Starting /dee2/code/volunteer_pipeline.sh ERR3317450 current disk space = 1524991934464 free memory = 1595831084 ERR3317450 SRAfilesize e191e61faccb7aaf22567e8857d4a3fe ERR3317450.sra ERR3317450.sra file validated ERR3317450 is paired end ERR3317450 is conventional basespace ERR3317450 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317450_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.43675 34.0 31.0 34.0 30.0 34.0 2 32.26975 34.0 31.0 34.0 31.0 34.0 3 32.872 34.0 31.0 34.0 31.0 34.0 4 36.39325 37.0 37.0 37.0 35.0 37.0 5 36.43325 37.0 37.0 37.0 35.0 37.0 6 36.4085 37.0 37.0 37.0 35.0 37.0 7 36.4455 37.0 37.0 37.0 35.0 37.0 8 36.43625 37.0 37.0 37.0 35.0 37.0 9 38.30525 39.0 39.0 39.0 37.0 39.0 10-11 38.30325 39.0 39.0 39.0 37.0 39.0 12-13 38.238375 39.0 39.0 39.0 37.0 39.0 14-15 39.7915 41.0 40.0 41.0 37.5 41.0 16-17 39.706500000000005 41.0 40.0 41.0 37.5 41.0 18-19 39.74275 41.0 40.0 41.0 37.5 41.0 20-21 39.640625 41.0 40.0 41.0 37.0 41.0 22-23 39.569 41.0 40.0 41.0 37.0 41.0 24-25 39.515625 41.0 40.0 41.0 37.0 41.0 26-27 39.413375 41.0 40.0 41.0 36.5 41.0 28-29 39.254875 41.0 39.0 41.0 36.0 41.0 30-31 39.067499999999995 41.0 39.0 41.0 35.5 41.0 32-33 38.845625 40.0 38.5 41.0 35.0 41.0 34-35 38.621125 40.0 38.0 41.0 34.5 41.0 36-37 38.636624999999995 40.0 38.0 41.0 35.0 41.0 38-39 38.272875 40.0 38.0 41.0 34.0 41.0 40-41 38.10625 40.0 38.0 41.0 33.5 41.0 42-43 38.182 40.0 38.0 41.0 33.5 41.0 44-45 37.897875 40.0 37.5 41.0 33.0 41.0 46-47 37.887875 40.0 37.0 41.0 33.0 41.0 48-49 37.57325 40.0 36.5 41.0 33.0 41.0 50-51 37.790875 40.0 37.0 41.0 33.0 41.0 52-53 37.705749999999995 40.0 36.5 41.0 33.0 41.0 54-55 37.297625 39.5 35.5 41.0 32.5 41.0 56-57 37.0185 39.0 35.0 41.0 33.0 41.0 58-59 36.759 39.0 35.0 41.0 32.0 41.0 60-61 36.41825 38.0 35.0 41.0 32.0 41.0 62-63 36.017250000000004 37.0 35.0 40.0 31.0 41.0 64-65 35.627375 37.0 35.0 40.0 31.0 41.0 66-67 35.33175 36.0 35.0 39.0 31.0 41.0 68-69 35.0005 36.0 35.0 39.0 31.0 41.0 70-71 34.609875 35.0 34.5 38.5 30.0 40.0 72-73 34.022625 35.0 34.0 37.0 29.0 39.0 74-75 33.716875 35.0 34.0 37.0 29.0 39.0 76-77 32.58625 34.5 32.5 36.0 27.0 37.0 78-79 32.90025 35.0 33.0 36.0 27.5 37.0 80-81 32.7455 35.0 33.5 35.0 28.0 37.0 82-83 32.527375 35.0 34.0 35.0 27.5 36.0 84-85 32.13275 35.0 33.0 35.0 26.0 36.0 86-87 31.92125 35.0 33.0 35.0 25.0 36.0 88-89 31.90525 35.0 33.0 35.0 26.0 36.0 90-91 31.645375 35.0 33.0 35.0 25.0 35.0 92-93 31.25625 35.0 33.0 35.0 24.0 35.0 94-95 31.125500000000002 35.0 33.0 35.0 23.5 35.0 96-97 30.7835 35.0 32.5 35.0 19.5 35.0 98-99 30.3985 35.0 32.0 35.0 9.5 35.0 100-101 28.154625 33.0 28.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 2.0 9 5.0 10 3.0 11 3.0 12 5.0 13 6.0 14 4.0 15 10.0 16 8.0 17 10.0 18 10.0 19 13.0 20 14.0 21 12.0 22 13.0 23 12.0 24 20.0 25 23.0 26 28.0 27 21.0 28 45.0 29 47.0 30 58.0 31 68.0 32 82.0 33 105.0 34 180.0 35 277.0 36 584.0 37 1106.0 38 1079.0 39 143.