Starting /dee2/code/volunteer_pipeline.sh ERR3317449 current disk space = 1524966375424 free memory = 1597879808 ERR3317449 SRAfilesize 4e72bffe247b086288d6c2202bca19d2 ERR3317449.sra ERR3317449.sra file validated ERR3317449 is paired end ERR3317449 is conventional basespace ERR3317449 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317449_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.51325 34.0 31.0 34.0 30.0 34.0 2 32.33575 34.0 31.0 34.0 31.0 34.0 3 32.9165 34.0 33.0 34.0 31.0 34.0 4 36.41775 37.0 37.0 37.0 35.0 37.0 5 36.4135 37.0 37.0 37.0 35.0 37.0 6 36.41775 37.0 37.0 37.0 35.0 37.0 7 36.44725 37.0 37.0 37.0 35.0 37.0 8 36.442 37.0 37.0 37.0 35.0 37.0 9 38.2565 39.0 39.0 39.0 37.0 39.0 10-11 38.284125 39.0 39.0 39.0 37.0 39.0 12-13 38.23350000000001 39.0 39.0 39.0 37.0 39.0 14-15 39.724625 41.0 40.0 41.0 37.5 41.0 16-17 39.7375 41.0 40.0 41.0 37.5 41.0 18-19 39.722875 41.0 40.0 41.0 37.0 41.0 20-21 39.624625 41.0 40.0 41.0 37.0 41.0 22-23 39.502875 41.0 39.5 41.0 37.0 41.0 24-25 39.503125 41.0 40.0 41.0 37.0 41.0 26-27 39.3515 41.0 40.0 41.0 36.0 41.0 28-29 39.175875000000005 41.0 39.0 41.0 36.0 41.0 30-31 39.015 40.5 39.0 41.0 35.0 41.0 32-33 38.75575 40.0 38.5 41.0 34.5 41.0 34-35 38.60525 40.0 38.0 41.0 35.0 41.0 36-37 38.525999999999996 40.0 38.0 41.0 34.0 41.0 38-39 38.1425 40.0 38.0 41.0 33.0 41.0 40-41 37.922375 40.0 38.0 41.0 33.0 41.0 42-43 37.978125000000006 40.0 38.0 41.0 33.0 41.0 44-45 37.680125000000004 40.0 37.0 41.0 32.5 41.0 46-47 37.627250000000004 40.0 37.0 41.0 32.5 41.0 48-49 37.263125 40.0 36.0 41.0 32.0 41.0 50-51 37.592875 40.0 36.0 41.0 33.0 41.0 52-53 37.419375 40.0 36.0 41.0 33.0 41.0 54-55 37.047875000000005 39.5 35.0 41.0 32.0 41.0 56-57 36.8225 39.0 35.0 41.0 32.0 41.0 58-59 36.528875 39.0 35.0 41.0 31.5 41.0 60-61 36.156375 38.0 35.0 41.0 31.0 41.0 62-63 35.801 37.0 35.0 40.0 30.5 41.0 64-65 35.35 37.0 35.0 40.0 30.0 41.0 66-67 35.12625 36.0 35.0 39.0 30.0 41.0 68-69 34.78525 35.5 35.0 39.0 30.0 41.0 70-71 34.372625 35.0 34.0 38.0 30.0 40.0 72-73 33.822 35.0 34.0 37.0 29.0 39.0 74-75 33.437625 35.0 34.0 36.5 29.0 39.0 76-77 32.269875 34.5 32.5 35.5 26.0 37.0 78-79 32.6185 35.0 33.0 36.0 27.0 37.0 80-81 32.430875 35.0 33.0 35.0 26.5 37.0 82-83 32.231375 35.0 33.0 35.0 26.5 36.5 84-85 31.87975 35.0 33.0 35.0 25.0 36.0 86-87 31.717125 35.0 33.0 35.0 25.0 36.0 88-89 31.532249999999998 35.0 33.0 35.0 24.5 36.0 90-91 31.289625 35.0 33.0 35.0 24.0 35.0 92-93 30.957 35.0 32.0 35.0 20.0 35.0 94-95 30.76625 35.0 32.0 35.0 20.0 35.0 96-97 30.483 35.0 32.0 35.0 14.5 35.0 98-99 29.989875 35.0 31.5 35.0 2.0 35.0 100-101 27.7435 33.0 27.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 1.0 9 4.0 10 2.0 11 3.0 12 11.0 13 8.0 14 6.0 15 8.0 16 16.0 17 9.0 18 9.0 19 13.0 20 7.0 21 15.0 22 17.0 23 18.0 24 29.0 25 24.0 26 36.0 27 21.0 28 42.0 29 57.0 30 63.0 31 75.0 32 86.0 33 119.0 34 184.0 35 291.0 36 572.0 37 1048.0 38 1071.0 39 133.