Starting /dee2/code/volunteer_pipeline.sh ERR3317453 current disk space = 1525007958016 free memory = 1506316928 ERR3317453 SRAfilesize 1554c405ec5ec35d56d14d526285b957 ERR3317453.sra ERR3317453.sra file validated ERR3317453 is paired end ERR3317453 is conventional basespace ERR3317453 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317453_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.54425 34.0 31.0 34.0 31.0 34.0 2 32.3475 34.0 31.0 34.0 31.0 34.0 3 32.91975 34.0 33.0 34.0 31.0 34.0 4 36.39425 37.0 37.0 37.0 35.0 37.0 5 36.442 37.0 37.0 37.0 35.0 37.0 6 36.41225 37.0 37.0 37.0 35.0 37.0 7 36.45925 37.0 37.0 37.0 35.0 37.0 8 36.5005 37.0 37.0 37.0 35.0 37.0 9 38.32825 39.0 39.0 39.0 37.0 39.0 10-11 38.27575 39.0 39.0 39.0 37.0 39.0 12-13 38.27975 39.0 39.0 39.0 37.0 39.0 14-15 39.768625 41.0 40.0 41.0 37.5 41.0 16-17 39.782250000000005 41.0 40.0 41.0 38.0 41.0 18-19 39.753125 41.0 40.0 41.0 37.5 41.0 20-21 39.685874999999996 41.0 40.0 41.0 37.0 41.0 22-23 39.617999999999995 41.0 40.0 41.0 37.0 41.0 24-25 39.54425 41.0 40.0 41.0 37.0 41.0 26-27 39.404125 41.0 40.0 41.0 36.0 41.0 28-29 39.35325 41.0 39.0 41.0 36.5 41.0 30-31 39.091125 41.0 39.0 41.0 36.0 41.0 32-33 38.865375 40.5 38.5 41.0 35.0 41.0 34-35 38.627250000000004 40.0 38.0 41.0 35.0 41.0 36-37 38.580124999999995 40.0 38.0 41.0 34.5 41.0 38-39 38.17675 40.0 38.0 41.0 33.5 41.0 40-41 38.00212500000001 40.0 38.0 41.0 33.0 41.0 42-43 38.056375 40.0 38.0 41.0 33.0 41.0 44-45 37.698625 40.0 37.0 41.0 33.0 41.0 46-47 37.6405 40.0 37.0 41.0 33.0 41.0 48-49 37.337875 40.0 36.0 41.0 32.5 41.0 50-51 37.60925 40.0 36.0 41.0 33.0 41.0 52-53 37.438 40.0 35.5 41.0 33.0 41.0 54-55 37.102625 39.0 35.0 41.0 32.5 41.0 56-57 36.819 39.0 35.0 41.0 32.0 41.0 58-59 36.536375 39.0 35.0 41.0 32.0 41.0 60-61 36.147999999999996 37.5 35.0 41.0 31.0 41.0 62-63 35.739875 37.0 35.0 40.0 31.0 41.0 64-65 35.338375 36.5 35.0 39.5 30.0 41.0 66-67 35.110875 36.0 35.0 39.0 30.0 41.0 68-69 34.684625 35.5 34.5 39.0 30.0 41.0 70-71 34.22725 35.0 34.0 37.5 29.0 40.0 72-73 33.74825 35.0 34.0 37.0 29.0 39.0 74-75 33.4705 35.0 34.0 37.0 29.0 39.0 76-77 32.358375 34.5 32.5 36.0 26.0 37.0 78-79 32.648250000000004 35.0 33.0 36.0 27.0 37.0 80-81 32.411625 35.0 33.0 35.0 27.0 37.0 82-83 32.186375 35.0 33.0 35.0 26.0 36.5 84-85 31.819375 35.0 33.0 35.0 25.0 36.0 86-87 31.57225 35.0 33.0 35.0 24.5 36.0 88-89 31.382625 35.0 33.0 35.0 24.0 35.5 90-91 31.133125 35.0 33.0 35.0 23.5 35.0 92-93 30.8445 35.0 32.0 35.0 20.0 35.0 94-95 30.610500000000002 35.0 32.0 35.0 19.5 35.0 96-97 30.345875 35.0 32.0 35.0 11.5 35.0 98-99 29.892 35.0 32.0 35.0 2.0 35.0 100-101 27.608375 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 6.0 11 5.0 12 8.0 13 4.0 14 7.0 15 9.0 16 11.0 17 12.0 18 11.0 19 10.0 20 12.0 21 21.0 22 14.0 23 16.0 24 19.0 25 23.0 26 26.0 27 32.0 28 40.0 29 63.0 30 64.0 31 72.0 32 78.0 33 109.0 34 207.0 35 297.0 36 602.0 37 990.0 38 1106.0 39 120.