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 26.519337016574585 26.808734543541174 20.284135753749013 26.387792686135224 2 26.700000000000003 25.1 19.55 28.65 3 26.424999999999997 26.224999999999998 19.05 28.299999999999997 4 27.800000000000004 24.0 17.599999999999998 30.599999999999998 5 27.3 26.875 16.225 29.599999999999998 6 28.175 26.875 19.3 25.650000000000002 7 30.275000000000002 24.15 22.85 22.725 8 32.1 25.4 23.575 18.925 9 31.75 26.900000000000002 23.375 17.974999999999998 10-11 33.074999999999996 25.637500000000003 22.625 18.6625 12-13 29.4 26.424999999999997 24.375 19.8 14-15 27.437499999999996 26.637499999999996 25.4 20.525 16-17 26.924999999999997 26.275 24.725 22.075 18-19 26.5125 26.450000000000003 25.2125 21.825 20-21 25.775 26.3125 26.0125 21.9 22-23 25.674999999999997 26.400000000000002 25.162499999999998 22.7625 24-25 25.3 26.6625 26.1125 21.925 26-27 25.224999999999998 27.6875 24.9875 22.1 28-29 26.8125 25.25 25.0375 22.900000000000002 30-31 25.7125 26.55 25.5625 22.175 32-33 25.174999999999997 27.200000000000003 25.2 22.425 34-35 25.2375 27.1125 24.4 23.25 36-37 25.887500000000003 25.7375 25.8 22.575 38-39 25.05 27.3125 25.9625 21.675 40-41 25.85 26.8125 24.125 23.2125 42-43 25.887500000000003 27.650000000000002 24.4125 22.05 44-45 26.5125 25.7 25.5625 22.225 46-47 26.987499999999997 25.75 24.3 22.9625 48-49 26.0 26.337500000000002 25.324999999999996 22.3375 50-51 25.5 26.525 25.6 22.375 52-53 26.174999999999997 27.4125 24.3875 22.025 54-55 25.4625 26.6625 25.5375 22.3375 56-57 24.6625 26.9125 26.0 22.425 58-59 25.874999999999996 26.575 24.675 22.875 60-61 26.025 27.025 25.362499999999997 21.587500000000002 62-63 25.5625 26.6125 25.275 22.55 64-65 25.2625 26.724999999999998 25.124999999999996 22.8875 66-67 24.375 27.3625 25.387500000000003 22.875 68-69 24.5125 28.625 24.0625 22.8 70-71 26.337500000000002 26.8625 24.425 22.375 72-73 25.887500000000003 26.400000000000002 24.9875 22.725 74-75 25.887500000000003 27.125 24.887500000000003 22.1 76-77 25.874999999999996 27.325 23.6875 23.1125 78-79 25.15 27.3625 25.362499999999997 22.125 80-81 25.0 27.3875 24.9125 22.7 82-83 25.825 27.125 24.05 23.0 84-85 25.5125 26.650000000000002 25.937500000000004 21.9 86-87 25.4875 27.6625 25.5375 21.3125 88-89 25.2 27.975 23.9 22.925 90-91 25.887500000000003 26.825 24.775 22.5125 92-93 24.275 27.762500000000003 25.45 22.5125 94-95 24.975 27.125 24.7375 23.1625 96-97 25.525 27.175 24.2375 23.0625 98-99 24.9 28.1125 24.462500000000002 22.525000000000002 100-101 26.150000000000002 26.687499999999996 23.474999999999998 23.6875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 2.0 13 2.0 14 0.5 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 2.5 21 3.0 22 2.0 23 2.0 24 2.0 25 2.5 26 4.5 27 7.0 28 8.5 29 8.0 30 10.0 31 16.5 32 19.0 