Starting /dee2/code/volunteer_pipeline.sh ERR3317448 current disk space = 1515002925056 free memory = 1564201380 ERR3317448 SRAfilesize 8ca8e2fd90d0b49f4b31b1ae65224563 ERR3317448.sra ERR3317448.sra file validated ERR3317448 is paired end ERR3317448 is conventional basespace ERR3317448 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317448_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.61525 34.0 31.0 34.0 31.0 34.0 2 32.3655 34.0 31.0 34.0 31.0 34.0 3 32.90725 34.0 31.0 34.0 31.0 34.0 4 36.4315 37.0 37.0 37.0 35.0 37.0 5 36.4265 37.0 37.0 37.0 35.0 37.0 6 36.403 37.0 37.0 37.0 35.0 37.0 7 36.4625 37.0 37.0 37.0 35.0 37.0 8 36.45125 37.0 37.0 37.0 35.0 37.0 9 38.32275 39.0 39.0 39.0 37.0 39.0 10-11 38.299 39.0 39.0 39.0 37.0 39.0 12-13 38.226625 39.0 39.0 39.0 37.0 39.0 14-15 39.7425 41.0 40.0 41.0 37.0 41.0 16-17 39.71225 41.0 40.0 41.0 37.0 41.0 18-19 39.69225 41.0 40.0 41.0 37.0 41.0 20-21 39.647999999999996 41.0 40.0 41.0 37.0 41.0 22-23 39.559 41.0 40.0 41.0 37.0 41.0 24-25 39.495875 41.0 39.5 41.0 37.0 41.0 26-27 39.319625 41.0 39.0 41.0 36.0 41.0 28-29 39.224374999999995 41.0 39.0 41.0 36.0 41.0 30-31 39.06125 40.5 39.0 41.0 35.0 41.0 32-33 38.82225 40.0 38.5 41.0 35.0 41.0 34-35 38.5385 40.0 38.0 41.0 34.0 41.0 36-37 38.484624999999994 40.0 38.0 41.0 34.0 41.0 38-39 38.093125 40.0 38.0 41.0 33.0 41.0 40-41 37.97075 40.0 37.5 41.0 33.0 41.0 42-43 37.88249999999999 40.0 37.0 41.0 33.0 41.0 44-45 37.602875 40.0 37.0 41.0 32.5 41.0 46-47 37.468375 40.0 36.5 41.0 32.5 41.0 48-49 37.1575 39.5 36.0 41.0 31.5 41.0 50-51 37.443250000000006 40.0 36.0 41.0 33.0 41.0 52-53 37.372749999999996 40.0 35.5 41.0 33.0 41.0 54-55 36.961375000000004 39.0 35.0 41.0 32.5 41.0 56-57 36.685874999999996 39.0 35.0 41.0 32.0 41.0 58-59 36.352375 38.5 35.0 41.0 31.0 41.0 60-61 36.026125 37.5 35.0 41.0 31.0 41.0 62-63 35.709500000000006 37.0 35.0 40.0 31.0 41.0 64-65 35.281 36.5 35.0 39.5 30.0 41.0 66-67 35.020250000000004 36.0 35.0 39.0 29.5 41.0 68-69 34.651875000000004 35.5 34.0 39.0 30.0 41.0 70-71 34.260625000000005 35.0 34.0 37.5 29.5 40.0 72-73 33.750249999999994 35.0 34.0 37.0 28.5 39.0 74-75 33.395875000000004 35.0 34.0 37.0 28.5 39.0 76-77 32.299499999999995 34.5 32.5 36.0 26.0 37.0 78-79 32.528999999999996 35.0 33.0 36.0 26.5 37.0 80-81 32.397999999999996 35.0 33.0 35.5 26.5 37.0 82-83 32.1455 35.0 33.0 35.0 25.5 36.5 84-85 31.77475 35.0 33.0 35.0 24.5 36.0 86-87 31.552500000000002 35.0 33.0 35.0 24.5 36.0 88-89 31.427374999999998 35.0 33.0 35.0 24.0 36.0 90-91 31.262625 35.0 33.0 35.0 24.0 35.0 92-93 30.8465 35.0 32.0 35.0 20.0 35.0 94-95 30.77375 35.0 32.5 35.0 19.5 35.0 96-97 30.556874999999998 35.0 32.0 35.0 18.5 35.0 98-99 30.094625 35.0 32.0 35.0 2.0 35.0 100-101 27.822375 33.0 28.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 5.0 10 7.0 11 3.0 12 6.0 13 4.0 14 13.0 15 6.0 16 7.0 17 11.0 18 22.0 19 11.0 20 8.0 21 19.0 22 8.0 23 19.0 24 26.0 25 20.0 26 29.0 27 41.0 28 46.0 29 48.0 30 58.0 31 76.0 32 89.0 33 136.0 34 215.0 35 275.0 36 560.0 37 1030.0 38 1060.0 39 141.