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 26.670159811370187 25.884202253078332 18.574796960964107 28.87084097458737 2 25.55 25.8 18.25 30.4 3 25.275 26.450000000000003 19.775000000000002 28.499999999999996 4 25.75 25.5 19.025 29.725 5 29.275000000000002 24.45 16.925 29.349999999999998 6 28.199999999999996 26.55 18.95 26.3 7 28.849999999999998 23.825 20.825 26.5 8 29.599999999999998 27.05 24.4 18.95 9 30.95 26.85 24.6 17.599999999999998 10-11 31.275 27.4125 21.7375 19.575 12-13 30.175 26.5375 23.8625 19.425 14-15 26.887499999999996 27.175 24.587500000000002 21.349999999999998 16-17 28.1 26.237500000000004 23.925 21.7375 18-19 25.75 25.4875 26.387500000000003 22.375 20-21 25.112499999999997 25.75 24.9375 24.2 22-23 26.26578322290286 25.51568946118265 25.240655081885237 22.977872234029252 24-25 25.474999999999998 25.95 25.724999999999998 22.85 26-27 24.20302537817227 25.815726965870734 26.215776972121514 23.76547068383548 28-29 26.737499999999997 25.837500000000002 23.925 23.5 30-31 25.9625 25.9875 25.474999999999998 22.575 32-33 25.8625 25.874999999999996 24.1625 24.099999999999998 34-35 26.0125 25.15 24.349999999999998 24.4875 36-37 25.6 25.4875 26.0 22.912499999999998 38-39 25.900000000000002 25.775 24.625 23.7 40-41 27.2625 24.4375 25.15 23.150000000000002 42-43 25.85 25.650000000000002 24.8125 23.6875 44-45 25.8 25.6 24.625 23.974999999999998 46-47 26.237500000000004 25.412499999999998 24.5375 23.8125 48-49 26.787499999999998 24.55 25.174999999999997 23.4875 50-51 26.424999999999997 26.25 24.3125 23.0125 52-53 25.5625 26.5125 24.65 23.275000000000002 54-55 26.0625 24.775 25.15 24.0125 56-57 25.8 25.8 24.375 24.025 58-59 25.6 25.6 24.2 24.6 60-61 25.575 25.7875 25.974999999999998 22.662499999999998 62-63 25.5 26.275 24.349999999999998 23.875 64-65 25.45 26.337500000000002 24.3625 23.849999999999998 66-67 25.587500000000002 25.637500000000003 25.374999999999996 23.400000000000002 68-69 25.7875 26.275 24.575 23.3625 70-71 25.4 26.75 24.0625 23.7875 72-73 26.5375 26.4125 23.5625 23.4875 74-75 25.974999999999998 26.3 23.9125 23.8125 76-77 26.387500000000003 26.025 23.962500000000002 23.625 78-79 26.05 26.125 24.75 23.075000000000003 80-81 26.650000000000002 25.837500000000002 23.962500000000002 23.549999999999997 82-83 25.374999999999996 26.674999999999997 24.337500000000002 23.6125 84-85 26.0 25.7125 24.675 23.6125 86-87 25.3 26.9125 24.637500000000003 23.150000000000002 88-89 26.0625 26.8375 23.5875 23.5125 90-91 24.8125 26.5625 24.2375 24.3875 92-93 27.1375 26.450000000000003 23.7125 22.7 94-95 26.087500000000002 26.2125 23.849999999999998 23.849999999999998 96-97 26.237500000000004 26.0125 24.962500000000002 22.787499999999998 98-99 25.9625 25.887500000000003 24.025 24.125 100-101 