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.056050288108956 26.03457307490833 19.905709795704556 27.003666841278157 2 26.224999999999998 24.7 19.6 29.475 3 26.450000000000003 26.075 18.725 28.749999999999996 4 26.825 27.0 16.925 29.25 5 28.325 25.650000000000002 15.975 30.049999999999997 6 28.975 27.3 18.2 25.525 7 30.95 24.275 21.15 23.625 8 31.75 26.200000000000003 23.45 18.6 9 32.35 26.6 23.95 17.1 10-11 32.5625 26.7125 21.625 19.1 12-13 30.1375 26.337500000000002 23.599999999999998 19.925 14-15 28.1875 26.55 24.425 20.837500000000002 16-17 26.700000000000003 26.5375 24.462500000000002 22.3 18-19 26.025 27.187499999999996 25.074999999999996 21.712500000000002 20-21 25.7 27.35 25.0375 21.912499999999998 22-23 26.1625 26.05 24.65 23.1375 24-25 25.5375 26.775 25.974999999999998 21.712500000000002 26-27 25.5625 26.450000000000003 24.925 23.0625 28-29 25.974999999999998 25.687500000000004 25.4 22.9375 30-31 25.587500000000002 26.55 25.75 22.112499999999997 32-33 24.8125 26.35 25.662499999999998 23.175 34-35 25.324999999999996 26.325 24.887500000000003 23.4625 36-37 25.374999999999996 26.0625 26.174999999999997 22.3875 38-39 25.525 26.0 25.662499999999998 22.8125 40-41 26.8375 25.2125 25.337500000000002 22.6125 42-43 25.474999999999998 26.125 25.650000000000002 22.75 44-45 25.275 26.787499999999998 25.35 22.5875 46-47 26.6125 25.624999999999996 24.5375 23.225 48-49 25.924999999999997 26.237500000000004 24.9125 22.925 50-51 25.5375 26.6125 24.6875 23.1625 52-53 25.7 28.012500000000003 23.8125 22.475 54-55 25.412499999999998 26.575 25.324999999999996 22.6875 56-57 24.6 27.0875 25.25 23.0625 58-59 25.674999999999997 26.937499999999996 24.775 22.6125 60-61 25.624999999999996 26.5875 25.087500000000002 22.7 62-63 24.375 26.8 25.362499999999997 23.4625 64-65 25.474999999999998 27.150000000000002 24.7375 22.6375 66-67 25.0625 27.875 24.575 22.4875 68-69 24.725 27.487499999999997 24.962500000000002 22.825 70-71 26.05 26.8375 23.225 23.8875 72-73 25.8 27.187499999999996 25.087500000000002 21.925 74-75 25.575 27.287499999999998 24.375 22.7625 76-77 25.474999999999998 26.35 24.1125 24.0625 78-79 25.4375 27.375 23.825 23.3625 80-81 25.650000000000002 27.487499999999997 24.3875 22.475 82-83 25.624999999999996 26.8125 24.75 22.8125 84-85 25.124999999999996 27.325 24.9375 22.6125 86-87 25.112499999999997 27.075 23.8875 23.925 88-89 24.9875 27.712500000000002 23.875 23.425 90-91 25.724999999999998 27.575 24.337500000000002 22.3625 92-93 25.687500000000004 27.0125 24.3625 22.9375 94-95 25.5 27.2625 24.15 23.0875 96-97 25.7125 27.0125 24.5375 22.7375 98-99 25.2625 27.675 24.087500000000002 22.975 100-101 25.5375 27.3625 23.075000000000003 24.025 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.5 5 1.0 6 0.5 7 1.0 8 1.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 1.5 17 4.5 18 4.0 19 1.5 20 1.0 21 0.5 22 0.5 23 1.5 24 2.0 25 4.5 26 4.0 27 3.5 28 7.0 29 11.0 30 10.0 31 11.0 32 15.0 33 20.0 34 25.5 35 34.5 36 53.0 37 61.5 38 78.0 39 106.5 40 125.0 41 153.0 42 166.0 43 161.5 44 188.0 45 204.0 46 202.0 47 201.5 48 198.0 49 176.5 50 157.5 51 156.0 52 149.5 53 138.0 54 116.0 55 93.5 56 84.0 57 90.5 58 80.0 59 65.5 60 71.0 61 57.5 62 47.0 63 49.5 64 51.0 65 51.0 66 41.0 67 34.5 68 33.5 69 32.0 70 26.5 71 22.5 72 17.5 73 16.5 74 15.0 75 11.5 76 8.0 77 4.0 78 6.0 79 7.5 80 4.0 81 2.0 82 3.5 83 3.5 84 1.5 85 1.0 86 2.0 87 2.