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.441253263707573 26.631853785900784 18.27676240208877 27.65013054830287 2 28.025 24.349999999999998 17.75 29.875 3 28.975 24.6 18.175 28.249999999999996 4 28.65 25.2 15.5 30.65 5 28.15 26.25 14.875 30.725 6 31.125000000000004 27.85 16.5 24.525 7 31.900000000000002 22.15 21.125 24.825 8 33.1 24.9 23.5 18.5 9 32.95 25.974999999999998 23.9 17.175 10-11 33.3625 26.6 21.475 18.5625 12-13 29.825000000000003 26.487500000000004 23.9375 19.75 14-15 26.8 26.5875 25.4 21.212500000000002 16-17 26.2125 25.174999999999997 26.5 22.112499999999997 18-19 25.6125 26.55 25.662499999999998 22.175 20-21 25.7875 26.325 25.75 22.1375 22-23 25.9407425928241 26.728341042630326 25.128141017627204 22.202775346918365 24-25 25.0375 26.8625 25.275 22.825 26-27 25.378172271533945 25.965745718214777 25.29066133266658 23.365420677584698 28-29 25.7 26.237500000000004 24.6 23.4625 30-31 25.412499999999998 27.025 25.45 22.112499999999997 32-33 25.387500000000003 25.8 26.5875 22.225 34-35 25.724999999999998 24.8125 25.362499999999997 24.099999999999998 36-37 26.0375 26.224999999999998 25.112499999999997 22.625 38-39 25.5 26.237500000000004 25.4875 22.775000000000002 40-41 26.450000000000003 25.5375 25.1 22.912499999999998 42-43 24.962500000000002 25.900000000000002 25.85 23.2875 44-45 26.150000000000002 26.224999999999998 25.137500000000003 22.4875 46-47 26.8125 25.0125 24.4 23.775 48-49 25.912499999999998 26.487500000000004 25.3 22.3 50-51 25.15 26.2125 25.5 23.1375 52-53 26.137500000000003 25.6125 25.112499999999997 23.1375 54-55 25.650000000000002 26.5875 25.837500000000002 21.925 56-57 25.362499999999997 26.200000000000003 25.45 22.9875 58-59 25.1 25.837500000000002 24.8625 24.2 60-61 25.837500000000002 26.150000000000002 26.337500000000002 21.675 62-63 25.275 26.950000000000003 24.0625 23.7125 64-65 25.575 26.275 24.2375 23.9125 66-67 25.525 26.5375 24.962500000000002 22.975 68-69 24.4875 26.6625 25.3 23.549999999999997 70-71 25.874999999999996 26.125 25.0125 22.9875 72-73 25.687500000000004 26.174999999999997 24.725 23.4125 74-75 26.1125 26.525 24.4375 22.925 76-77 25.95 25.924999999999997 24.2375 23.8875 78-79 25.662499999999998 26.35 26.05 21.9375 80-81 25.8625 25.15 25.0375 23.95 82-83 25.4 26.6 24.375 23.625 84-85 25.9875 26.5375 25.174999999999997 22.3 86-87 26.1125 26.2625 23.962500000000002 23.6625 88-89 25.637500000000003 26.575 24.9125 22.875 90-91 25.6125 26.2625 25.074999999999996 23.05 92-93 25.35 27.125 23.8625 23.6625 94-95 25.6 26.9625 24.1625 23.275000000000002 96-97 25.1875 26.674999999999997 25.162499999999998 22.975 98-99 25.087500000000002 26.8 24.625 23.4875 100-101 25.674999999999997 27.450000000000003 23.075000000000003 23.799999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.5 10 1.0 11 0.5 12 0.0 13 0.5 14 1.5 15 1.5 16 0.5 17 1.5 18 2.0 19 1.5 20 2.0 21 1.5 22 2.0 23 3.5 24 2.0 25 1.0 26 1.5 27 3.5 28 7.5 29 10.0 30 10.0 31 12.0 32 16.5 33 19.5 34 27.0 35 35.5 36 47.0 37 60.5 38 76.0 39 97.5 40 117.0 41 140.0 42 169.0 43 188.0 44 213.5 45 216.0 46 191.5 47 202.0 48 195.5 49 175.5 50 170.0 51 144.0 52 132.0 53 120.0 54 105.5 55 98.0 56 81.5 57 74.5 58 77.5 59 80.0 60 74.5 61 59.5 62 43.5 63 36.0 64 38.0 65 43.5 66 47.0 67 44.5 68 38.0 69 33.5 70 26.0 71 24.5 72 28.0 73 23.0 74 17.5 75 13.5 76 7.0 77 6.5 78 8.0 79 8.5 80 7.5 81 8.0 82 7.0 83 3.5 84 1.5 85 2.5 86 2.5 87 1.0 88 1.0 89 1.0 90 1.0 91 1.0 92 1.