33 18.5 34 19.5 35 28.5 36 47.0 37 62.0 38 75.5 39 97.5 40 124.0 41 142.0 42 160.0 43 195.0 44 207.5 45 211.5 46 230.0 47 226.5 48 202.5 49 181.5 50 173.5 51 171.0 52 158.5 53 130.0 54 109.5 55 98.0 56 90.0 57 76.5 58 59.5 59 52.5 60 51.0 61 56.5 62 52.5 63 42.0 64 40.0 65 38.5 66 33.5 67 28.0 68 26.5 69 30.0 70 25.0 71 22.0 72 22.5 73 16.0 74 16.5 75 13.5 76 6.0 77 5.0 78 6.0 79 5.0 80 4.0 81 3.0 82 3.0 83 2.5 84 0.5 85 0.5 86 1.5 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.9750000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.12868495257626 95.7 2 1.4867982568572162 2.9000000000000004 3 0.25634452704434757 0.75 4 0.02563445270443476 0.1 5 0.05126890540886952 0.25 6 0.05126890540886952 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGCAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGAT 6 0.15 No Hit AGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCGAGTTCGCGCCGG 6 0.15 No Hit GCAGAGAGAGAGATCGAGATGGCAGCGTCCATGATCACGTCGCCTCTGGT 5 0.125 No Hit GTACAAGCTCGTAACGAAGGGCGCGATCTTGCTCGTGAAGGTAATGAAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.175 0.0 0.0 0.0 0.0 38-39 0.23750000000000002 0.0 0.0 0.0 0.0 40-41 0.35 0.0 0.0 0.0 0.0 42-43 0.45 0.0 0.0 0.0 0.0 44-45 0.4625 0.0 0.0 0.0 0.0 46-47 0.5875 0.0 0.0 0.0 0.0 48-49 0.7 0.0 0.0 0.0 0.0 50-51 0.8 0.0 0.0 0.0 0.0 52-53 0.8875 0.0 0.0 0.0 0.0 54-55 1.025 0.0 0.0 0.0 0.0 56-57 1.1 0.0 0.0 0.0 0.0 58-59 1.2375 0.0 0.0 0.0 0.0 60-61 1.375 0.0 0.0 0.0 0.0 62-63 1.5625 0.0 0.0 0.0 0.0 64-65 1.8125 0.0 0.0 0.0 0.0 66-67 2.05 0.0 0.0 0.0 0.0 68-69 2.3375000000000004 0.0 0.0 0.0 0.0 70-71 2.6625 0.0 0.0 0.0 0.0 72-73 2.9375 0.0 0.0 0.0 0.0 74-75 3.4124999999999996 0.0 0.0 0.0 0.0 76-77 3.8375000000000004 0.0 0.0 0.0 0.0 78-79 4.3 0.0 0.0 0.0 0.0 80-81 4.8625 0.0 0.0 0.0 0.0 82-83 5.425000000000001 0.0 0.0 0.0 0.0 84-85 5.9375 0.0 0.0 0.0 0.0 86-87 6.362500000000001 0.0 0.0 0.0 0.0 88-89 6.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317450 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317450_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.13975 34.0 31.0 34.0 30.0 34.0 2 32.14875 34.0 31.0 34.0 30.0 34.0 3 32.0315 34.0 31.0 34.0 30.0 34.0 4 35.42925 37.0 35.0 37.0 33.0 37.0 5 35.52025 37.0 35.0 37.0 33.0 37.0 6 35.693 37.0 37.0 37.0 35.0 37.0 7 35.79575 37.0 37.0 37.0 35.0 37.0 8 35.77375 37.0 37.0 37.0 35.0 37.0 9 37.612 39.0 39.0 39.0 35.0 39.0 10-11 37.718875 39.0 39.0 39.0 35.0 39.0 12-13 37.695750000000004 39.0 39.0 39.0 36.0 39.0 14-15 39.12825 41.0 40.0 41.0 36.5 41.0 16-17 39.17825 41.0 40.0 41.0 36.5 41.0 18-19 39.054874999999996 41.0 40.0 41.0 36.0 41.0 20-21 39.029875000000004 41.0 40.0 41.0 36.0 41.0 22-23 38.961 41.0 40.0 41.0 35.5 41.0 24-25 38.891999999999996 41.0 39.5 41.0 35.0 41.0 26-27 38.76525 41.0 39.0 41.0 35.0 41.0 28-29 38.758624999999995 41.0 39.0 41.0 35.0 41.0 30-31 38.581625 41.0 