 41.0 36.0 41.0 20-21 38.60425 41.0 39.0 41.0 35.0 41.0 22-23 38.564 41.0 39.0 41.0 35.0 41.0 24-25 38.5095 41.0 39.0 41.0 35.0 41.0 26-27 38.43625 41.0 39.0 41.0 35.0 41.0 28-29 38.2895 41.0 39.0 41.0 35.0 41.0 30-31 38.017624999999995 40.0 38.0 41.0 33.5 41.0 32-33 38.092875 40.0 38.0 41.0 34.0 41.0 34-35 37.953500000000005 40.0 38.0 41.0 34.0 41.0 36-37 37.879125 40.0 38.0 41.0 34.0 41.0 38-39 37.72925 40.0 38.0 41.0 33.0 41.0 40-41 37.85675 40.0 38.0 41.0 33.0 41.0 42-43 37.794875 40.0 38.0 41.0 33.5 41.0 44-45 37.625625 40.0 38.0 41.0 33.0 41.0 46-47 37.469625 40.0 37.5 41.0 33.0 41.0 48-49 37.212 40.0 37.0 41.0 32.5 41.0 50-51 36.59975 39.5 36.0 40.5 31.0 41.0 52-53 36.530125 39.5 35.5 40.5 31.0 41.0 54-55 36.607124999999996 39.5 35.5 41.0 31.0 41.0 56-57 36.475375 39.0 35.0 41.0 31.0 41.0 58-59 36.343625 39.0 35.0 41.0 31.0 41.0 60-61 36.018875 39.0 35.0 41.0 31.0 41.0 62-63 35.705124999999995 38.0 35.0 40.5 30.0 41.0 64-65 35.346125 37.5 35.0 40.0 29.0 41.0 66-67 35.373625000000004 37.0 35.0 40.0 30.5 41.0 68-69 35.141375 37.0 35.0 39.5 30.5 41.0 70-71 34.820375 36.0 35.0 39.0 30.5 41.0 72-73 34.324 36.0 35.0 39.0 29.0 40.5 74-75 34.022000000000006 35.0 34.5 37.5 29.0 39.5 76-77 33.68125 35.0 34.0 37.0 29.0 39.0 78-79 33.31725 35.0 34.0 36.5 29.0 39.0 80-81 32.909875 35.0 34.0 36.0 28.0 37.0 82-83 32.641625000000005 35.0 34.0 36.0 27.5 37.0 84-85 32.433625 35.0 34.0 35.0 28.0 36.5 86-87 32.16475 35.0 34.0 35.0 27.0 36.0 88-89 31.84475 35.0 33.0 35.0 25.0 36.0 90-91 31.836 35.0 33.0 35.0 26.0 36.0 92-93 31.6555 35.0 33.0 35.0 25.0 35.0 94-95 31.543999999999997 35.0 33.0 35.0 25.0 35.0 96-97 31.372999999999998 35.0 33.0 35.0 24.5 35.0 98-99 31.190125000000002 35.0 33.0 35.0 23.5 35.0 100-101 29.356749999999998 33.5 29.5 34.5 12.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 62.0 3 6.0 4 5.0 5 3.0 6 8.0 7 3.0 8 5.0 9 5.0 10 7.0 11 4.0 12 4.0 13 3.0 14 11.0 15 7.0 16 7.0 17 8.0 18 6.0 19 7.0 20 9.0 21 13.0 22 9.0 23 15.0 24 17.0 25 14.0 26 20.0 27 22.0 28 22.0 29 36.0 30 46.0 31 70.0 32 67.0 33 102.0 34 173.0 35 255.0 36 437.0 37 919.0 38 1333.0 39 260.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.875 11.075 30.4 29.65 2 26.625 9.425 25.074999999999996 38.875 3 21.75 13.325000000000001 29.7 35.225 4 24.025 11.35 28.799999999999997 35.825 5 26.0 13.825000000000001 23.599999999999998 36.575 6 24.5 17.5 30.675 27.325 7 18.5 24.325 40.825 16.35 8 18.504626156539132 25.55638909727432 36.63415853963491 19.30482620655164 9 17.5293823455864 27.081770442610654 35.108777194298575 20.280070017504375 10-11 18.775 26.787499999999998 32.4 22.037499999999998 12-13 19.727465933241657 27.315914489311165 31.866483310413802 21.09013626703338 14-15 19.425 26.05 31.225 23.3 16-17 20.815101887735967 26.16577072134017 29.466183272909113 23.55294411801475 18-19 19.667416854213553 26.731682920730183 29.68242060515129 23.918479619904975 20-21 20.99274818704676 26.18154538634659 28.769692423105774 24.056014003500874 22-23 21.827728466058257 24.590573821727716 28.42855356919615 25.153144143017876 24-25 19.787499999999998 26.6 29.125 24.4875 26-27 21.725 26.075 27.1375 25.0625 28-29 