26.787499999999998 26.125 22.95 24.1375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 1.0 12 1.0 13 1.5 14 1.5 15 1.0 16 0.5 17 0.5 18 1.5 19 1.0 20 0.5 21 1.0 22 2.0 23 2.0 24 0.5 25 0.5 26 3.5 27 6.0 28 6.5 29 9.0 30 12.0 31 10.0 32 8.5 33 13.0 34 27.5 35 41.5 36 50.5 37 65.5 38 82.0 39 94.0 40 108.5 41 131.0 42 150.5 43 158.0 44 177.0 45 189.0 46 204.0 47 214.5 48 187.5 49 169.5 50 172.0 51 158.0 52 134.5 53 125.0 54 116.0 55 100.5 56 84.5 57 74.5 58 79.0 59 77.0 60 68.5 61 67.0 62 63.0 63 65.0 64 63.0 65 47.5 66 38.5 67 40.5 68 40.5 69 40.0 70 35.0 71 29.0 72 25.0 73 24.5 74 19.5 75 14.0 76 11.0 77 9.5 78 8.0 79 5.5 80 3.0 81 3.0 82 5.0 83 3.0 84 2.5 85 3.0 86 3.0 87 1.5 88 0.5 89 1.5 90 1.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0125 24-25 0.0 26-27 0.0125 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.26131424188188 96.075 2 1.3295832267962158 2.6 3 0.3579647149066735 1.05 4 0.0 0.0 5 0.025568908207619537 0.125 6 0.025568908207619537 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TATGTACCTTTTTCACACGTTTGTTTCATGTTGTATTTATGCATGTGATC 6 0.15 No Hit CCACGCACACCAGAGCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10-11 0.1375 0.0 0.0 0.0 0.0 12-13 0.15 0.0 0.0 0.0 0.0 14-15 0.15 0.0 0.0 0.0 0.0 16-17 0.15 0.0 0.0 0.0 0.0 18-19 0.15 0.0 0.0 0.0 0.0 20-21 0.16249999999999998 0.0 0.0 0.0 0.0 22-23 0.175 0.0 0.0 0.0 0.0 24-25 0.21250000000000002 0.0 0.0 0.0 0.0 26-27 0.225 0.0 0.0 0.0 0.0 28-29 0.2625 0.0 0.0 0.0 0.0 30-31 0.3 0.0 0.0 0.0 0.0 32-33 0.3375 0.0 0.0 0.0 0.0 34-35 0.4 0.0 0.0 0.0 0.0 36-37 0.4625 0.0 0.0 0.0 0.0 38-39 0.55 0.0 0.0 0.0 0.0 40-41 0.6 0.0 0.0 0.0 0.0 42-43 0.7125 0.0 0.0 0.0 0.0 44-45 0.8125 0.0 0.0 0.0 0.0 46-47 0.8875 0.0 0.0 0.0 0.0 48-49 1.0375 0.0 0.0 0.0 0.0 50-51 1.1 0.0 0.0 0.0 0.0 52-53 1.275 0.0 0.0 0.0 0.0 54-55 1.45 0.0 0.0 0.0 0.0 56-57 1.5625 0.0 0.0 0.0 0.0 58-59 1.7375 0.0 0.0 0.0 0.0 60-61 1.9749999999999999 0.0 0.0 0.0 0.0 62-63 2.175 0.0 0.0 0.0 0.0 64-65 2.4375 0.0 0.0 0.0 0.0 66-67 2.7625 0.0 0.0 0.0 0.0 68-69 3.1 0.0 0.0 0.0 0.0 70-71 3.425 0.0 0.0 0.0 0.0 72-73 3.8 0.0 0.0 0.0 0.0 74-75 4.0875 0.0 0.0 0.0 0.0 76-77 4.5 0.0 0.0 0.0 0.0 78-79 5.025 0.0 0.0 0.0 0.0 80-81 5.5125 0.0 0.0 0.0 0.0 82-83 6.05 0.0 0.0 0.0 0.0 84-85 6.6 0.0 0.0 0.0 0.0 86-87 7.1125 0.0 0.0 0.0 0.0 88-89 7.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317453 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317453_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.98625 33.0 31.0 34.0 30.0 34.0 2 31.9095 34.0 31.0 34.0 30.0 34.0 3 31.79275 34.0 31.0 34.0 30.0 34.0 4 35.16275 37.0 35.0 37.0 33.0 37.0 5 35.38825 37.0 35.0 37.0 35.0 37.0 6 35.50825 37.0 36.0 37.0 35.0 37.0 7 35.5615 37.0 37.0 37.0 35.0 37.0 8 35.546 37.0 37.0 37.0 35.0 37.0 9 37.31725 39.0 39.0 39.0 35.0 39.0 10-11 37.454625 39.0 39.0 39.0 35.0 39.0 12-13 37.378875 