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.875 #Duplication Level Percentage of deduplicated Percentage of total 1 98.46743295019157 96.375 2 1.2005108556832695 2.35 3 0.15325670498084293 0.44999999999999996 4 0.1277139208173691 0.5 5 0.0 0.0 6 0.02554278416347382 0.15 7 0.02554278416347382 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTTAACTGGGGGATTCACCGCAAATACTACTTTGGCTCATTATTGCCGC 7 0.17500000000000002 No Hit AGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCGAGTTCGCGCCGG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.0875 0.0 0.0 0.0 0.0 24-25 0.1125 0.0 0.0 0.0 0.0 26-27 0.15 0.0 0.0 0.0 0.0 28-29 0.16249999999999998 0.0 0.0 0.0 0.0 30-31 0.2 0.0 0.0 0.0 0.0 32-33 0.275 0.0 0.0 0.0 0.0 34-35 0.35 0.0 0.0 0.0 0.0 36-37 0.44999999999999996 0.0 0.0 0.0 0.0 38-39 0.55 0.0 0.0 0.0 0.0 40-41 0.675 0.0 0.0 0.0 0.0 42-43 0.8125 0.0 0.0 0.0 0.0 44-45 0.9 0.0 0.0 0.0 0.0 46-47 0.9874999999999999 0.0 0.0 0.0 0.0 48-49 1.0750000000000002 0.0 0.0 0.0 0.0 50-51 1.2875 0.0 0.0 0.0 0.0 52-53 1.5 0.0 0.0 0.0 0.0 54-55 1.725 0.0 0.0 0.0 0.0 56-57 1.9125 0.0 0.0 0.0 0.0 58-59 2.0875 0.0 0.0 0.0 0.0 60-61 2.425 0.0 0.0 0.0 0.0 62-63 2.825 0.0 0.0 0.0 0.0 64-65 3.2249999999999996 0.0 0.0 0.0 0.0 66-67 3.575 0.0 0.0 0.0 0.0 68-69 3.8875 0.0 0.0 0.0 0.0 70-71 4.225 0.0 0.0 0.0 0.0 72-73 4.6875 0.0 0.0 0.0 0.0 74-75 5.175 0.0 0.0 0.0 0.0 76-77 5.725 0.0 0.0 0.0 0.0 78-79 6.225 0.0 0.0 0.0 0.0 80-81 6.737500000000001 0.0 0.0 0.0 0.0 82-83 7.25 0.0 0.0 0.0 0.0 84-85 7.7125 0.0 0.0 0.0 0.0 86-87 8.15 0.0 0.0 0.0 0.0 88-89 8.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317449 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317449_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.891 33.0 31.0 34.0 30.0 34.0 2 31.824 34.0 31.0 34.0 30.0 34.0 3 31.68725 34.0 31.0 34.0 30.0 34.0 4 35.111 37.0 35.0 37.0 32.0 37.0 5 35.28775 37.0 35.0 37.0 33.0 37.0 6 35.37925 37.0 35.0 37.0 35.0 37.0 7 35.51475 37.0 36.0 37.0 35.0 37.0 8 35.5425 37.0 37.0 37.0 35.0 37.0 9 37.2655 39.0 39.0 39.0 35.0 39.0 10-11 37.406875 39.0 39.0 39.0 35.0 39.0 12-13 37.342375 39.0 39.0 39.0 35.0 39.0 14-15 38.779125 41.0 40.0 41.0 36.0 41.0 16-17 38.786625 41.0 40.0 41.0 36.0 41.0 18-19 38.70075 41.0 40.0 41.0 35.0 41.0 20-21 38.710125 41.0 40.0 41.0 35.0 41.0 22-23 38.640249999999995 41.0 39.5 41.0 35.0 41.0 24-25 38.54475 41.0 39.5 41.0 35.0 41.0 26-27 38.438500000000005 41.0 39.0 41.0 35.0 41.0 28-29 38.360375 41.0 39.0 41.0 35.0 41.0 30-31 38.288624999999996 41.0 39.0 41.0 34.5 41.0 32-33 38.13612500000001 40.5 38.5 41.0 34.5 41.0 34-35 38.016375 40.0 38.0 41.0 34.0 41.0 36-37 37.873000000000005 40.0 38.0 41.0 34.0 41.0 38-39 37.760374999999996 40.0 38.0 41.0 33.0 41.0 40-41 37.907250000000005 