Starting /dee2/code/volunteer_pipeline.sh ERR3317451 current disk space = 1525008678912 free memory = 1512240312 ERR3317451 SRAfilesize f02749cc7c02461328a32db9553b2873 ERR3317451.sra ERR3317451.sra file validated ERR3317451 is paired end ERR3317451 is conventional basespace ERR3317451 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317451_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.63275 34.0 31.0 34.0 31.0 34.0 2 32.34775 34.0 31.0 34.0 31.0 34.0 3 32.9285 34.0 33.0 34.0 31.0 34.0 4 36.45325 37.0 37.0 37.0 35.0 37.0 5 36.413 37.0 37.0 37.0 35.0 37.0 6 36.43875 37.0 37.0 37.0 35.0 37.0 7 36.496 37.0 37.0 37.0 35.0 37.0 8 36.476 37.0 37.0 37.0 35.0 37.0 9 38.31925 39.0 39.0 39.0 37.0 39.0 10-11 38.314625 39.0 39.0 39.0 37.0 39.0 12-13 38.278625 39.0 39.0 39.0 37.0 39.0 14-15 39.77425 41.0 40.0 41.0 38.0 41.0 16-17 39.787875 41.0 40.0 41.0 38.0 41.0 18-19 39.79625 41.0 40.0 41.0 38.0 41.0 20-21 39.698499999999996 41.0 40.0 41.0 37.5 41.0 22-23 39.631375 41.0 40.0 41.0 37.0 41.0 24-25 39.558875 41.0 40.0 41.0 37.0 41.0 26-27 39.415875 41.0 40.0 41.0 37.0 41.0 28-29 39.293125 41.0 39.5 41.0 36.0 41.0 30-31 39.1395 41.0 39.0 41.0 36.0 41.0 32-33 38.8845 40.0 38.5 41.0 35.5 41.0 34-35 38.614125 40.0 38.0 41.0 34.5 41.0 36-37 38.518125 40.0 38.0 41.0 34.5 41.0 38-39 38.1965 40.0 38.0 41.0 33.5 41.0 40-41 38.043875 40.0 38.0 41.0 33.0 41.0 42-43 38.085875 40.0 38.0 41.0 33.0 41.0 44-45 37.811875 40.0 37.5 41.0 33.0 41.0 46-47 37.723625 40.0 37.0 41.0 33.0 41.0 48-49 37.340999999999994 40.0 36.5 41.0 32.5 41.0 50-51 37.620125 40.0 37.0 41.0 33.0 41.0 52-53 37.397375 40.0 36.0 41.0 33.0 41.0 54-55 37.025 39.5 35.0 41.0 32.5 41.0 56-57 36.733374999999995 39.0 35.0 41.0 32.0 41.0 58-59 36.463499999999996 39.0 35.0 41.0 31.5 41.0 60-61 36.17100000000001 38.0 35.0 41.0 31.5 41.0 62-63 35.809375 37.0 35.0 40.0 30.5 41.0 64-65 35.428 37.0 35.0 40.0 31.0 41.0 66-67 35.103 36.0 35.0 39.0 30.0 41.0 68-69 34.773624999999996 35.5 35.0 39.0 30.0 41.0 70-71 34.286625 35.0 34.0 38.5 29.0 40.0 72-73 33.845625 35.0 34.0 37.0 29.0 39.5 74-75 33.518125 35.0 34.0 37.0 29.0 39.0 76-77 32.366749999999996 34.5 32.5 36.0 26.0 37.5 78-79 32.733625 35.0 33.5 36.0 27.0 37.0 80-81 32.56 35.0 33.0 35.0 27.0 37.0 82-83 32.343500000000006 35.0 33.0 35.0 27.0 36.5 84-85 31.938499999999998 35.0 33.0 35.0 25.5 36.0 86-87 31.722250000000003 35.0 33.0 35.0 25.0 36.0 88-89 31.57575 35.0 33.0 35.0 24.5 36.0 90-91 31.353875000000002 35.0 33.0 35.0 24.0 35.0 92-93 31.136 35.0 32.5 35.0 23.5 35.0 94-95 30.850625 35.0 32.0 35.0 21.0 35.0 96-97 30.4895 35.0 32.0 35.0 16.5 35.0 98-99 30.08625 35.0 32.0 35.0 2.0 35.0 100-101 27.838625 33.0 27.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 2.0 9 5.0 10 8.0 11 5.0 12 2.0 13 8.0 14 10.0 15 10.0 16 16.0 17 8.0 18 10.0 19 12.0 20 14.0 21 14.0 22 15.0 23 19.0 24 12.0 25 18.0 26 22.0 27 23.0 28 35.0 29 58.0 30 70.0 31 70.0 32 73.0 33 136.0 34 180.0 35 301.0 36 563.0 37 1046.0 38 1068.0 39 164.