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0125 24-25 0.0 26-27 0.0125 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.225 #Duplication Level Percentage of deduplicated Percentage of total 1 98.02005656981228 95.3 2 1.542813062483929 3.0 3 0.23142195937258936 0.675 4 0.10285420416559526 0.4 5 0.025713551041398816 0.125 6 0.05142710208279763 0.3 7 0.0 0.0 8 0.025713551041398816 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GACACGGGGAGGTAGTGACAATAAATAACAATACCGGGCACATTAGTGTC 8 0.2 No Hit ACTTAACTGGGGGATTCACCGCAAATACTACTTTGGCTCATTATTGCCGC 6 0.15 No Hit TGCTCGTGAAGGTAATGAAATTATCCGAGCAGCTTGCAAATGGAGTCCTG 6 0.15 No Hit TAACTGGGGGATTCACCGCAAATACTACTTTGGCTCATTATTGCCGCGAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0125 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.0625 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.16249999999999998 0.0 0.0 0.0 0.0 30-31 0.21250000000000002 0.0 0.0 0.0 0.0 32-33 0.2375 0.0 0.0 0.0 0.0 34-35 0.275 0.0 0.0 0.0 0.0 36-37 0.2875 0.0 0.0 0.0 0.0 38-39 0.3375 0.0 0.0 0.0 0.0 40-41 0.3875 0.0 0.0 0.0 0.0 42-43 0.4375 0.0 0.0 0.0 0.0 44-45 0.475 0.0 0.0 0.0 0.0 46-47 0.4875 0.0 0.0 0.0 0.0 48-49 0.5875 0.0 0.0 0.0 0.0 50-51 0.7125 0.0 0.0 0.0 0.0 52-53 0.8375 0.0 0.0 0.0 0.0 54-55 1.0625 0.0 0.0 0.0 0.0 56-57 1.2125 0.0 0.0 0.0 0.0 58-59 1.275 0.0 0.0 0.0 0.0 60-61 1.3625 0.0 0.0 0.0 0.0 62-63 1.5125000000000002 0.0 0.0 0.0 0.0 64-65 1.75 0.0 0.0 0.0 0.0 66-67 1.9 0.0 0.0 0.0 0.0 68-69 2.1875 0.0 0.0 0.0 0.0 70-71 2.425 0.0 0.0 0.0 0.0 72-73 2.75 0.0 0.0 0.0 0.0 74-75 3.1375 0.0 0.0 0.0 0.0 76-77 3.525 0.0 0.0 0.0 0.0 78-79 4.0125 0.0 0.0 0.0 0.0 80-81 4.475 0.0 0.0 0.0 0.0 82-83 4.975 0.0 0.0 0.0 0.0 84-85 5.362500000000001 0.0 0.0 0.0 0.0 86-87 5.775 0.0 0.0 0.0 0.0 88-89 6.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317448 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317448_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.02075 33.0 31.0 34.0 30.0 34.0 2 32.00325 34.0 31.0 34.0 30.0 34.0 3 31.922 34.0 31.0 34.0 30.0 34.0 4 35.268 37.0 35.0 37.0 33.0 37.0 5 35.48525 37.0 35.0 37.0 33.0 37.0 6 35.59825 37.0 36.0 37.0 35.0 37.0 7 35.68425 37.0 36.0 37.0 35.0 37.0 8 35.63225 37.0 37.0 37.0 35.0 37.0 9 37.4065 39.0 39.0 39.0 35.0 39.0 10-11 37.59125 39.0 39.0 39.0 35.0 39.0 12-13 37.576125000000005 39.0 38.5 39.0 35.0 39.0 14-15 39.033375 41.0 40.0 41.0 36.0 41.0 16-17 39.045 41.0 39.5 41.0 36.0 41.0 18-19 38.91875 41.0 39.5 41.0 36.0 41.0 20-21 38.925125 41.0 40.0 41.0 36.0 41.0 22-23 38.88225 41.0 39.0 41.0 35.5 41.0 24-25 38.775375 41.0 39.0 41.0 35.0 41.0 26-27 38.658 41.0 39.0 41.0 35.0 41.0 28-29 38.5655 41.0 39.0 41.0 35.0 41.0 30-31 38.369875 41.0 39.0 41.0 34.0 41.0 32-33 38.301375 40.5 38.0 41.0 34.0 41.0 34-35 38.245999999999995 40.0 38.0 41.0 34.0 41.0 36-37 38.147000000000006 