40.0 38.0 41.0 33.5 41.0 42-43 37.781 40.5 38.0 41.0 34.0 41.0 44-45 37.664874999999995 40.0 38.0 41.0 33.0 41.0 46-47 37.459875 40.0 38.0 41.0 33.0 41.0 48-49 37.289125 40.0 37.0 41.0 33.0 41.0 50-51 36.618125 39.5 36.0 40.5 32.0 41.0 52-53 36.416 39.5 35.5 40.5 31.0 41.0 54-55 36.519375 40.0 35.0 41.0 30.5 41.0 56-57 36.413 39.5 35.0 41.0 31.0 41.0 58-59 36.23625 39.0 35.0 41.0 31.0 41.0 60-61 35.938625 39.0 35.0 41.0 30.0 41.0 62-63 35.559625 38.0 35.0 40.5 29.5 41.0 64-65 35.28325 37.5 35.0 40.0 29.0 41.0 66-67 35.248625000000004 37.0 35.0 40.0 30.0 41.0 68-69 34.9155 37.0 35.0 39.5 30.0 41.0 70-71 34.652875 36.0 35.0 39.0 30.0 41.0 72-73 34.3 36.0 35.0 39.0 29.5 40.5 74-75 33.893 35.0 35.0 37.0 29.0 39.5 76-77 33.529875000000004 35.0 34.5 37.0 29.0 39.0 78-79 33.23725 35.0 34.0 36.5 29.0 39.0 80-81 32.899625 35.0 34.0 36.0 29.0 37.0 82-83 32.596000000000004 35.0 34.0 36.0 27.5 37.0 84-85 32.420249999999996 35.0 34.0 35.0 27.5 36.5 86-87 32.261875 35.0 34.0 35.0 27.5 36.0 88-89 32.04075 35.0 34.0 35.0 27.0 36.0 90-91 31.82775 35.0 34.0 35.0 25.5 36.0 92-93 31.665625 35.0 33.5 35.0 24.5 35.5 94-95 31.573625 35.0 33.0 35.0 25.0 35.0 96-97 31.343125 35.0 33.0 35.0 24.0 35.0 98-99 31.055625 35.0 33.0 35.0 21.5 35.0 100-101 29.303874999999998 33.5 30.0 35.0 10.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 71.0 3 10.0 4 5.0 5 2.0 6 3.0 7 3.0 8 2.0 9 8.0 10 3.0 11 5.0 12 9.0 13 13.0 14 7.0 15 5.0 16 8.0 17 10.0 18 8.0 19 13.0 20 6.0 21 10.0 22 7.0 23 7.0 24 16.0 25 14.0 26 15.0 27 31.0 28 22.0 29 28.0 30 41.0 31 52.0 32 61.0 33 103.0 34 152.0 35 274.0 36 408.0 37 901.0 38 1403.0 39 264.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.875 11.375 31.55 28.199999999999996 2 26.075 10.15 26.450000000000003 37.325 3 22.275 12.075 30.099999999999998 35.55 4 24.0 11.525 28.425 36.05 5 25.525 13.575000000000001 24.25 36.65 6 24.325 18.575 31.025000000000002 26.075 7 19.15 23.45 39.2 18.2 8 18.7 24.15 36.025 21.125 9 18.825 27.150000000000002 34.225 19.8 10-11 19.61740435108777 27.031757939484873 32.495623905976494 20.855213803450862 12-13 19.959979989995 27.43871935967984 31.56578289144572 21.03551775887944 14-15 20.30761535575841 26.172314617981744 30.661498061773163 22.858571964486682 16-17 20.810405202601302 25.30015007503752 29.389694847423716 24.499749874937468 18-19 20.515386539904927 26.332249186890166 30.022516887665752 23.129847385539154 20-21 20.675422138836772 24.36522826766729 30.34396497811132 24.615384615384617 22-23 21.22045767162686 24.0090033762661 29.58609478554458 25.184444166562457 24-25 20.155038759689923 26.281570392598148 30.095023755938982 23.468367091772944 26-27 20.305076269067268 26.51912978244561 29.057264316079017 24.118529632408105 28-29 21.075 26.0375 27.224999999999998 25.662499999999998 30-31 21.475 25.974999999999998 28.625 23.925 32-33 21.675 25.55 27.787499999999998 24.9875 34-35 21.85 24.95 27.3625 25.837500000000002 36-37 21.725 26.187500000000004 27.525 24.5625 38-39 21.848424212106053 25.887943971985994 27.026013006503252 