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 25.90078328981723 27.31070496083551 20.156657963446474 26.631853785900784 2 25.374999999999996 25.674999999999997 19.75 29.2 3 23.525 26.924999999999997 18.625 30.925000000000004 4 25.5 27.625 18.0 28.875 5 26.825 25.900000000000002 17.424999999999997 29.849999999999998 6 27.85 27.500000000000004 19.35 25.3 7 27.725 24.675 23.3 24.3 8 28.7 26.025 24.925 20.349999999999998 9 28.975 26.650000000000002 26.650000000000002 17.724999999999998 10-11 30.575000000000003 27.575 23.599999999999998 18.25 12-13 29.462500000000002 27.0 23.5375 20.0 14-15 27.35 26.4625 24.8625 21.325 16-17 26.2625 26.55 24.6 22.5875 18-19 25.2 26.737499999999997 25.525 22.537499999999998 20-21 25.6125 27.0 25.324999999999996 22.0625 22-23 25.374999999999996 26.974999999999998 24.3875 23.2625 24-25 24.4125 26.6125 25.4875 23.4875 26-27 25.624999999999996 26.737499999999997 25.6125 22.025 28-29 25.9625 26.224999999999998 24.6 23.2125 30-31 25.4875 25.662499999999998 25.912499999999998 22.9375 32-33 25.7625 25.362499999999997 25.224999999999998 23.65 34-35 25.924999999999997 26.1125 24.1375 23.825 36-37 25.85 26.150000000000002 25.5625 22.4375 38-39 24.2625 26.2125 26.1 23.425 40-41 24.9875 25.4875 25.374999999999996 24.15 42-43 25.2125 27.1125 25.4 22.275 44-45 25.2 26.650000000000002 24.212500000000002 23.9375 46-47 25.474999999999998 26.625 24.275 23.625 48-49 24.75 26.875 25.0375 23.3375 50-51 26.6 25.5125 25.3125 22.575 52-53 24.962500000000002 26.125 25.4 23.5125 54-55 25.575 25.587500000000002 26.4125 22.425 56-57 25.2625 26.6 24.087500000000002 24.05 58-59 26.0625 25.887500000000003 24.8 23.25 60-61 25.0625 26.85 25.474999999999998 22.6125 62-63 25.162499999999998 27.2625 24.2875 23.2875 64-65 26.1125 26.05 24.8125 23.025000000000002 66-67 24.3625 26.8375 25.5 23.3 68-69 25.1 25.937500000000004 25.9875 22.975 70-71 26.174999999999997 27.200000000000003 23.7375 22.8875 72-73 25.362499999999997 26.825 25.137500000000003 22.675 74-75 25.324999999999996 26.7125 24.837500000000002 23.125 76-77 25.137500000000003 27.537499999999998 24.087500000000002 23.2375 78-79 25.424999999999997 26.700000000000003 25.05 22.825 80-81 25.775 27.9375 23.9375 22.35 82-83 25.874999999999996 26.474999999999998 23.75 23.9 84-85 25.474999999999998 27.275 24.474999999999998 22.775000000000002 86-87 25.4875 27.35 24.425 22.7375 88-89 25.2125 27.474999999999998 23.95 23.3625 90-91 24.6875 27.275 25.137500000000003 22.900000000000002 92-93 25.112499999999997 27.675 24.087500000000002 23.125 94-95 25.5625 26.950000000000003 24.1875 23.3 96-97 25.0375 27.05 24.7 23.2125 98-99 26.150000000000002 27.325 23.7125 22.8125 100-101 25.5125 26.8 23.75 23.9375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 1.0 14 1.5 15 0.5 16 1.0 17 1.0 18 1.0 19 2.0 20 1.0 21 0.5 22 0.5 23 2.0 24 4.5 25 4.0 26 2.5 27 4.0 28 9.0 29 10.5 30 9.5 31 13.0 32 18.5 33 22.0 34 30.5 35 40.0 36 45.0 37 69.5 38 90.0 39 102.5 40 116.5 41 147.5 42 180.5 43 200.5 44 204.0 45 200.0 46 202.5 47 189.5 48 183.0 49 167.5 50 155.0 51 149.5 52 148.0 53 128.0 54 109.0 55 94.0 56 81.5 57 89.5 58 80.5 59 70.5 60 62.0 61 51.5 62 54.5 63 55.0 64 48.5 65 45.5 66 38.5 67 36.0 68 38.0 69 35.5 70 24.0 71 18.5 72 16.0 73 13.5 74 11.5 75 11.0 76 12.0 77 7.0 78 4.5 79 5.0 80 5.5 81 4.5 82 3.5 83 3.0 84 2.5 85 1.0 86 1.0 87 1.