39.0 41.0 35.0 41.0 32-33 38.503625 41.0 39.0 41.0 35.0 41.0 34-35 38.422625 41.0 39.0 41.0 35.0 41.0 36-37 38.26025 40.0 38.0 41.0 34.5 41.0 38-39 38.229875 40.0 38.0 41.0 34.5 41.0 40-41 38.332375 40.5 39.0 41.0 35.0 41.0 42-43 38.236875 41.0 38.0 41.0 34.5 41.0 44-45 38.1055 40.5 38.0 41.0 34.0 41.0 46-47 37.995000000000005 40.0 38.0 41.0 33.5 41.0 48-49 37.780375 40.0 37.5 41.0 33.0 41.0 50-51 37.113 39.5 36.5 40.5 32.5 41.0 52-53 37.012625 39.5 36.0 40.5 32.5 41.0 54-55 37.105374999999995 40.0 36.0 41.0 32.0 41.0 56-57 36.9725 40.0 35.5 41.0 32.0 41.0 58-59 36.770125 39.0 35.0 41.0 32.0 41.0 60-61 36.547875000000005 39.0 35.0 41.0 31.5 41.0 62-63 36.1785 38.5 35.0 41.0 31.0 41.0 64-65 35.81125 37.5 35.0 40.0 30.5 41.0 66-67 35.701 37.0 35.0 40.0 31.0 41.0 68-69 35.357875 37.0 35.0 39.5 30.5 41.0 70-71 35.124 36.0 35.0 39.0 31.0 41.0 72-73 34.779625 36.0 35.0 39.0 31.0 41.0 74-75 34.385875 35.0 35.0 37.5 30.5 39.5 76-77 33.958375000000004 35.0 35.0 37.0 30.0 39.0 78-79 33.641375 35.0 34.5 36.5 29.5 39.0 80-81 33.42575 35.0 34.0 36.0 29.5 37.0 82-83 33.091375 35.0 34.0 36.0 29.0 37.0 84-85 32.884 35.0 34.0 35.0 29.0 37.0 86-87 32.778375 35.0 34.0 35.0 29.0 36.0 88-89 32.493875 35.0 34.0 35.0 29.0 36.0 90-91 32.356625 35.0 34.0 35.0 29.0 36.0 92-93 32.157624999999996 35.0 34.0 35.0 28.0 35.5 94-95 31.901375 35.0 34.0 35.0 27.0 35.0 96-97 31.7945 35.0 33.5 35.0 27.0 35.0 98-99 31.594125 35.0 33.0 35.0 25.0 35.0 100-101 29.95375 34.0 30.0 35.0 20.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 42.0 3 5.0 4 1.0 5 5.0 6 3.0 7 4.0 8 2.0 9 6.0 10 3.0 11 3.0 12 6.0 13 7.0 14 8.0 15 8.0 16 4.0 17 9.0 18 4.0 19 6.0 20 9.0 21 10.0 22 12.0 23 13.0 24 11.0 25 17.0 26 17.0 27 28.0 28 28.0 29 33.0 30 32.0 31 50.0 32 70.0 33 89.0 34 146.0 35 224.0 36 451.0 37 903.0 38 1437.0 39 294.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.075 11.924999999999999 31.2 28.799999999999997 2 25.900000000000002 10.674999999999999 26.3 37.125 3 22.3 13.075000000000001 29.725 34.9 4 23.674999999999997 11.375 28.749999999999996 36.199999999999996 5 24.2 14.825 24.8 36.175000000000004 6 24.525 19.05 30.8 25.624999999999996 7 20.125 23.625 38.574999999999996 17.675 8 17.025000000000002 25.75 35.725 21.5 9 17.424999999999997 27.750000000000004 35.949999999999996 18.875 10-11 19.475 27.0625 32.4125 21.05 12-13 19.4375 27.725 31.937500000000004 20.9 14-15 19.689961245155644 26.190773846730842 31.716464558069756 22.402800350043755 16-17 20.280070017504375 26.831707926981746 30.545136284071017 22.343085771442862 18-19 19.667208807706743 26.097835606155385 30.91455023145252 23.32040535468535 20-21 20.355310897034904 25.860127611660204 29.83860878268485 23.94595270862004 22-23 20.490061257657207 24.965620702587824 29.753719214901864 24.79059882485311 24-25 20.1 26.450000000000003 29.7125 23.7375 26-27 20.5 26.5375 27.962500000000002 