40.0 38.0 41.0 34.0 41.0 38-39 38.050625 40.0 38.0 41.0 34.0 41.0 40-41 38.110625 40.0 38.0 41.0 34.0 41.0 42-43 37.97325 40.0 38.0 41.0 33.5 41.0 44-45 37.791875000000005 40.0 38.0 41.0 33.0 41.0 46-47 37.623875 40.0 38.0 41.0 33.0 41.0 48-49 37.458875 40.0 37.0 41.0 33.0 41.0 50-51 36.6515 39.5 36.0 40.5 31.5 41.0 52-53 36.562375 39.5 36.0 40.5 31.0 41.0 54-55 36.611875 40.0 35.0 41.0 31.0 41.0 56-57 36.514125 39.0 35.0 41.0 31.0 41.0 58-59 36.31175 39.0 35.0 41.0 31.0 41.0 60-61 36.028999999999996 39.0 35.0 41.0 30.5 41.0 62-63 35.56675 38.0 35.0 40.5 29.5 41.0 64-65 35.325 37.0 35.0 40.0 29.0 41.0 66-67 35.294624999999996 37.0 35.0 40.0 30.0 41.0 68-69 35.034125 36.5 35.0 39.5 29.5 41.0 70-71 34.7325 36.0 35.0 39.0 30.0 41.0 72-73 34.411 35.5 35.0 39.0 29.5 40.5 74-75 33.998625 35.0 35.0 37.5 29.5 39.0 76-77 33.6505 35.0 34.0 37.0 29.0 39.0 78-79 33.32425 35.0 34.0 36.5 29.0 39.0 80-81 33.082625 35.0 34.0 36.0 29.0 37.0 82-83 32.7855 35.0 34.0 36.0 29.0 37.0 84-85 32.604875 35.0 34.0 35.0 28.0 36.5 86-87 32.428124999999994 35.0 34.0 35.0 28.0 36.0 88-89 32.192 35.0 34.0 35.0 27.0 36.0 90-91 32.02625 35.0 34.0 35.0 26.5 36.0 92-93 31.83175 35.0 33.5 35.0 26.0 35.0 94-95 31.620625 35.0 33.0 35.0 25.0 35.0 96-97 31.492 35.0 33.0 35.0 25.0 35.0 98-99 31.228375 35.0 33.0 35.0 24.0 35.0 100-101 29.5095 33.5 30.0 35.0 11.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 41.0 3 1.0 4 4.0 5 5.0 6 7.0 7 6.0 8 2.0 9 5.0 10 4.0 11 7.0 12 9.0 13 12.0 14 8.0 15 10.0 16 17.0 17 12.0 18 9.0 19 9.0 20 5.0 21 9.0 22 8.0 23 7.0 24 12.0 25 13.0 26 19.0 27 20.0 28 34.0 29 34.0 30 46.0 31 55.0 32 67.0 33 99.0 34 177.0 35 254.0 36 435.0 37 930.0 38 1354.0 39 254.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.5 11.1 29.575000000000003 28.825 2 26.775 10.225 25.0 38.0 3 22.525000000000002 12.6 30.0 34.875 4 24.725 11.575000000000001 27.675 36.025 5 25.4 14.45 23.474999999999998 36.675000000000004 6 24.6 18.95 29.775000000000002 26.674999999999997 7 18.85 23.275000000000002 40.275 17.599999999999998 8 18.025 25.3 34.949999999999996 21.725 9 17.879469867466867 27.53188297074269 34.658664666166544 19.929982495623904 10-11 18.914864358044756 26.778347293411674 32.87910988873609 21.427678459807474 12-13 19.017254313578395 27.66941735433858 32.570642660665165 20.742685671417853 14-15 19.86746686671668 25.84396099024756 31.657914478619652 22.630657664416105 16-17 20.255063765941486 26.39409852463116 29.91997999499875 23.43085771442861 18-19 19.97248624312156 27.47623811905953 29.864932466233117 22.686343171585793 20-21 21.14807403701851 26.563281640820406 28.61430715357679 23.67433716858429 22-23 21.630407601900476 24.793698424606152 28.257064266066518 25.318829707426854 24-25 20.56764191047762 26.669167291822955 28.132033008252062 24.63115778944736 26-27 22.152769096137018 26.02825353169146 27.128391048881113 24.69058632329041 28-29 21.25265658207276 26.053256657082137 26.24078009751219 26.453306663332913 30-31 20.6875 26.775 29.2 23.3375 32-33 22.527815976997125 25.440680085010626 27.640955119389925 24.390548818602326 34-35 20.977622202775347 