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.05 #Duplication Level Percentage of deduplicated Percentage of total 1 98.64864864864865 96.72500000000001 2 0.9688934217236104 1.9 3 0.22947475777664456 0.675 4 0.0764915859255482 0.3 5 0.05099439061703213 0.25 6 0.025497195308516064 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATGCCAGCTCTGACCGAAATCTTTGGGGATGATTCTGTATTACAATTTGG 6 0.15 No Hit ACTTAACTGGGGGATTCACCGCAAATACTACTTTGGCTCATTATTGCCGC 5 0.125 No Hit AAACAACCAAGGACAGCTCCGTATTAAGATGGACCATATATAAAGTGTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.3 0.0 0.0 0.0 0.0 7 0.4 0.0 0.0 0.0 0.0 8 0.475 0.0 0.0 0.0 0.0 9 0.525 0.0 0.0 0.0 0.0 10-11 0.525 0.0 0.0 0.0 0.0 12-13 0.525 0.0 0.0 0.0 0.0 14-15 0.525 0.0 0.0 0.0 0.0 16-17 0.525 0.0 0.0 0.0 0.0 18-19 0.525 0.0 0.0 0.0 0.0 20-21 0.525 0.0 0.0 0.0 0.0 22-23 0.5375000000000001 0.0 0.0 0.0 0.0 24-25 0.5625 0.0 0.0 0.0 0.0 26-27 0.575 0.0 0.0 0.0 0.0 28-29 0.575 0.0 0.0 0.0 0.0 30-31 0.575 0.0 0.0 0.0 0.0 32-33 0.625 0.0 0.0 0.0 0.0 34-35 0.65 0.0 0.0 0.0 0.0 36-37 0.7124999999999999 0.0 0.0 0.0 0.0 38-39 0.775 0.0 0.0 0.0 0.0 40-41 0.875 0.0 0.0 0.0 0.0 42-43 0.9624999999999999 0.0 0.0 0.0 0.0 44-45 1.025 0.0 0.0 0.0 0.0 46-47 1.0875 0.0 0.0 0.0 0.0 48-49 1.15 0.0 0.0 0.0 0.0 50-51 1.35 0.0 0.0 0.0 0.0 52-53 1.4875 0.0 0.0 0.0 0.0 54-55 1.5875 0.0 0.0 0.0 0.0 56-57 1.6875 0.0 0.0 0.0 0.0 58-59 1.9874999999999998 0.0 0.0 0.0 0.0 60-61 2.25 0.0 0.0 0.0 0.0 62-63 2.5250000000000004 0.0 0.0 0.0 0.0 64-65 2.8875 0.0 0.0 0.0 0.0 66-67 3.1625 0.0 0.0 0.0 0.0 68-69 3.3875 0.0 0.0 0.0 0.0 70-71 3.8 0.0 0.0 0.0 0.0 72-73 4.1 0.0 0.0 0.0 0.0 74-75 4.55 0.0 0.0 0.0 0.0 76-77 5.175 0.0 0.0 0.0 0.0 78-79 5.65 0.0 0.0 0.0 0.0 80-81 6.0875 0.0 0.0 0.0 0.0 82-83 6.575 0.0 0.0 0.0 0.0 84-85 7.2875 0.0 0.0 0.0 0.0 86-87 7.875 0.0 0.0 0.0 0.0 88-89 8.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317451 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317451_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.09675 33.0 31.0 34.0 30.0 34.0 2 32.026 34.0 31.0 34.0 30.0 34.0 3 31.9895 34.0 31.0 34.0 30.0 34.0 4 35.3655 37.0 35.0 37.0 33.0 37.0 5 35.528 37.0 35.0 37.0 33.0 37.0 6 35.6345 37.0 37.0 37.0 35.0 37.0 7 35.721 37.0 37.0 37.0 35.0 37.0 8 35.708 37.0 37.0 37.0 35.0 37.0 9 37.51025 39.0 39.0 39.0 35.0 39.0 10-11 37.67375 39.0 39.0 39.0 35.0 39.0 12-13 37.67175 39.0 39.0 39.0 35.0 39.0 14-15 39.0865 41.0 40.0 41.0 36.0 41.0 16-17 39.1285 41.0 40.0 41.0 36.0 41.0 18-19 39.05075 41.0 40.0 41.0 36.0 41.0 20-21 38.991875 41.0 40.0 41.0 36.0 41.0 22-23 38.911 41.0 40.0 41.0 35.5 41.0 24-25 38.797 41.0 39.0 41.0 35.0 41.0 26-27 38.704499999999996 41.0 39.0 41.0 35.0 41.0 28-29 38.66375 41.0 39.0 41.0 35.0 41.0 30-31 38.51775 41.0 39.0 41.0 35.0 41.0 32-33 38.444125 41.0 39.0 41.0 35.0 41.0 34-35 38.257125 