39.0 39.0 39.0 35.0 39.0 14-15 38.851375000000004 41.0 40.0 41.0 36.0 41.0 16-17 38.92725 41.0 40.0 41.0 36.5 41.0 18-19 38.82475 41.0 40.0 41.0 36.0 41.0 20-21 38.814875 41.0 40.0 41.0 36.0 41.0 22-23 38.772999999999996 41.0 40.0 41.0 35.5 41.0 24-25 38.681875000000005 41.0 39.0 41.0 35.0 41.0 26-27 38.5985 41.0 39.0 41.0 35.0 41.0 28-29 38.48 41.0 39.0 41.0 35.0 41.0 30-31 38.3395 41.0 39.0 41.0 35.0 41.0 32-33 38.241875 41.0 38.5 41.0 35.0 41.0 34-35 38.119749999999996 40.0 38.0 41.0 34.0 41.0 36-37 37.943875000000006 40.0 38.0 41.0 33.5 41.0 38-39 37.7825 40.0 38.0 41.0 33.0 41.0 40-41 37.968125 40.0 38.0 41.0 33.5 41.0 42-43 37.87375 40.0 38.0 41.0 34.0 41.0 44-45 37.748374999999996 40.0 38.0 41.0 33.5 41.0 46-47 37.561625 40.0 37.5 41.0 33.0 41.0 48-49 37.471000000000004 40.0 37.0 41.0 33.0 41.0 50-51 36.752875 39.5 36.0 40.5 32.0 41.0 52-53 36.591499999999996 39.5 35.0 40.5 31.5 41.0 54-55 36.750375000000005 40.0 35.0 41.0 31.5 41.0 56-57 36.579 39.5 35.0 41.0 31.0 41.0 58-59 36.304125 39.0 35.0 41.0 31.0 41.0 60-61 36.0415 39.0 35.0 41.0 31.0 41.0 62-63 35.6225 38.0 35.0 41.0 30.0 41.0 64-65 35.34525 37.0 35.0 40.0 29.5 41.0 66-67 35.323750000000004 37.0 35.0 40.0 30.5 41.0 68-69 35.0085 36.0 35.0 39.5 30.5 41.0 70-71 34.718 36.0 35.0 39.0 30.0 41.0 72-73 34.376374999999996 35.5 35.0 39.0 30.0 40.5 74-75 33.971125 35.0 35.0 37.0 29.0 39.5 76-77 33.60575 35.0 34.0 37.0 29.0 39.0 78-79 33.251374999999996 35.0 34.0 36.5 29.0 39.0 80-81 32.93025 35.0 34.0 36.0 28.0 37.0 82-83 32.7085 35.0 34.0 36.0 29.0 37.0 84-85 32.476625 35.0 34.0 35.0 28.0 36.5 86-87 32.28175 35.0 34.0 35.0 27.0 36.0 88-89 32.164125 35.0 34.0 35.0 27.0 36.0 90-91 32.051625 35.0 34.0 35.0 27.0 36.0 92-93 31.8435 35.0 33.5 35.0 26.0 35.0 94-95 31.674625 35.0 33.0 35.0 25.5 35.0 96-97 31.397125 35.0 33.0 35.0 24.0 35.0 98-99 31.148125 35.0 33.0 35.0 23.5 35.0 100-101 29.313000000000002 33.5 30.0 34.5 10.5 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 67.0 3 8.0 4 2.0 5 4.0 6 2.0 7 1.0 8 4.0 9 3.0 10 8.0 11 5.0 12 4.0 13 10.0 14 7.0 15 5.0 16 8.0 17 9.0 18 4.0 19 5.0 20 7.0 21 11.0 22 9.0 23 7.0 24 14.0 25 18.0 26 20.0 27 26.0 28 26.0 29 32.0 30 54.0 31 50.0 32 71.0 33 91.0 34 151.0 35 287.0 36 451.0 37 931.0 38 1311.0 39 277.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.7 12.325 28.375 28.599999999999998 2 27.200000000000003 11.05 25.3 36.449999999999996 3 23.45 13.100000000000001 28.375 35.075 4 24.5 11.875 26.575 37.05 5 26.075 14.725 24.474999999999998 34.725 6 25.874999999999996 18.75 29.975 25.4 7 20.549999999999997 23.599999999999998 37.974999999999994 17.875 8 17.75 25.2 36.875 20.175 9 18.704676169042262 28.132033008252062 33.708427106776696 19.454863715928983 10-11 19.91996998874578 27.46029761160435 31.899462298361886 20.720270101287984 12-13 20.527895921941454 27.545659244433324 