24.94061757719715 27.678459807475935 26.403300412551566 36-37 20.56507063382923 26.715839479934996 27.890986373296663 24.82810351293912 38-39 21.255313828457115 26.03150787696924 27.33183295823956 25.381345336334082 40-41 22.605651412853213 24.318579644911228 27.831957989497376 25.243810952738183 42-43 22.280570142535634 26.294073518379594 27.319329832458116 24.10602650662666 44-45 22.843210802700675 26.30657664416104 25.506376594148538 25.343835958989747 46-47 22.255563890972745 25.35633908477119 26.156539134783696 26.231557889472366 48-49 21.61790447611903 27.019254813703427 27.019254813703427 24.343585896474117 50-51 22.455613903475868 25.393848462115532 26.231557889472366 25.918979744936234 52-53 22.59032379047381 25.90323790473809 25.965745718214777 25.54069258657332 54-55 20.9875 26.7625 28.287499999999998 23.962500000000002 56-57 22.1 25.775 27.35 24.775 58-59 21.925 25.25 26.4625 26.3625 60-61 21.512500000000003 25.85 27.237499999999997 25.4 62-63 22.4625 25.1875 26.474999999999998 25.874999999999996 64-65 22.2 24.887500000000003 25.912499999999998 27.0 66-67 21.587500000000002 25.650000000000002 28.625 24.1375 68-69 22.727840980122515 26.453306663332913 25.678209776222026 25.14064258032254 70-71 22.662499999999998 25.874999999999996 25.4875 25.974999999999998 72-73 22.468117029257314 25.593898474618655 27.581895473868467 24.356089022255563 74-75 23.293323330832706 25.806451612903224 26.356589147286826 24.543635908977244 76-77 22.605651412853213 26.131532883220803 25.731432858214554 25.531382845711427 78-79 22.10276284535567 26.040755094386796 26.490811351418923 25.365670708838607 80-81 23.10577644411103 25.818954738684667 27.019254813703427 24.056014003500874 82-83 23.1375 24.4375 25.974999999999998 26.450000000000003 84-85 22.5875 26.7625 25.874999999999996 24.775 86-87 24.8625 25.424999999999997 25.387500000000003 24.325 88-89 23.625 25.900000000000002 25.362499999999997 25.112499999999997 90-91 22.95 27.175 25.25 24.625 92-93 23.3375 25.6125 26.6625 24.3875 94-95 24.575 25.025 25.687500000000004 24.712500000000002 96-97 24.5 25.900000000000002 26.200000000000003 23.400000000000002 98-99 24.1625 26.4125 25.0625 24.3625 100-101 24.103012876609576 25.753219152394045 24.778097262157768 25.365670708838607 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 19.0 1 13.0 2 4.5 3 3.0 4 3.5 5 1.5 6 0.5 7 1.5 8 1.5 9 1.0 10 0.5 11 1.0 12 2.0 13 1.5 14 0.5 15 0.0 16 0.5 17 1.5 18 2.5 19 2.0 20 2.0 21 1.5 22 1.0 23 1.5 24 1.5 25 3.0 26 2.5 27 5.5 28 11.0 29 15.0 30 15.5 31 14.0 32 21.0 33 31.5 34 41.5 35 53.0 36 62.0 37 69.0 38 94.5 39 130.5 40 153.5 41 172.5 42 198.5 43 208.0 44 201.5 45 198.5 46 202.0 47 186.5 48 175.0 49 165.5 50 153.0 51 144.5 52 128.5 53 117.5 54 99.5 55 83.5 56 73.5 57 73.5 58 64.5 59 53.5 60 58.0 61 56.5 62 44.5 63 44.5 64 40.0 65 34.0 66 32.0 67 28.0 68 24.0 69 23.0 70 27.0 71 24.0 72 16.5 73 12.0 74 14.5 75 13.5 76 8.5 77 5.5 78 3.5 79 1.5 80 1.5 81 1.5 82 1.0 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-11 0.0125 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.05 20-21 0.05 22-23 0.025 