40.0 38.5 41.0 34.5 41.0 36-37 38.1055 40.0 38.0 41.0 34.0 41.0 38-39 38.019875 40.0 38.0 41.0 34.0 41.0 40-41 38.113375000000005 40.0 38.0 41.0 34.0 41.0 42-43 38.066125 40.0 38.0 41.0 34.0 41.0 44-45 37.942875 40.0 38.0 41.0 33.5 41.0 46-47 37.812125 40.0 38.0 41.0 33.0 41.0 48-49 37.620625000000004 40.0 37.0 41.0 33.0 41.0 50-51 36.9135 39.5 36.0 40.5 32.0 41.0 52-53 36.778625 39.5 36.0 40.5 32.0 41.0 54-55 36.88575 40.0 35.0 41.0 31.5 41.0 56-57 36.734375 39.0 35.0 41.0 31.5 41.0 58-59 36.521125 39.0 35.0 41.0 31.0 41.0 60-61 36.2535 39.0 35.0 41.0 31.0 41.0 62-63 35.7995 38.0 35.0 40.5 30.0 41.0 64-65 35.530125 37.5 35.0 40.0 30.0 41.0 66-67 35.38575 37.0 35.0 40.0 30.0 41.0 68-69 35.14 36.5 35.0 39.0 30.5 41.0 70-71 34.8345 36.0 35.0 39.0 30.0 41.0 72-73 34.447 35.5 35.0 39.0 30.0 40.5 74-75 33.94625 35.0 35.0 37.0 29.0 39.5 76-77 33.567125000000004 35.0 34.0 37.0 29.0 39.0 78-79 33.327 35.0 34.0 36.5 29.0 39.0 80-81 33.057 35.0 34.0 36.0 29.0 37.0 82-83 32.84 35.0 34.0 36.0 29.0 37.0 84-85 32.528875 35.0 34.0 35.0 27.0 37.0 86-87 32.385125 35.0 34.0 35.0 27.5 36.0 88-89 32.207625 35.0 34.0 35.0 27.0 36.0 90-91 32.080625 35.0 34.0 35.0 27.0 36.0 92-93 31.84525 35.0 33.5 35.0 26.0 36.0 94-95 31.654875 35.0 33.5 35.0 25.0 35.0 96-97 31.502375 35.0 33.0 35.0 25.0 35.0 98-99 31.252375 35.0 33.0 35.0 23.5 35.0 100-101 29.5025 33.5 30.0 35.0 11.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 46.0 3 5.0 4 4.0 5 7.0 6 4.0 7 3.0 8 3.0 9 6.0 10 3.0 11 5.0 12 5.0 13 3.0 14 9.0 15 7.0 16 8.0 17 5.0 18 6.0 19 8.0 20 6.0 21 12.0 22 13.0 23 13.0 24 13.0 25 19.0 26 28.0 27 30.0 28 27.0 29 28.0 30 42.0 31 58.0 32 68.0 33 104.0 34 138.0 35 241.0 36 477.0 37 901.0 38 1358.0 39 287.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.75 10.8 28.275 29.175 2 28.275 10.15 24.525 37.05 3 23.375 13.200000000000001 28.225 35.199999999999996 4 24.575 11.799999999999999 26.3 37.325 5 24.525 14.025000000000002 24.8 36.65 6 26.3 18.925 28.9 25.874999999999996 7 19.225 23.925 39.825 17.025000000000002 8 17.599999999999998 24.925 35.55 21.925 9 18.625 27.650000000000002 33.925 19.8 10-11 19.787499999999998 27.462500000000002 32.05 20.7 12-13 20.005001250312578 28.107026756689173 31.845461365341336 20.042510627656913 14-15 20.740092511563944 26.665833229153645 29.91623952994124 22.677834729341168 16-17 21.230307576894223 26.19404851212803 29.144786196549138 23.43085771442861 18-19 20.92296148074037 27.026013006503252 28.751875937968986 23.299149574787396 20-21 21.07303651825913 25.625312656328163 28.92696348174087 24.374687343671837 22-23 21.465183147893487 25.415676959619955 28.20352544068008 24.915614451806476 24-25 20.45 26.5125 28.675 24.3625 26-27 21.349999999999998 26.6625 28.3125 23.674999999999997 28-29 21.475 25.4375 27.650000000000002 25.4375 30-31 20.6875 26.3125 28.512500000000003 24.4875 32-33 22.125 25.674999999999997 28.1625 24.0375 34-35 21.7875 24.6 28.012500000000003 25.6 36-37 21.3875 25.7125 28.225 24.675 38-39 23.0 25.724999999999998 27.037499999999998 24.2375 40-41 22.412499999999998 