25.0 28-29 20.375 26.2875 27.1625 26.174999999999997 30-31 20.2375 26.325 29.562500000000004 23.875 32-33 20.424999999999997 26.1625 28.5625 24.85 34-35 20.0375 25.874999999999996 27.8125 26.275 36-37 20.8875 25.85 28.999999999999996 24.2625 38-39 21.05 26.887499999999996 26.900000000000002 25.162499999999998 40-41 21.3125 25.087500000000002 27.987499999999997 25.6125 42-43 20.96512064008001 25.928241030128767 27.715964495561945 25.390673834229275 44-45 21.952744093011624 26.290786348293537 26.56582072759095 25.19064883110389 46-47 21.475 26.337500000000002 26.6125 25.575 48-49 20.1625 27.487499999999997 28.537499999999998 23.8125 50-51 21.4875 25.587500000000002 27.675 25.25 52-53 22.7625 25.575 26.7625 24.9 54-55 21.475 26.737499999999997 28.375 23.4125 56-57 21.05 26.0625 28.6375 24.25 58-59 21.2875 25.937500000000004 27.075 25.7 60-61 20.5375 26.7125 28.9 23.849999999999998 62-63 22.0625 26.137500000000003 26.8 25.0 64-65 21.95 24.75 27.0625 26.237500000000004 66-67 20.65 27.1125 27.8875 24.349999999999998 68-69 21.8125 26.375 26.637499999999996 25.174999999999997 70-71 22.325 26.1 25.900000000000002 25.674999999999997 72-73 21.15 25.900000000000002 26.8125 26.137500000000003 74-75 22.662499999999998 25.6125 26.8625 24.8625 76-77 22.375 26.0125 26.400000000000002 25.2125 78-79 21.212500000000002 26.937499999999996 26.4125 25.4375 80-81 21.512500000000003 27.1125 26.7625 24.6125 82-83 23.2125 25.5125 26.224999999999998 25.05 84-85 23.225 26.387500000000003 26.05 24.337500000000002 86-87 25.0625 24.975 25.8125 24.15 88-89 23.1125 25.687500000000004 26.637499999999996 24.5625 90-91 23.575 26.887499999999996 25.8 23.7375 92-93 22.9875 24.7875 27.55 24.675 94-95 23.8625 25.674999999999997 26.0375 24.425 96-97 24.85 26.8625 25.324999999999996 22.9625 98-99 23.1875 25.7125 27.175 23.925 100-101 23.8875 25.974999999999998 24.975 25.162499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 21.0 1 15.5 2 6.5 3 2.0 4 1.0 5 1.5 6 2.0 7 2.5 8 4.0 9 3.0 10 1.0 11 2.5 12 4.0 13 2.5 14 1.0 15 1.0 16 0.5 17 0.5 18 1.5 19 1.5 20 2.5 21 2.5 22 1.0 23 2.0 24 2.5 25 4.0 26 5.5 27 8.0 28 12.0 29 16.5 30 18.5 31 20.5 32 23.0 33 33.5 34 44.5 35 52.0 36 58.5 37 70.5 38 93.5 39 122.5 40 151.5 41 184.5 42 221.5 43 222.0 44 215.5 45 218.0 46 208.0 47 196.0 48 176.0 49 146.5 50 143.5 51 156.0 52 139.0 53 108.5 54 90.0 55 84.5 56 79.5 57 70.0 58 59.0 59 46.5 60 43.0 61 43.5 62 36.5 63 34.0 64 34.5 65 32.0 66 28.0 67 27.0 68 25.0 69 20.5 70 21.0 71 19.0 72 12.0 73 9.0 74 10.0 75 7.5 76 4.0 77 4.0 78 4.0 79 3.5 80 2.0 81 1.5 82 1.5 83 0.0 84 0.5 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0125 16-17 0.025 18-19 0.08750000000000001 20-21 0.08750000000000001 22-23 0.0125 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0125 44-45 0.0125 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8697662471102 96.22500000000001 2 0.7706139224248651 1.5 3 0.20549704597996404 0.6 4 0.07706139224248652 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.07706139224248652 1.