24-25 0.025 26-27 0.0125 28-29 0.0125 30-31 0.0 32-33 0.0125 34-35 0.0125 36-37 0.0125 38-39 0.025 40-41 0.025 42-43 0.025 44-45 0.025 46-47 0.025 48-49 0.025 50-51 0.025 52-53 0.0125 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0125 70-71 0.0 72-73 0.025 74-75 0.025 76-77 0.025 78-79 0.0125 80-81 0.025 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.71597329224447 96.1 2 0.8731381612737544 1.7000000000000002 3 0.17976373908577298 0.525 4 0.1027221366204417 0.4 5 0.025680534155110426 0.125 6 0.05136106831022085 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05136106831022085 0.8500000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 24 0.6 No Hit TCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 10 0.25 No Hit TCTTCGTATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 6 0.15 No Hit TCTTCTTATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 6 0.15 No Hit TGGGGGTGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.037500000000000006 0.0 0.0 0.0 0.0 26-27 0.07500000000000001 0.0 0.0 0.0 0.0 28-29 0.1375 0.0 0.0 0.0 0.0 30-31 0.1875 0.0 0.0 0.0 0.0 32-33 0.21250000000000002 0.0 0.0 0.0 0.0 34-35 0.25 0.0 0.0 0.0 0.0 36-37 0.2625 0.0 0.0 0.0 0.0 38-39 0.3125 0.0 0.0 0.0 0.0 40-41 0.3625 0.0 0.0 0.0 0.0 42-43 0.4125 0.0 0.0 0.0 0.0 44-45 0.4625 0.0 0.0 0.0 0.0 46-47 0.4875 0.0 0.0 0.0 0.0 48-49 0.5875 0.0 0.0 0.0 0.0 50-51 0.7250000000000001 0.0 0.0 0.0 0.0 52-53 0.8625 0.0 0.0 0.0 0.0 54-55 1.075 0.0 0.0 0.0 0.0 56-57 1.2125 0.0 0.0 0.0 0.0 58-59 1.275 0.0 0.0 0.0 0.0 60-61 1.3625 0.0 0.0 0.0 0.0 62-63 1.5125000000000002 0.0 0.0 0.0 0.0 64-65 1.75 0.0 0.0 0.0 0.0 66-67 1.9 0.0 0.0 0.0 0.0 68-69 2.1875 0.0 0.0 0.0 0.0 70-71 2.425 0.0 0.0 0.0 0.0 72-73 2.7625 0.0 0.0 0.0 0.0 74-75 3.15 0.0 0.0 0.0 0.0 76-77 3.55 0.0 0.0 0.0 0.0 78-79 4.0625 0.0 0.0 0.0 0.0 80-81 4.5625 0.0 0.0 0.0 0.0 82-83 5.074999999999999 0.0 0.0 0.0 0.0 84-85 5.45 0.0 0.0 0.0 0.0 86-87 5.85 0.0 0.0 0.0 0.0 88-89 6.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1931160 spots for ERR3317448.sra Written 1931160 spots for ERR3317448.sra Read 1931160 spots for ERR3317448.sra Written 1931160 spots for ERR3317448.sra Read 1931160 spots for ERR3317448.sra Written 1931160 spots for ERR3317448.sra Read 1931160 spots for ERR3317448.sra Written 1931160 spots for ERR3317448.sra Read 1931160 spots for ERR3317448.sra Written 1931160 spots for ERR3317448.sra Read 1931160 spots for ERR3317448.sra Written 1931160 spots for ERR3317448.sra Read 1931166 spots for ERR3317448.sra Written 1931166 spots for ERR3317448.sra Read 1931160 spots for ERR3317448.sra Written 1931160 spots for ERR3317448.sra Read 1931160 spots for ERR3317448.sra Written 1931160 spots for ERR3317448.sra Read 1931160 spots for ERR3317448.sra Written 1931160 spots for ERR3317448.sra Read 1931160 spots for ERR3317448.sra Written 1931160 spots for ERR3317448.sra Read 1931160 spots for ERR3317448.sra Written 1931160 spots for ERR3317448.sra Read 1931160 spots for ERR3317448.sra Written 1931160 spots for ERR3317448.sra Read 1931160 spots for ERR3317448.sra Written 1931160 spots for