24.8625 27.0625 25.662499999999998 42-43 22.402800350043755 25.753219152394045 27.440930116264532 24.40305038129766 44-45 22.577822227778473 25.890736342042754 26.52831603950494 25.003125390673837 46-47 21.880470117529384 25.64391097774444 26.744186046511626 25.731432858214554 48-49 21.9375 26.737499999999997 27.037499999999998 24.2875 50-51 22.775000000000002 26.224999999999998 26.525 24.474999999999998 52-53 22.5625 24.975 25.95 26.5125 54-55 22.037499999999998 26.5 28.1875 23.275000000000002 56-57 22.55 24.962500000000002 26.8 25.687500000000004 58-59 21.712500000000002 25.275 27.125 25.887500000000003 60-61 21.6875 27.1 28.000000000000004 23.2125 62-63 22.7125 26.325 26.8125 24.15 64-65 22.7625 25.6125 26.487500000000004 25.137500000000003 66-67 22.4625 26.6 27.6625 23.275000000000002 68-69 23.549999999999997 25.374999999999996 26.174999999999997 24.9 70-71 22.7 26.9125 25.75 24.637500000000003 72-73 22.10276284535567 25.753219152394045 26.690836354544317 25.453181647705964 74-75 22.7625 26.787499999999998 26.687499999999996 23.7625 76-77 22.8 25.837500000000002 26.0625 25.3 78-79 22.6 26.900000000000002 25.75 24.75 80-81 23.225 26.087500000000002 26.625 24.0625 82-83 23.2875 25.525 25.224999999999998 25.9625 84-85 24.3125 25.900000000000002 26.2125 23.575 86-87 24.9125 25.6125 25.412499999999998 24.0625 88-89 23.375 26.137500000000003 25.5375 24.95 90-91 24.2625 26.5375 25.900000000000002 23.3 92-93 24.099999999999998 25.662499999999998 26.25 23.9875 94-95 24.0625 25.900000000000002 26.2625 23.775 96-97 25.112499999999997 25.137500000000003 26.275 23.474999999999998 98-99 24.5125 26.187500000000004 25.337500000000002 23.962500000000002 100-101 25.05 24.625 25.637500000000003 24.6875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 18.0 1 13.5 2 8.0 3 4.5 4 2.5 5 3.0 6 2.0 7 1.0 8 0.5 9 0.0 10 0.5 11 1.5 12 1.5 13 1.5 14 1.0 15 0.5 16 1.0 17 1.0 18 1.5 19 1.5 20 2.0 21 2.5 22 1.5 23 2.0 24 2.0 25 1.5 26 4.5 27 6.0 28 5.5 29 8.5 30 10.0 31 12.5 32 25.0 33 35.0 34 37.5 35 47.5 36 65.0 37 76.5 38 96.0 39 133.0 40 155.5 41 178.0 42 182.0 43 195.0 44 213.0 45 209.5 46 203.5 47 186.0 48 177.5 49 165.0 50 149.5 51 139.0 52 128.0 53 112.5 54 106.0 55 98.0 56 76.0 57 70.0 58 67.5 59 62.0 60 57.0 61 49.5 62 47.5 63 38.5 64 34.0 65 31.0 66 33.5 67 31.0 68 26.0 69 25.5 70 21.0 71 18.0 72 15.0 73 14.5 74 10.5 75 5.5 76 8.0 77 12.0 78 8.0 79 2.5 80 0.5 81 1.0 82 1.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 1.0 92 1.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.025 14-15 0.0125 16-17 0.025 18-19 0.05 20-21 0.05 22-23 0.0125 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0125 44-45 0.0125 46-47 0.025 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0125 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.92583120204603 96.7 2 0.843989769820972 1.6500000000000001 3 0.1278772378516624 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025575447570332477 0.17500000000000002 8 0.025575447570332477 0.2 9 0.0 0.0 >10 0.051150895140664954 