25.237618809404704 40-41 22.48062015503876 24.956239059764943 27.131782945736433 25.431357839459867 42-43 21.898449224612307 26.613306653326664 26.40070035017509 25.087543771885944 44-45 22.061030515257627 26.450725362681343 25.975487743871934 25.512756378189096 46-47 21.260630315157577 25.912956478239117 27.026013006503252 25.80040020010005 48-49 21.54288572143036 26.819204801200303 27.294323580895224 24.343585896474117 50-51 22.55563890972743 25.456364091022753 26.79419854963741 25.1937984496124 52-53 22.6 24.962500000000002 26.575 25.8625 54-55 21.3875 25.7125 27.5875 25.3125 56-57 21.775 25.474999999999998 27.55 25.2 58-59 22.1875 25.924999999999997 26.9625 24.925 60-61 21.087500000000002 26.700000000000003 27.9375 24.275 62-63 23.125 25.112499999999997 26.75 25.0125 64-65 22.412499999999998 25.162499999999998 27.2625 25.162499999999998 66-67 22.2125 25.7625 27.6375 24.3875 68-69 23.1125 25.8625 26.25 24.775 70-71 22.4375 26.3625 25.95 25.25 72-73 23.068267066766694 25.63140785196299 26.44411102775694 24.85621405351338 74-75 22.343085771442862 26.04401100275069 27.806951737934483 23.80595148787197 76-77 23.674999999999997 25.637500000000003 25.6125 25.074999999999996 78-79 22.6125 26.474999999999998 26.5625 24.349999999999998 80-81 22.6875 26.2125 26.1 25.0 82-83 23.724999999999998 25.2625 25.324999999999996 25.687500000000004 84-85 24.25 26.3625 25.2125 24.175 86-87 24.8125 25.374999999999996 25.687500000000004 24.125 88-89 23.7875 26.400000000000002 25.650000000000002 24.1625 90-91 24.2375 26.187500000000004 25.937500000000004 23.6375 92-93 23.95 25.45 26.75 23.849999999999998 94-95 24.1375 25.924999999999997 25.7125 24.224999999999998 96-97 24.8625 27.474999999999998 24.9375 22.725 98-99 24.675 27.212500000000002 24.762500000000003 23.35 100-101 24.887500000000003 26.1 24.95 24.0625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 22.0 1 14.5 2 4.5 3 3.0 4 2.0 5 0.0 6 0.5 7 2.0 8 2.5 9 2.0 10 3.0 11 3.5 12 2.0 13 1.5 14 2.0 15 1.5 16 2.0 17 3.0 18 2.0 19 1.0 20 2.0 21 4.5 22 4.5 23 2.5 24 4.0 25 4.5 26 4.5 27 5.5 28 6.0 29 9.5 30 13.0 31 17.5 32 19.0 33 27.0 34 42.5 35 49.5 36 61.5 37 76.5 38 89.5 39 111.5 40 138.0 41 183.5 42 211.5 43 212.5 44 207.5 45 202.5 46 206.5 47 179.0 48 159.0 49 163.5 50 145.0 51 131.0 52 134.0 53 123.0 54 107.0 55 94.0 56 85.5 57 78.0 58 67.5 59 57.0 60 54.5 61 54.0 62 41.5 63 36.5 64 38.5 65 34.5 66 32.5 67 31.0 68 26.0 69 23.0 70 25.5 71 22.5 72 15.5 73 12.0 74 10.5 75 8.5 76 5.5 77 5.5 78 4.0 79 2.0 80 2.0 81 3.0 82 2.0 83 1.0 84 0.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.5 96 1.0 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.025 12-13 0.05 14-15 0.0375 16-17 0.05 18-19 0.075 20-21 0.0625 22-23 0.0375 24-25 0.025 26-27 0.025 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.05 40-41 0.025 42-43 0.05 44-45 0.05 46-47 0.05 48-49 0.025 50-51 0.025 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.025 74-75 0.025 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.375 #Duplication