ERR3317448.sra Read 1931160 spots for ERR3317448.sra Written 1931160 spots for ERR3317448.sra Read 1931160 spots for ERR3317448.sra Written 1931160 spots for ERR3317448.sra Read 1931160 spots for ERR3317448.sra Written 1931160 spots for ERR3317448.sra Read 1931160 spots for ERR3317448.sra Written 1931160 spots for ERR3317448.sra Read 1931160 spots for ERR3317448.sra Written 1931160 spots for ERR3317448.sra Read 1931160 spots for ERR3317448.sra Written 1931160 spots for ERR3317448.sra SRR ids: ['ERR3317448.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ai07x3un ERR3317448.sra spots: 38623206 blocks: [[1, 1931160], [1931161, 3862320], [3862321, 5793480], [5793481, 7724640], [7724641, 9655800], [9655801, 11586960], [11586961, 13518120], [13518121, 15449280], [15449281, 17380440], [17380441, 19311600], [19311601, 21242760], [21242761, 23173920], [23173921, 25105080], [25105081, 27036240], [27036241, 28967400], [28967401, 30898560], [30898561, 32829720], [32829721, 34760880], [34760881, 36692040], [36692041, 38623206]] ERR3317448 file size 9294639 ERR3317448 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317448 ERR3317448_1.fastq ERR3317448_2.fastq Input file: ERR3317448_1.fastq Paired file: ERR3317448_2.fastq trimmed: ERR3317448-trimmed-pair1.fastq, ERR3317448-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 03:39:07 2024 >> started Thu Dec 12 03:39:44 2024 >> done (37.359s) 38623206 read pairs processed; of these: 259252 ( 0.67%) short read pairs filtered out after trimming by size control 646807 ( 1.67%) empty read pairs filtered out after trimming by size control 37717147 (97.65%) read pairs available; of these: 11186520 (29.66%) trimmed read pairs available after processing 26530627 (70.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 778 0.00% 19 849 0.00% 20 1105 0.00% 21 1414 0.00% 22 1740 0.00% 23 2460 0.01% 24 3090 0.01% 25 3669 0.01% 26 4281 0.01% 27 5136 0.01% 28 5559 0.01% 29 6697 0.02% 30 7542 0.02% 31 10688 0.03% 32 9597 0.03% 33 9864 0.03% 34 11476 0.03% 35 12092 0.03% 36 13572 0.04% 37 14235 0.04% 38 17128 0.05% 39 17304 0.05% 40 17652 0.05% 41 19521 0.05% 42 20766 0.06% 43 21376 0.06% 44 22805 0.06% 45 23673 0.06% 46 24945 0.07% 47 29113 0.08% 48 29816 0.08% 49 30650 0.08% 50 34522 0.09% 51 34456 0.09% 52 36047 0.10% 53 40857 0.11% 54 44173 0.12% 55 46189 0.12% 56 47794 0.13% 57 49920 0.13% 58 55052 0.15% 59 69649 0.18% 60 82475 0.22% 61 87993 0.23% 62 94012 0.25% 63 98847 0.26% 64 106126 0.28% 65 112446 0.30% 66 122582 0.33% 67 122268 0.32% 68 123860 0.33% 69 128337 0.34% 70 131681 0.35% 71 136897 0.36% 72 143275 0.38% 73 150597 0.40% 74 149355 0.40% 75 148192 0.39% 76 150682 0.40% 77 159070 0.42% 78 171075 0.45% 79 167718 0.44% 80 173767 0.46% 81 178485 0.47% 82 179352 0.48% 83 187996 0.50% 84 201789 0.54% 85 198538 0.53% 86 206820 0.55% 87 217229 0.58% 88 219641 0.58% 89 261493 0.69% 90 234408 0.62% 91 246526 0.65% 92 259138 0.69% 93 280727 0.74% 94 304145 0.81% 95 327594 0.87% 96 362130 0.96% 97 439162 1.16% 98 535499 1.42% 99 747645 1.98% 100 1977696 5.24% 101 26530627 70.34% 37717147 