0.8999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 25 0.625 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 11 0.27499999999999997 No Hit TCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 8 0.2 No Hit TCTTCGTATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.3 0.0 0.0 0.0 0.0 7 0.4 0.0 0.0 0.0 0.0 8 0.475 0.0 0.0 0.0 0.0 9 0.525 0.0 0.0 0.0 0.0 10-11 0.525 0.0 0.0 0.0 0.0 12-13 0.525 0.0 0.0 0.0 0.0 14-15 0.525 0.0 0.0 0.0 0.0 16-17 0.525 0.0 0.0 0.0 0.0 18-19 0.525 0.0 0.0 0.0 0.0 20-21 0.525 0.0 0.0 0.0 0.0 22-23 0.5375000000000001 0.0 0.0 0.0 0.0 24-25 0.5625 0.0 0.0 0.0 0.0 26-27 0.575 0.0 0.0 0.0 0.0 28-29 0.575 0.0 0.0 0.0 0.0 30-31 0.575 0.0 0.0 0.0 0.0 32-33 0.625 0.0 0.0 0.0 0.0 34-35 0.65 0.0 0.0 0.0 0.0 36-37 0.7 0.0 0.0 0.0 0.0 38-39 0.75 0.0 0.0 0.0 0.0 40-41 0.825 0.0 0.0 0.0 0.0 42-43 0.9125000000000001 0.0 0.0 0.0 0.0 44-45 0.975 0.0 0.0 0.0 0.0 46-47 1.0375 0.0 0.0 0.0 0.0 48-49 1.0875 0.0 0.0 0.0 0.0 50-51 1.275 0.0 0.0 0.0 0.0 52-53 1.4125 0.0 0.0 0.0 0.0 54-55 1.5125 0.0 0.0 0.0 0.0 56-57 1.6125 0.0 0.0 0.0 0.0 58-59 1.9375 0.0 0.0 0.0 0.0 60-61 2.2 0.0 0.0 0.0 0.0 62-63 2.5125 0.0 0.0 0.0 0.0 64-65 2.9 0.0 0.0 0.0 0.0 66-67 3.2125 0.0 0.0 0.0 0.0 68-69 3.4375 0.0 0.0 0.0 0.0 70-71 3.8625 0.0 0.0 0.0 0.0 72-73 4.175000000000001 0.0 0.0 0.0 0.0 74-75 4.6375 0.0 0.0 0.0 0.0 76-77 5.2625 0.0 0.0 0.0 0.0 78-79 5.7625 0.0 0.0 0.0 0.0 80-81 6.2125 0.0 0.0 0.0 0.0 82-83 6.675 0.0 0.0 0.0 0.0 84-85 7.4 0.0 0.0 0.0 0.0 86-87 7.9625 0.0 0.0 0.0 0.0 88-89 8.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1844260 spots for ERR3317451.sra Written 1844260 spots for ERR3317451.sra Read 1844260 spots for ERR3317451.sra Written 1844260 spots for ERR3317451.sra Read 1844260 spots for ERR3317451.sra Written 1844260 spots for ERR3317451.sra Read 1844260 spots for ERR3317451.sra Written 1844260 spots for ERR3317451.sra Read 1844260 spots for ERR3317451.sra Written 1844260 spots for ERR3317451.sra Read 1844260 spots for ERR3317451.sra Written 1844260 spots for ERR3317451.sra Read 1844260 spots for ERR3317451.sra Written 1844260 spots for ERR3317451.sra Read 1844260 spots for ERR3317451.sra Written 1844260 spots for ERR3317451.sra Read 1844260 spots for ERR3317451.sra Written 1844260 spots for ERR3317451.sra Read 1844260 spots for ERR3317451.sra Written 1844260 spots for ERR3317451.sra Read 1844260 spots for ERR3317451.sra Written 1844260 spots for ERR3317451.sra Read 1844265 spots for ERR3317451.sra Written 1844265 spots for ERR3317451.sra Read 1844260 spots for ERR3317451.sra Written 1844260 spots for ERR3317451.sra Read 1844260 spots for ERR3317451.sra Written 1844260 spots for ERR3317451.sra Read 1844260 spots for ERR3317451.sra Written 1844260 spots for ERR3317451.sra Read 1844260 spots for ERR3317451.sra Written 1844260 spots for ERR3317451.sra Read 1844260 spots for ERR3317451.sra Written 1844260 spots for ERR3317451.sra Read 1844260 spots for ERR3317451.sra Written 1844260 spots for ERR3317451.sra Read 1844260 spots for ERR3317451.sra Written 1844260 spots for ERR3317451.sra Read 1844260 spots for ERR3317451.sra Written 1844260 spots for ERR3317451.sra SRR ids: ['ERR3317451.