Level Percentage of deduplicated Percentage of total 1 98.87034659820283 96.275 2 0.7958921694480102 1.55 3 0.10269576379974327 0.3 4 0.12836970474967907 0.5 5 0.025673940949935817 0.125 6 0.0 0.0 7 0.025673940949935817 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.051347881899871634 1.075 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 32 0.8 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 11 0.27499999999999997 No Hit TCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 7 0.17500000000000002 No Hit TCTTCCTATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.0875 0.0 0.0 0.0 0.0 24-25 0.1125 0.0 0.0 0.0 0.0 26-27 0.15 0.0 0.0 0.0 0.0 28-29 0.175 0.0 0.0 0.0 0.0 30-31 0.225 0.0 0.0 0.0 0.0 32-33 0.30000000000000004 0.0 0.0 0.0 0.0 34-35 0.375 0.0 0.0 0.0 0.0 36-37 0.4625 0.0 0.0 0.0 0.0 38-39 0.5625 0.0 0.0 0.0 0.0 40-41 0.7 0.0 0.0 0.0 0.0 42-43 0.825 0.0 0.0 0.0 0.0 44-45 0.925 0.0 0.0 0.0 0.0 46-47 1.0375 0.0 0.0 0.0 0.0 48-49 1.125 0.0 0.0 0.0 0.0 50-51 1.3375 0.0 0.0 0.0 0.0 52-53 1.55 0.0 0.0 0.0 0.0 54-55 1.75 0.0 0.0 0.0 0.0 56-57 1.9375 0.0 0.0 0.0 0.0 58-59 2.15 0.0 0.0 0.0 0.0 60-61 2.5 0.0 0.0 0.0 0.0 62-63 2.8875 0.0 0.0 0.0 0.0 64-65 3.325 0.0 0.0 0.0 0.0 66-67 3.675 0.0 0.0 0.0 0.0 68-69 3.975 0.0 0.0 0.0 0.0 70-71 4.300000000000001 0.0 0.0 0.0 0.0 72-73 4.725 0.0 0.0 0.0 0.0 74-75 5.2 0.0 0.0 0.0 0.0 76-77 5.725 0.0 0.0 0.0 0.0 78-79 6.2 0.0 0.0 0.0 0.0 80-81 6.7125 0.0 0.0 0.0 0.0 82-83 7.225 0.0 0.0 0.0 0.0 84-85 7.6875 0.0 0.0 0.0 0.0 86-87 8.125 0.0 0.0 0.0 0.0 88-89 8.649999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1984692 spots for ERR3317449.sra Written 1984692 spots for ERR3317449.sra Read 1984692 spots for ERR3317449.sra Written 1984692 spots for ERR3317449.sra Read 1984692 spots for ERR3317449.sra Written 1984692 spots for ERR3317449.sra Read 1984692 spots for ERR3317449.sra Written 1984692 spots for ERR3317449.sra Read 1984692 spots for ERR3317449.sra Written 1984692 spots for ERR3317449.sra Read 1984692 spots for ERR3317449.sra Written 1984692 spots for ERR3317449.sra Read 1984692 spots for ERR3317449.sra Written 1984692 spots for ERR3317449.sra Read 1984692 spots for ERR3317449.sra Written 1984692 spots for ERR3317449.sra Read 1984697 spots for ERR3317449.sra Written 1984697 spots for ERR3317449.sra Read 1984692 spots for ERR3317449.sra Written 1984692 spots for ERR3317449.sra Read 1984692 spots for ERR3317449.sra Written 1984692 spots for ERR3317449.sra Read 1984692 spots for ERR3317449.sra Written 1984692 spots for ERR3317449.sra Read 1984692 spots for ERR3317449.sra Written 1984692 spots for ERR3317449.sra Read 1984692 spots for ERR3317449.sra Written 1984692 spots for ERR3317449.sra Read 1984692 spots for ERR3317449.sra Written 1984692 spots for ERR3317449.sra Read 1984692 spots for ERR3317449.sra Written 1984692 spots for ERR3317449.sra Read 1984692 spots for ERR3317449.sra Written 1984692 spots for ERR3317449.sra Read 1984692 spots for ERR3317449.sra Written 1984692 spots for ERR3317449.sra Read 1984692 spots for ERR3317449.sra Written 1984692 spots for ERR3317449.sra Read 1984692 spots for ERR3317449.sra Written 1984692 spots for ERR3317449.sra SRR ids: ['ERR3317449.