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=3.25 fanout-score-rank=17 prefix-density=0.64 prefix-fanout=2.8 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=93.17 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=2.6 sequence=ACAACACCAGCCACCAGCTCATCTCTCACTGACCTTACCACTTGAATTGGGATCGAAATGGCCGCGTCGGCGCTGCACCAGACCACCAGCTTCCTCGGCACCGCCCCACGCCGCGATGACCTCGTCCGCAGCGTCGGCGACTTCGGCGGCCGCATCAC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=24 prefix-density=0.36 prefix-fanout=2.2 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCT criterion=fanout-score sequence-density=0.06 sequence-density-rank=20 fanout-score=101.46 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=12.1 sequence=CCTTCTTCTCCGGGTCC ERR3317448 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 03:40:17 Started mapping on | Dec 12 03:40:17 Finished on | Dec 12 03:41:59 Mapping speed, Million of reads per hour | 1331.19 Number of input reads | 37717147 Average input read length | 192 UNIQUE READS: Uniquely mapped reads number | 33673631 Uniquely mapped reads % | 89.28% Average mapped length | 191.38 Number of splices: Total | 20616100 Number of splices: Annotated (sjdb) | 19576486 Number of splices: GT/AG | 20311200 Number of splices: GC/AG | 273356 Number of splices: AT/AC | 13914 Number of splices: Non-canonical | 17630 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.00% Deletion average length | 1.22 Insertion rate per base | 0.00% Insertion average length | 1.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2858283 % of reads mapped to multiple loci | 7.58% Number of reads mapped to too many loci | 70381 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.81% % of reads unmapped: other | 1.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1358256 1358256 1358256 N_multimapping 2858283 2858283 2858283 N_noFeature 1302821 2516182 31746004 N_ambiguous 1037152 350041 14745 UnstrandedReadsAssigned:31333658 PositiveStrandReadsAssigned:30807408 NegativeStrandReadsAssigned:1912882 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 ERR3317448 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317448-trimmed-pair1.fastq ERR3317448-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,717,147 reads, 33,140,263 reads pseudoaligned [quant] estimated average fragment length: 192.832 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,197 rounds 52973 ERR3317448.ke.tsv 35125 ERR3317448.se.tsv 88098 total ==> ERR3317448.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 744.495 0 0 PNS24247 1044 852.168 45.8483 2.45363 PNS24249 1928 1736.17 103.832 2.72742 PNS24246 1044 852.168 45.8483 2.45363 PNS24248 1044 852.168 45.8483 2.45363 PNS24244 1471 1279.17 196.623 7.01 PNS24243 293 130.638 2 0.698188 KQK14069 1603 1411.17 10848 350.575 KQK14071 474 290.249 74.8847 11.7661 ==> ERR3317448.se.tsv <== BRADI_1g14170v3 13491 BRADI_1g53295v3 129 BRADI_1g59795v3 1275 BRADI_1g07683v3 0 BRADI_1g00485v3 158 BRADI_1g20270v3 3156 BRADI_1g74790v3 273 BRADI_1g09890v3 14 BRADI_1g77505v3 369 BRADI_1g48960v3 1 ERR3317448 completed mapping pipeline successfully