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 31 0.775 No Hit TCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 12 0.3 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 12 0.3 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.2125 0.0 0.0 0.0 0.0 40-41 0.3125 0.0 0.0 0.0 0.0 42-43 0.4 0.0 0.0 0.0 0.0 44-45 0.4125 0.0 0.0 0.0 0.0 46-47 0.5249999999999999 0.0 0.0 0.0 0.0 48-49 0.625 0.0 0.0 0.0 0.0 50-51 0.7375 0.0 0.0 0.0 0.0 52-53 0.8625 0.0 0.0 0.0 0.0 54-55 1.0 0.0 0.0 0.0 0.0 56-57 1.075 0.0 0.0 0.0 0.0 58-59 1.2000000000000002 0.0 0.0 0.0 0.0 60-61 1.375 0.0 0.0 0.0 0.0 62-63 1.5625 0.0 0.0 0.0 0.0 64-65 1.8 0.0 0.0 0.0 0.0 66-67 2.025 0.0 0.0 0.0 0.0 68-69 2.3 0.0 0.0 0.0 0.0 70-71 2.625 0.0 0.0 0.0 0.0 72-73 2.8875 0.0 0.0 0.0 0.0 74-75 3.3375000000000004 0.0 0.0 0.0 0.0 76-77 3.7625 0.0 0.0 0.0 0.0 78-79 4.2125 0.0 0.0 0.0 0.0 80-81 4.775 0.0 0.0 0.0 0.0 82-83 5.3375 0.0 0.0 0.0 0.0 84-85 5.8375 0.0 0.0 0.0 0.0 86-87 6.275 0.0 0.0 0.0 0.0 88-89 6.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCAAG 15 0.009957196 47.5 64-65 >>END_MODULE Read 1962212 spots for ERR3317450.sra Written 1962212 spots for ERR3317450.sra Read 1962212 spots for ERR3317450.sra Written 1962212 spots for ERR3317450.sra Read 1962212 spots for ERR3317450.sra Written 1962212 spots for ERR3317450.sra Read 1962212 spots for ERR3317450.sra Written 1962212 spots for ERR3317450.sra Read 1962212 spots for ERR3317450.sra Written 1962212 spots for ERR3317450.sra Read 1962221 spots for ERR3317450.sra Written 1962221 spots for ERR3317450.sra Read 1962212 spots for ERR3317450.sra Written 1962212 spots for ERR3317450.sra Read 1962212 spots for ERR3317450.sra Written 1962212 spots for ERR3317450.sra Read 1962212 spots for ERR3317450.sra Written 1962212 spots for ERR3317450.sra Read 1962212 spots for ERR3317450.sra Written 1962212 spots for ERR3317450.sra Read 1962212 spots for ERR3317450.sra Written 1962212 spots for ERR3317450.sra Read 1962212 spots for ERR3317450.sra Written 1962212 spots for ERR3317450.sra Read 1962212 spots for ERR3317450.sra Written 1962212 spots for ERR3317450.sra Read 1962212 spots for ERR3317450.sra Written 1962212 spots for ERR3317450.sra Read 1962212 spots for ERR3317450.sra Written 1962212 spots for ERR3317450.sra Read 1962212 spots for ERR3317450.sra Written 1962212 spots for ERR3317450.sra Read 1962212 spots for ERR3317450.sra Written 1962212 spots for ERR3317450.sra Read 1962212 spots for ERR3317450.sra Written 1962212 spots for ERR3317450.sra Read 1962212 spots for ERR3317450.sra Written 1962212 spots for ERR3317450.sra Read 1962212 spots for ERR3317450.sra Written 1962212 spots for ERR3317450.sra SRR ids: ['ERR3317450.