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0yskbpc6 ERR3317449.sra spots: 39693845 blocks: [[1, 1984692], [1984693, 3969384], [3969385, 5954076], [5954077, 7938768], [7938769, 9923460], [9923461, 11908152], [11908153, 13892844], [13892845, 15877536], [15877537, 17862228], [17862229, 19846920], [19846921, 21831612], [21831613, 23816304], [23816305, 25800996], [25800997, 27785688], [27785689, 29770380], [29770381, 31755072], [31755073, 33739764], [33739765, 35724456], [35724457, 37709148], [37709149, 39693845]] ERR3317449 file size 9552889 ERR3317449 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317449 ERR3317449_1.fastq ERR3317449_2.fastq Input file: ERR3317449_1.fastq Paired file: ERR3317449_2.fastq trimmed: ERR3317449-trimmed-pair1.fastq, ERR3317449-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:49:15 2024 >> started Tue Dec 10 09:49:59 2024 >> done (43.833s) 39693845 read pairs processed; of these: 256721 ( 0.65%) short read pairs filtered out after trimming by size control 660794 ( 1.66%) empty read pairs filtered out after trimming by size control 38776330 (97.69%) read pairs available; of these: 12134596 (31.29%) trimmed read pairs available after processing 26641734 (68.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1285 0.00% 19 1403 0.00% 20 2040 0.01% 21 2408 0.01% 22 2899 0.01% 23 4007 0.01% 24 4718 0.01% 25 5718 0.01% 26 6495 0.02% 27 7879 0.02% 28 8495 0.02% 29 9950 0.03% 30 10952 0.03% 31 15311 0.04% 32 14659 0.04% 33 15213 0.04% 34 17709 0.05% 35 18271 0.05% 36 19860 0.05% 37 20908 0.05% 38 24161 0.06% 39 25595 0.07% 40 26048 0.07% 41 27948 0.07% 42 29572 0.08% 43 31214 0.08% 44 33401 0.09% 45 34377 0.09% 46 36659 0.09% 47 42101 0.11% 48 42237 0.11% 49 43667 0.11% 50 48060 0.12% 51 48827 0.13% 52 50535 0.13% 53 55887 0.14% 54 60093 0.15% 55 62937 0.16% 56 63810 0.16% 57 66256 0.17% 58 70419 0.18% 59 88475 0.23% 60 99465 0.26% 61 105509 0.27% 62 110802 0.29% 63 115746 0.30% 64 122682 0.32% 65 130365 0.34% 66 141083 0.36% 67 141538 0.37% 68 143276 0.37% 69 146211 0.38% 70 150004 0.39% 71 156250 0.40% 72 159974 0.41% 73 168914 0.44% 74 168109 0.43% 75 168198 0.43% 76 168851 0.44% 77 178074 0.46% 78 192775 0.50% 79 188214 0.49% 80 193482 0.50% 81 196553 0.51% 82 198693 0.51% 83 207582 0.54% 84 223007 0.58% 85 217734 0.56% 86 224916 0.58% 87 233925 0.60% 88 237321 0.61% 89 263964 0.68% 90 251165 0.65% 91 260217 0.67% 92 272013 0.70% 93 286023 0.74% 94 311139 0.80% 95 336974 0.87% 96 373861 0.96% 97 447214 1.15% 98 539491 1.39% 99 747486 1.93% 100 1953337 5.04% 101 26641734 68.71% 38776330 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.62 fanout-score-rank=19 prefix-density=0.54 prefix-fanout=3.1 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=272.75 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=27.8 