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lq8vh5qh ERR3317451.sra spots: 36885205 blocks: [[1, 1844260], [1844261, 3688520], [3688521, 5532780], [5532781, 7377040], [7377041, 9221300], [9221301, 11065560], [11065561, 12909820], [12909821, 14754080], [14754081, 16598340], [16598341, 18442600], [18442601, 20286860], [20286861, 22131120], [22131121, 23975380], [23975381, 25819640], [25819641, 27663900], [27663901, 29508160], [29508161, 31352420], [31352421, 33196680], [33196681, 35040940], [35040941, 36885205]] ERR3317451 file size 8875414 ERR3317451 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317451 ERR3317451_1.fastq ERR3317451_2.fastq Input file: ERR3317451_1.fastq Paired file: ERR3317451_2.fastq trimmed: ERR3317451-trimmed-pair1.fastq, ERR3317451-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:49:32 2024 >> started Tue Dec 10 09:50:22 2024 >> done (50.101s) 36885205 read pairs processed; of these: 331274 ( 0.90%) short read pairs filtered out after trimming by size control 602373 ( 1.63%) empty read pairs filtered out after trimming by size control 35951558 (97.47%) read pairs available; of these: 10933801 (30.41%) trimmed read pairs available after processing 25017757 (69.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1040 0.00% 19 1222 0.00% 20 1828 0.01% 21 2094 0.01% 22 2501 0.01% 23 3473 0.01% 24 4073 0.01% 25 4839 0.01% 26 5356 0.01% 27 6324 0.02% 28 6926 0.02% 29 8375 0.02% 30 9277 0.03% 31 13278 0.04% 32 12011 0.03% 33 12688 0.04% 34 15633 0.04% 35 15757 0.04% 36 17115 0.05% 37 17872 0.05% 38 20967 0.06% 39 22259 0.06% 40 22066 0.06% 41 23884 0.07% 42 25778 0.07% 43 26967 0.08% 44 28538 0.08% 45 29209 0.08% 46 31123 0.09% 47 35731 0.10% 48 36166 0.10% 49 37689 0.10% 50 41899 0.12% 51 41527 0.12% 52 42913 0.12% 53 48360 0.13% 54 51538 0.14% 55 53791 0.15% 56 54554 0.15% 57 56375 0.16% 58 59560 0.17% 59 74935 0.21% 60 85715 0.24% 61 90684 0.25% 62 95687 0.27% 63 99619 0.28% 64 108670 0.30% 65 112247 0.31% 66 121590 0.34% 67 124283 0.35% 68 123339 0.34% 69 126566 0.35% 70 127945 0.36% 71 134197 0.37% 72 138775 0.39% 73 152028 0.42% 74 147327 0.41% 75 148181 0.41% 76 147678 0.41% 77 157139 0.44% 78 171327 0.48% 79 168919 0.47% 80 173389 0.48% 81 173774 0.48% 82 177415 0.49% 83 186176 0.52% 84 200577 0.56% 85 201663 0.56% 86 206477 0.57% 87 214015 0.60% 88 217919 0.61% 89 238351 0.66% 90 230321 0.64% 91 236077 0.66% 92 249559 0.69% 93 259017 0.72% 94 282812 0.79% 95 311560 0.87% 96 347606 0.97% 97 410864 1.14% 98 499522 1.39% 99 689209 1.92% 100 1818071 5.06% 101 25017757 69.59% 35951558 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=3.10 fanout-score-rank=15 prefix-density=0.64 prefix-fanout=2.7 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.11 sequence-density-rank=15 fanout-score=32.02 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=8.8 sequence=TCCTCCTCCGCCGCCTCGGACGATCGATTCTTTGTAATGAGAATTCGAAGTATCGAACTCGATCCCAACAGT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.97 