20.962500000000002 24.875 27.275 26.887499999999996 30-31 19.575 26.1625 29.575000000000003 24.6875 32-33 22.8125 25.974999999999998 26.387500000000003 24.825 34-35 20.3875 25.3 27.8875 26.424999999999997 36-37 21.725 25.224999999999998 27.8875 25.162499999999998 38-39 21.6875 25.7375 27.037499999999998 25.5375 40-41 22.412499999999998 24.962500000000002 26.787499999999998 25.837500000000002 42-43 21.2375 26.437500000000004 27.8125 24.5125 44-45 22.030507626906726 27.319329832458116 25.681420355088775 24.968742185546386 46-47 21.255313828457115 25.581395348837212 26.93173293323331 26.231557889472366 48-49 21.0625 26.825 27.575 24.5375 50-51 21.987499999999997 26.75 26.85 24.4125 52-53 22.45 25.525 26.150000000000002 25.874999999999996 54-55 20.4625 26.9625 28.000000000000004 24.575 56-57 20.9125 26.400000000000002 27.8375 24.85 58-59 21.212500000000002 25.162499999999998 27.250000000000004 26.375 60-61 21.837500000000002 26.237500000000004 27.787499999999998 24.1375 62-63 22.4375 26.0 26.3 25.2625 64-65 21.05 24.8625 27.4125 26.674999999999997 66-67 20.9875 26.025 28.6625 24.325 68-69 21.9375 25.7625 26.474999999999998 25.825 70-71 20.9 26.387500000000003 26.974999999999998 25.7375 72-73 21.702712839104887 25.690711338917367 27.21590198774847 25.390673834229275 74-75 21.775 26.187500000000004 26.237500000000004 25.8 76-77 22.537499999999998 26.3 26.174999999999997 24.9875 78-79 21.712500000000002 25.724999999999998 26.687499999999996 25.874999999999996 80-81 21.7875 25.7 27.2625 25.25 82-83 21.65 25.5125 26.487500000000004 26.35 84-85 23.1625 25.137500000000003 26.625 25.074999999999996 86-87 23.3875 26.2625 26.0125 24.337500000000002 88-89 22.912499999999998 25.2 25.900000000000002 25.9875 90-91 23.1125 26.0125 26.6125 24.2625 92-93 22.8 25.7125 27.150000000000002 24.337500000000002 94-95 22.675 25.900000000000002 26.087500000000002 25.337500000000002 96-97 25.2625 24.375 26.924999999999997 23.4375 98-99 22.9875 26.4125 24.75 25.85 100-101 23.125 25.674999999999997 25.924999999999997 25.275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 16.0 1 12.0 2 6.0 3 3.0 4 2.5 5 2.5 6 1.5 7 2.0 8 2.5 9 1.5 10 1.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 1.0 17 1.0 18 0.5 19 0.5 20 0.0 21 1.0 22 1.5 23 1.0 24 1.5 25 4.0 26 6.5 27 8.0 28 8.5 29 10.5 30 15.0 31 19.5 32 25.5 33 32.5 34 40.5 35 52.5 36 60.5 37 66.5 38 88.5 39 133.0 40 166.5 41 193.0 42 209.0 43 208.0 44 229.0 45 230.0 46 202.5 47 192.0 48 178.5 49 156.5 50 143.0 51 128.0 52 112.5 53 100.5 54 88.5 55 82.5 56 83.0 57 79.0 58 60.0 59 47.5 60 44.0 61 44.0 62 43.5 63 38.5 64 38.0 65 35.0 66 33.5 67 30.0 68 26.5 69 22.5 70 19.5 71 19.0 72 16.5 73 14.0 74 13.0 75 8.0 76 5.0 77 7.0 78 5.5 79 3.5 80 3.5 81 3.5 82 3.0 83 2.0 84 1.5 85 1.0 86 0.0 87 0.0 88 0.0 89 1.0 90 1.0 91 0.0 92 0.0 93 1.0 94 1.