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5w5biy3v ERR3317450.sra spots: 39244249 blocks: [[1, 1962212], [1962213, 3924424], [3924425, 5886636], [5886637, 7848848], [7848849, 9811060], [9811061, 11773272], [11773273, 13735484], [13735485, 15697696], [15697697, 17659908], [17659909, 19622120], [19622121, 21584332], [21584333, 23546544], [23546545, 25508756], [25508757, 27470968], [27470969, 29433180], [29433181, 31395392], [31395393, 33357604], [33357605, 35319816], [35319817, 37282028], [37282029, 39244249]] ERR3317450 file size 9444441 ERR3317450 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317450 ERR3317450_1.fastq ERR3317450_2.fastq Input file: ERR3317450_1.fastq Paired file: ERR3317450_2.fastq trimmed: ERR3317450-trimmed-pair1.fastq, ERR3317450-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:49:09 2024 >> started Tue Dec 10 09:50:06 2024 >> done (56.382s) 39244249 read pairs processed; of these: 245135 ( 0.62%) short read pairs filtered out after trimming by size control 592162 ( 1.51%) empty read pairs filtered out after trimming by size control 38406952 (97.87%) read pairs available; of these: 11474506 (29.88%) trimmed read pairs available after processing 26932446 (70.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 846 0.00% 19 1023 0.00% 20 1384 0.00% 21 1660 0.00% 22 1975 0.01% 23 2894 0.01% 24 3469 0.01% 25 4127 0.01% 26 4782 0.01% 27 5911 0.02% 28 5951 0.02% 29 7185 0.02% 30 7994 0.02% 31 12956 0.03% 32 11507 0.03% 33 11939 0.03% 34 13950 0.04% 35 14452 0.04% 36 15456 0.04% 37 16452 0.04% 38 19092 0.05% 39 20539 0.05% 40 20604 0.05% 41 22051 0.06% 42 23986 0.06% 43 25034 0.07% 44 26814 0.07% 45 27668 0.07% 46 29543 0.08% 47 36128 0.09% 48 34628 0.09% 49 35874 0.09% 50 40140 0.10% 51 40309 0.10% 52 42222 0.11% 53 47060 0.12% 54 51024 0.13% 55 53425 0.14% 56 53796 0.14% 57 56375 0.15% 58 59305 0.15% 59 76624 0.20% 60 87699 0.23% 61 94055 0.24% 62 99090 0.26% 63 104325 0.27% 64 111577 0.29% 65 118613 0.31% 66 128473 0.33% 67 130057 0.34% 68 131295 0.34% 69 135042 0.35% 70 137511 0.36% 71 144373 0.38% 72 148519 0.39% 73 156398 0.41% 74 156092 0.41% 75 155167 0.40% 76 156982 0.41% 77 166243 0.43% 78 181896 0.47% 79 179030 0.47% 80 182481 0.48% 81 186765 0.49% 82 190226 0.50% 83 198786 0.52% 84 214450 0.56% 85 215322 0.56% 86 220466 0.57% 87 227945 0.59% 88 231028 0.60% 89 271370 0.71% 90 243458 0.63% 91 250676 0.65% 92 261657 0.68% 93 273117 0.71% 94 301624 0.79% 95 326348 0.85% 96 362052 0.94% 97 435668 1.13% 98 523828 1.36% 99 727271 1.89% 100 1919377 5.00% 101 26932446 70.12% 38406952 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.06 fanout-score-rank=22 prefix-density=0.58 prefix-fanout=2.7 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=246.43 fanout-score-rank=1 prefix-density=0.76 prefix-fanout=29.2 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=25 