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=22 prefix-density=0.49 prefix-fanout=2.5 sequence=TGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTGAGCTGACACTTTATATATGGTCCATCTTAATACGGAGCTGTCCTTGGTTGTTTATGCCTTGCCGGATTCCTCGCAGCCCGGTGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=98.76 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=11.7 sequence=AGCTTCTTGCCGATGTTCTCTATTCCGGTTGAGCTGACCCACTTGCGCACCTCATCGTCGTACACCCGGGCACGCAGCGCTCCGAAAAAGTCGATGGATTGGCCTGGGAAGGTGTCTACGATCTTGATGACGGACTCGTCGCTGATGTTGTCAGTTTGGAAGATACCCCTGCATACACCGATACGGTCTTCGCGGGTGGGGGCCCAGTAGAACTTCTCCATACGACCGTCACGGATGAGTGGCGCGTAGAGCGTGGAGAAATCGTTACCAGTGACGATGATGGGCACACGGGGG ERR3317449 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:50:47 Started mapping on | Dec 10 09:50:47 Finished on | Dec 10 09:52:44 Mapping speed, Million of reads per hour | 1193.12 Number of input reads | 38776330 Average input read length | 191 UNIQUE READS: Uniquely mapped reads number | 34870621 Uniquely mapped reads % | 89.93% Average mapped length | 189.76 Number of splices: Total | 21723592 Number of splices: Annotated (sjdb) | 20676627 Number of splices: GT/AG | 21410960 Number of splices: GC/AG | 276099 Number of splices: AT/AC | 17431 Number of splices: Non-canonical | 19102 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.00% Deletion average length | 1.21 Insertion rate per base | 0.00% Insertion average length | 1.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2694296 % of reads mapped to multiple loci | 6.95% Number of reads mapped to too many loci | 68389 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.94% % of reads unmapped: other | 1.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1400083 1400083 1400083 N_multimapping 2694296 2694296 2694296 N_noFeature 1236677 2451899 32964464 N_ambiguous 1001030 339110 16101 UnstrandedReadsAssigned:32632914 PositiveStrandReadsAssigned:32079612 NegativeStrandReadsAssigned:1890056 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=98 echo kmer=93 ERR3317449 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317449-trimmed-pair1.fastq ERR3317449-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,776,330 reads, 34,372,182 reads pseudoaligned [quant] estimated average fragment length: 180.341 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52973 ERR3317449.ke.tsv 35125 ERR3317449.se.tsv 88098 total ==> ERR3317449.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 756.87 0 0 PNS24247 1044 864.659 52.6706 2.70441 PNS24249 1928 1748.66 173.966 4.41681 PNS24246 1044 864.659 52.6706 2.70441 PNS24248 1044 864.659 52.6706 2.70441 PNS24244 1471 1291.66 324.022 11.1372 PNS24243 293 136.395 0 0 KQK14069 1603 1423.66 6342.58 197.792 KQK14071 474 300.124 35.6581 5.27479 ==> ERR3317449.se.tsv <== BRADI_1g14170v3 7542 BRADI_1g53295v3 84 BRADI_1g59795v3 810 BRADI_1g07683v3 0 BRADI_1g00485v3 131 BRADI_1g20270v3 2796 BRADI_1g74790v3 405 BRADI_1g09890v3 23 BRADI_1g77505v3 398 BRADI_1g48960v3 0 ERR3317449 completed mapping pipeline successfully