31.623717788341253 20.302727045283962 14-15 20.69784892446223 26.100550275137568 30.565282641320664 22.63631815907954 16-17 21.26594946209657 25.8443832874656 29.19689767325494 23.692769577182887 18-19 21.428571428571427 26.82011508631474 28.608956717538153 23.14235676757568 20-21 21.403552664498374 26.494871153365025 28.096072054040533 24.00550412809607 22-23 22.679509632224168 23.91793845384038 27.733299974981236 25.66925193895422 24-25 21.03551775887944 26.150575287643825 28.92696348174087 23.88694347173587 26-27 21.082906089783666 25.221958234337876 28.698261848193074 24.99687382768538 28-29 21.8 25.6 26.6625 25.937500000000004 30-31 21.3 25.874999999999996 28.0625 24.762500000000003 32-33 22.412499999999998 24.9375 27.8875 24.762500000000003 34-35 22.877859732466558 25.50318789848731 25.453181647705964 26.16577072134017 36-37 22.115264408051004 26.053256657082137 27.94099262407801 23.89048631078885 38-39 22.59194395796848 25.806855141356017 26.169627220415308 25.431573680260193 40-41 23.06153076538269 24.324662331165584 27.151075537768882 25.46273136568284 42-43 22.291718789091817 25.50662997247936 26.782586940205157 25.41906429822367 44-45 22.95471603702777 25.99449587190393 25.55666750062547 25.494120590442833 46-47 22.892169126845133 25.30647985989492 26.832624468351263 24.96872654490868 48-49 21.313320825515948 27.79237023139462 26.504065040650403 24.390243902439025 50-51 22.573786893446723 25.912956478239117 26.76338169084542 24.749874937468736 52-53 23.0375 25.587500000000002 25.8 25.575 54-55 21.25 26.700000000000003 27.5125 24.5375 56-57 23.1625 25.337500000000002 25.637500000000003 25.8625 58-59 23.225 25.087500000000002 26.85 24.837500000000002 60-61 21.987499999999997 25.3125 27.712500000000002 24.9875 62-63 23.5875 26.0 25.362499999999997 25.05 64-65 23.2875 24.8125 26.525 25.374999999999996 66-67 21.8625 27.700000000000003 25.874999999999996 24.5625 68-69 22.540317539692463 26.440805100637583 25.86573321665208 25.153144143017876 70-71 23.5125 26.0375 25.6 24.85 72-73 23.011505752876438 26.700850425212607 24.83741870935468 25.45022511255628 74-75 23.708890834062775 25.78466925096911 25.57208953357509 24.934350381393024 76-77 24.20302537817227 25.90323790473809 24.803100387548444 25.090636329541194 78-79 23.102887860982623 25.965745718214777 25.84073009126141 25.090636329541194 80-81 23.340417552194022 26.02825353169146 26.190773846730842 24.440555069383674 82-83 23.200000000000003 25.674999999999997 24.925 26.200000000000003 84-85 23.5 26.2125 26.5125 23.775 86-87 24.212500000000002 26.55 25.162499999999998 24.075 88-89 23.849999999999998 24.875 26.200000000000003 25.074999999999996 90-91 23.875 25.412499999999998 26.375 24.337500000000002 92-93 23.8875 25.837500000000002 25.362499999999997 24.9125 94-95 24.975 24.85 25.25 24.925 96-97 25.0125 25.7 25.874999999999996 23.4125 