fanout-score-rank=18 prefix-density=0.57 prefix-fanout=1.0 sequence=ATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=48 fanout-score=83.62 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.6 sequence=CTCCTTGTTGTACATCCCAGGGAGCTGCACGTTGGTGGGGGCATCCGCGATGTTCATCAGGGTGGCGTTAACCATCTGGTTGTTGACAGTGTACTGGGTGGTCCCGCCCATCCGACCCGCACCAGCGTCGAGATCGTTGATGAAGAGGCAGCACATCTTACCCTTCTTGATCAAGTCTGCGGCCTCACGGTACCGCTGCCTGATCAGCTTGGCTGGCTCTCCGGCGTTTCCGCTCTCCAGCTCTCCGGCACTCATCATGATTGGGTTGATGCCCATCTTGGCGAAGACAAGCTCACATTGGAAGGATTTTCCTTGACCCTTGCCTCCCCAGATACCCAAGATGAGTGGCACCTTGATGTTGGGCAGGGTCATGAAGTTCTTGG ERR3317451 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:50:59 Started mapping on | Dec 10 09:50:59 Finished on | Dec 10 09:52:50 Mapping speed, Million of reads per hour | 1166.00 Number of input reads | 35951558 Average input read length | 191 UNIQUE READS: Uniquely mapped reads number | 32670170 Uniquely mapped reads % | 90.87% Average mapped length | 190.39 Number of splices: Total | 19856883 Number of splices: Annotated (sjdb) | 18879569 Number of splices: GT/AG | 19577876 Number of splices: GC/AG | 251084 Number of splices: AT/AC | 12140 Number of splices: Non-canonical | 15783 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.00% Deletion average length | 1.22 Insertion rate per base | 0.00% Insertion average length | 1.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2398739 % of reads mapped to multiple loci | 6.67% Number of reads mapped to too many loci | 41074 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.62% % of reads unmapped: other | 0.72% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1027910 1027910 1027910 N_multimapping 2398739 2398739 2398739 N_noFeature 1197325 2446493 30738380 N_ambiguous 932339 273189 12498 UnstrandedReadsAssigned:30540506 PositiveStrandReadsAssigned:29950488 NegativeStrandReadsAssigned:1919292 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=99 echo kmer=95 ERR3317451 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317451-trimmed-pair1.fastq ERR3317451-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,951,558 reads, 31,969,814 reads pseudoaligned [quant] estimated average fragment length: 180.871 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,198 rounds 52973 ERR3317451.ke.tsv 35125 ERR3317451.se.tsv 88098 total ==> ERR3317451.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 756.356 0 0 PNS24247 1044 864.129 21.3491 1.18765 PNS24249 1928 1748.13 81.0666 2.22924 PNS24246 1044 864.129 21.3491 1.18765 PNS24248 1044 864.129 21.3491 1.18765 PNS24244 1471 1291.13 235.886 8.78256 PNS24243 293 136.649 0 0 KQK14069 1603 1423.13 1086.3 36.6937 KQK14071 474 299.734 1.41474 0.226897 ==> ERR3317451.se.tsv <== BRADI_1g14170v3 1220 BRADI_1g53295v3 47 BRADI_1g59795v3 288 BRADI_1g07683v3 0 BRADI_1g00485v3 95 BRADI_1g20270v3 2497 BRADI_1g74790v3 703 BRADI_1g09890v3 12 BRADI_1g77505v3 332 BRADI_1g48960v3 0 ERR3317451 completed mapping pipeline successfully