prefix-density=0.49 prefix-fanout=1.0 sequence=ATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=84.71 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=12.5 sequence=AGCTTCTTGCCGATGTTCTCTATTCCGGTTGAGCTGACCCACTTGCGCACCTCATCGTCGTACACCCGGGCACGCAGCGCTCCGAAAAAGTCGATGGATTGGCCTGGGAAGGTGTCTACGATCTTGATGACGGACTCGTCGCTGATGTTGTCAGTTTGGAAGATACCCCTGCATACACCGATACGGTCTTCGCGGGTGGGGGCCCAGTAGAACTTCTCCATACGACCGTCACGGATGAGTGGCGCGTAGAGCGTGGAGAAATCGTTACCAGTGACGATGATGGGCACACGGGGG ERR3317450 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:50:47 Started mapping on | Dec 10 09:50:47 Finished on | Dec 10 09:52:43 Mapping speed, Million of reads per hour | 1191.94 Number of input reads | 38406952 Average input read length | 192 UNIQUE READS: Uniquely mapped reads number | 34014251 Uniquely mapped reads % | 88.56% Average mapped length | 190.85 Number of splices: Total | 20936190 Number of splices: Annotated (sjdb) | 19922006 Number of splices: GT/AG | 20639761 Number of splices: GC/AG | 263209 Number of splices: AT/AC | 15671 Number of splices: Non-canonical | 17549 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.00% Deletion average length | 1.21 Insertion rate per base | 0.00% Insertion average length | 1.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 3204444 % of reads mapped to multiple loci | 8.34% Number of reads mapped to too many loci | 63806 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.01% % of reads unmapped: other | 0.92% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1384894 1384894 1384894 N_multimapping 3204444 3204444 3204444 N_noFeature 1229533 2314429 32219033 N_ambiguous 1050395 378771 16966 UnstrandedReadsAssigned:31734323 PositiveStrandReadsAssigned:31321051 NegativeStrandReadsAssigned:1778252 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=99 echo kmer=95 ERR3317450 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317450-trimmed-pair1.fastq ERR3317450-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,406,952 reads, 34,158,970 reads pseudoaligned [quant] estimated average fragment length: 185.891 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,178 rounds 52973 ERR3317450.ke.tsv 35125 ERR3317450.se.tsv 88098 total ==> ERR3317450.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 751.291 0 0 PNS24247 1044 859.109 41.4652 2.14445 PNS24249 1928 1743.11 96.0125 2.44728 PNS24246 1044 859.109 41.4652 2.14445 PNS24248 1044 859.109 41.4652 2.14445 PNS24244 1471 1286.11 289.592 10.0043 PNS24243 293 133.84 1 0.331966 KQK14069 1603 1418.11 3646.48 114.247 KQK14071 474 295.213 14.0811 2.11924 ==> ERR3317450.se.tsv <== BRADI_1g14170v3 4111 BRADI_1g53295v3 39 BRADI_1g59795v3 413 BRADI_1g07683v3 0 BRADI_1g00485v3 77 BRADI_1g20270v3 2885 BRADI_1g74790v3 686 BRADI_1g09890v3 8 BRADI_1g77505v3 451 BRADI_1g48960v3 4 ERR3317450 completed mapping pipeline successfully