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.025 9 0.025 10-11 0.0 12-13 0.0125 14-15 0.0 16-17 0.0125 18-19 0.025 20-21 0.025 22-23 0.0125 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.025 46-47 0.025 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0125 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.61431870669746 96.075 2 1.0264305876315114 2.0 3 0.1796253528355145 0.525 4 0.051321529381575574 0.2 5 0.025660764690787787 0.125 6 0.025660764690787787 0.15 7 0.0 0.0 8 0.0 0.0 9 0.051321529381575574 0.44999999999999996 >10 0.025660764690787787 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 19 0.475 No Hit TCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 9 0.22499999999999998 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 9 0.22499999999999998 No Hit CCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGG 6 0.15 No Hit TCACATGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10-11 0.125 0.0 0.0 0.0 0.0 12-13 0.125 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.1375 0.0 0.0 0.0 0.0 18-19 0.15 0.0 0.0 0.0 0.0 20-21 0.15 0.0 0.0 0.0 0.0 22-23 0.15 0.0 0.0 0.0 0.0 24-25 0.15 0.0 0.0 0.0 0.0 26-27 0.15 0.0 0.0 0.0 0.0 28-29 0.15 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.16249999999999998 0.0 0.0 0.0 0.0 36-37 0.1875 0.0 0.0 0.0 0.0 38-39 0.21250000000000002 0.0 0.0 0.0 0.0 40-41 0.25 0.0 0.0 0.0 0.0 42-43 0.36250000000000004 0.0 0.0 0.0 0.0 44-45 0.4875 0.0 0.0 0.0 0.0 46-47 0.575 0.0 0.0 0.0 0.0 48-49 0.6375 0.0 0.0 0.0 0.0 50-51 0.6625000000000001 0.0 0.0 0.0 0.0 52-53 0.75 0.0 0.0 0.0 0.0 54-55 0.8625 0.0 0.0 0.0 0.0 56-57 0.9624999999999999 0.0 0.0 0.0 0.0 58-59 1.025 0.0 0.0 0.0 0.0 60-61 1.0750000000000002 0.0 0.0 0.0 0.0 62-63 1.2125 0.0 0.0 0.0 0.0 64-65 1.4 0.0 0.0 0.0 0.0 66-67 1.5625 0.0 0.0 0.0 0.0 68-69 1.7125 0.0 0.0 0.0 0.0 70-71 1.8875 0.0 0.0 0.0 0.0 72-73 2.0375 0.0 0.0 0.0 0.0 74-75 2.2375 0.0 0.0 0.0 0.0 76-77 2.5250000000000004 0.0 0.0 0.0 0.0 78-79 2.8 0.0 0.0 0.0 0.0 80-81 3.0375 0.0 0.0 0.0 0.0 82-83 3.3375 0.0 0.0 0.0 0.0 84-85 3.7375 0.0 0.0 0.0 0.0 86-87 4.125 0.0 0.0 0.0 0.0 88-89 4.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAGCT 15 0.009957196 47.5 32-33 >>END_MODULE Read 1875947 spots for ERR3317447.sra Written 1875947 spots for ERR3317447.sra Read 1875947 spots for ERR3317447.sra Written 1875947 spots for ERR3317447.sra Read 1875947 spots for ERR3317447.sra Written 1875947 spots for ERR3317447.sra Read 1875947 spots for ERR3317447.sra Written 1875947 spots for ERR3317447.sra Read 1875947 spots for ERR3317447.sra Written 1875947 spots for ERR3317447.sra Read 1875947 spots for ERR3317447.sra Written 1875947 spots for ERR3317447.sra Read 1875947 spots for ERR3317447.sra Written 1875947 spots for ERR3317447.sra Read 1875947 spots for ERR3317447.sra Written 1875947 spots for ERR3317447.sra Read 1875947 spots for ERR3317447.sra Written 1875947 spots for ERR3317447.sra Read 1875951 spots for ERR3317447.sra Written 1875951 spots for ERR3317447.sra Read 1875947 spots for ERR3317447.sra Written 1875947 spots for ERR3317447.sra Read 1875947 spots for ERR3317447.sra Written 1875947 spots for ERR3317447.sra Read 1875947 spots for ERR3317447.sra Written 1875947 spots for ERR3317447.sra Read 1875947 spots for ERR3317447.sra Written 1875947 spots for ERR3317447.sra Read 1875947 spots for ERR3317447.sra Written 1875947 spots for ERR3317447.sra Read 1875947 spots for ERR3317447.sra Written 1875947 spots for ERR3317447.sra Read 1875947 spots for ERR3317447.sra Written 1875947 spots for ERR3317447.sra Read 1875947 spots for ERR3317447.sra Written 1875947 spots for ERR3317447.sra Read 1875947 spots for ERR3317447.sra Written 1875947 spots for ERR3317447.sra Read 1875947 spots for ERR3317447.sra Written 1875947 spots for ERR3317447.sra SRR ids: ['ERR3317447.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d211z14r ERR3317447.sra spots: 37518944 blocks: [[1, 1875947], [1875948, 3751894], [3751895, 5627841], [5627842, 7503788], [7503789, 9379735], [9379736, 11255682], [11255683, 13131629], [13131630, 15007576], [15007577, 16883523], [16883524, 18759470], [18759471, 20635417], [20635418, 22511364], [22511365, 24387311], [24387312, 26263258], [26263259, 28139205], [28139206, 30015152], [30015153, 31891099], [31891100, 33767046], [33767047, 35642993], [35642994, 37518944]] ERR3317447 file size 9028279 ERR3317447 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317447 ERR3317447_1.fastq ERR3317447_2.fastq Input file: ERR3317447_1.fastq Paired file: ERR3317447_2.fastq trimmed: ERR3317447-trimmed-pair1.fastq, ERR3317447-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:33:53 2024 >> started Tue Dec 10 09:34:32 2024 >> done (38.674s) 37518944 read pairs processed; of these: 295597 ( 0.79%) short read pairs filtered out after trimming by size control 693550 ( 1.85%) empty read pairs filtered out after trimming by size control 36529797 (97.36%) read pairs available; of these: 9919481 (27.15%) trimmed read pairs available after processing 26610316 (72.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 305 0.00% 19 393 0.00% 20 636 0.00% 21 819 0.00% 22 1060 0.00% 23 1490 0.00% 24 1808 0.00% 25 2359 0.01% 26 2667 0.01% 27 3336 0.01% 28 3581 0.01% 29 4443 0.01% 30 4847 0.01% 31 7218 0.02% 32 6378 0.02% 33 6610 0.02% 34 7838 0.02% 35 8195 0.02% 36 9317 0.03% 37 9977 0.03% 38 11225 0.03% 39 12701 0.03% 40 12241 0.03% 41 13345 0.04% 42 14222 0.04% 43 15379 0.04% 44 16331 0.04% 45 16976 0.05% 46 18092 0.05% 47 20414 0.06% 48 21095 0.06% 49 22039 0.06% 50 24451 0.07% 51 24937 0.07% 52 26590 0.07% 53 28743 0.08% 54 33155 0.09% 55 37388 0.10% 56 35974 0.10% 57 37789 0.10% 58 43391 0.12% 59 55767 0.15% 60 65106 0.18% 61 73163 0.20% 62 75747 0.21% 63 80091 0.22% 64 85865 0.24% 65 89140 0.24% 66 99716 0.27% 67 100242 0.27% 68 101114 0.28% 69 106669 0.29% 70 108473 0.30% 71 113038 0.31% 72 117027 0.32% 73 124127 0.34% 74 124902 0.34% 75 125606 0.34% 76 123862 0.34% 77 130731 0.36% 78 141753 0.39% 79 141581 0.39% 80 144190 0.39% 81 146074 0.40% 82 151649 0.42% 83 156858 0.43% 84 166008 0.45% 85 180472 0.49% 86 188607 0.52% 87 197240 0.54% 88 195050 0.53% 89 222575 0.61% 90 215543 0.59% 91 220392 0.60% 92 231803 0.63% 93 246458 0.67% 94 272368 0.75% 95 299947 0.82% 96 342618 0.94% 97 410857 1.12% 98 522643 1.43% 99 741069 2.03% 100 1913585 5.24% 101 26610316 72.85% 36529797 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=3.92 fanout-score-rank=13 prefix-density=0.55 prefix-fanout=3.2 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.10 sequence-density-rank=18 fanout-score=25.82 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=7.5 sequence=TCCTCCTCCTCCGCCG criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=26.45 fanout-score-rank=7 prefix-density=0.39 prefix-fanout=12.3 sequence=TCCTTCTTCTCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=178.68 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=7.7 sequence=TTTTCCTTTTTGTTTGTTTCGAGAAAGATATCGTCCGATTCTCCTTCTATTGATTCTTTTCCGATCGAGATGTATGGATCCATGTGTCTACATACCTAGATTCTGTTCATGGATTAACGAAAATGTGCAAGAGCTCTATTTGCCTCTGCCATTCTATGAGTCGCTTCCTTTTTGCGTATGGCACCCCCACTCCCTTTGGCAGCATCTACTAATTCGGAACTTAATTTGAAAGCCATATTTCGACCCGGACGCTTTTGGGATGCTTCTAATAACCAACGAATGGCAAGTGCTCTTCCTTGTTTAGATCCTATTTCAATCGGAACTTTCCGCGTCGATCCTTTTTTATTACGTCTTGTTTTTACTCCTATATTGGGAGTTACTCTACGTATTGCTTGACGTAAAACCAATAGTGGATTTGTTTCTGTCTTTTGTT ERR3317447 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:35:19 Started mapping on | Dec 10 09:35:19 Finished on | Dec 10 09:37:15 Mapping speed, Million of reads per hour | 1133.68 Number of input reads | 36529797 Average input read length | 194 UNIQUE READS: Uniquely mapped reads number | 33076331 Uniquely mapped reads % | 90.55% Average mapped length | 193.01 Number of splices: Total | 21338216 Number of splices: Annotated (sjdb) | 20353622 Number of splices: GT/AG | 21021057 Number of splices: GC/AG | 284633 Number of splices: AT/AC | 17729 Number of splices: Non-canonical | 14797 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.00% Deletion average length | 1.21 Insertion rate per base | 0.00% Insertion average length | 1.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2493830 % of reads mapped to multiple loci | 6.83% Number of reads mapped to too many loci | 50702 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.54% % of reads unmapped: other | 0.95% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1123680 1123680 1123680 N_multimapping 2493830 2493830 2493830 N_noFeature 1156042 1932685 31620948 N_ambiguous 1027302 387585 11806 UnstrandedReadsAssigned:30892987 PositiveStrandReadsAssigned:30756061 NegativeStrandReadsAssigned:1443577 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 ERR3317447 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317447-trimmed-pair1.fastq ERR3317447-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,529,797 reads, 33,009,840 reads pseudoaligned [quant] estimated average fragment length: 194.969 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,148 rounds 52973 ERR3317447.ke.tsv 35125 ERR3317447.se.tsv 88098 total ==> ERR3317447.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 742.257 0 0 PNS24247 1044 850.031 20.3581 1.08687 PNS24249 1928 1734.03 100.865 2.63972 PNS24246 1044 850.031 20.3581 1.08687 PNS24248 1044 850.031 20.3581 1.08687 PNS24244 1471 1277.03 269.061 9.56146 PNS24243 293 126.807 0 0 KQK14069 1603 1409.03 3698.12 119.106 KQK14071 474 287.256 19.8031 3.12852 ==> ERR3317447.se.tsv <== BRADI_1g14170v3 4512 BRADI_1g53295v3 699 BRADI_1g59795v3 849 BRADI_1g07683v3 0 BRADI_1g00485v3 85 BRADI_1g20270v3 2567 BRADI_1g74790v3 180 BRADI_1g09890v3 25 BRADI_1g77505v3 424 BRADI_1g48960v3 0 ERR3317447 completed mapping pipeline successfully