98-99 24.9375 25.7375 25.174999999999997 24.15 100-101 24.6625 24.2625 25.8125 25.2625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 19.0 1 11.5 2 6.5 3 5.5 4 2.0 5 1.5 6 2.5 7 2.5 8 2.0 9 2.5 10 1.0 11 0.0 12 1.5 13 1.5 14 1.0 15 1.5 16 0.5 17 1.0 18 1.5 19 1.5 20 2.5 21 2.0 22 1.5 23 2.5 24 1.5 25 1.0 26 6.5 27 8.0 28 7.5 29 12.5 30 14.5 31 17.0 32 24.0 33 31.0 34 37.5 35 51.0 36 61.5 37 77.5 38 96.0 39 115.0 40 133.5 41 157.5 42 184.5 43 189.5 44 202.0 45 199.5 46 185.0 47 182.5 48 173.0 49 161.0 50 150.0 51 144.0 52 134.0 53 124.0 54 103.0 55 81.5 56 96.0 57 96.0 58 69.5 59 53.0 60 52.0 61 50.5 62 40.5 63 38.0 64 38.5 65 41.0 66 43.0 67 39.0 68 34.5 69 26.5 70 26.5 71 26.0 72 20.5 73 16.5 74 11.0 75 9.5 76 6.5 77 4.0 78 6.0 79 5.5 80 1.5 81 1.0 82 1.0 83 0.5 84 0.0 85 1.5 86 1.5 87 1.0 88 1.5 89 0.5 90 0.0 91 0.0 92 1.0 93 1.5 94 0.5 95 0.0 96 0.5 97 0.5 98 1.0 99 2.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-11 0.0375 12-13 0.075 14-15 0.05 16-17 0.075 18-19 0.075 20-21 0.075 22-23 0.075 24-25 0.05 26-27 0.0375 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0125 36-37 0.0125 38-39 0.075 40-41 0.05 42-43 0.075 44-45 0.075 46-47 0.075 48-49 0.0625 50-51 0.05 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0125 70-71 0.0 72-73 0.05 74-75 0.0375 76-77 0.0125 78-79 0.0125 80-81 0.0125 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.90025575447571 96.675 2 0.8951406649616368 1.7500000000000002 3 0.1278772378516624 0.375 4 0.025575447570332477 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.051150895140664954 1.0999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 32 0.8 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 12 0.3 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10-11 0.1375 0.0 0.0 0.0 0.0 12-13 0.15 0.0 0.0 0.0 0.0 14-15 0.15 0.0 0.0 0.0 0.0 16-17 0.15 0.0 0.0 0.0 0.0 18-19 0.15 0.0 0.0 0.0 0.0 20-21 0.16249999999999998 0.0 0.0 0.0 0.0 22-23 0.175 0.0 0.0 0.0 0.0 24-25 0.2 0.0 0.0 0.0 0.0 26-27 0.2 0.0 0.0 0.0 0.0 28-29 0.23750000000000002 0.0 0.0 0.0 0.0 30-31 0.275 0.0 0.0 0.0 0.0 32-33 0.3375 0.0 0.0 0.0 0.0 34-35 0.4 0.0 0.0 0.0 0.0 36-37 0.4625 0.0 0.0 0.0 0.0 38-39 0.55 0.0 0.0 0.0 0.0 40-41 0.6 0.0 0.0 0.0 0.0 42-43 0.7125 0.0 0.0 0.0 0.0 44-45 0.8125 0.0 0.0 0.0 0.0 46-47 0.8875 0.0 0.0 0.0 0.0 48-49 1.0375 0.0 0.0 0.0 0.0 50-51 1.1 0.0 0.0 0.0 0.0 52-53 1.275 0.0 0.0 0.0 0.0 54-55 1.45 0.0 0.0 0.0 0.0 56-57 1.5625 0.0 0.0 0.0 0.0 58-59 1.725 0.0 0.0 0.0 0.0 60-61 1.9375 0.0 0.0 0.0 0.0 62-63 2.125 0.0 0.0 0.0 0.0 64-65 2.375 0.0 0.0 0.0 0.0 66-67 2.7 0.0 0.0 0.0 0.0 68-69 3.0375 0.0 0.0 0.0 0.0 70-71 3.35 0.0 0.0 0.0 0.0 72-73 3.7 0.0 0.0 0.0 0.0 74-75 3.9875 0.0 0.0 0.0 0.0 76-77 4.4 0.0 0.0 0.0 0.0 78-79 4.9125 0.0 0.0 0.0 0.0 80-81 5.4125 0.0 0.0 0.0 0.0 82-83 5.95 0.0 0.0 0.0 0.0 84-85 6.5 0.0 0.0 0.0 0.0 86-87 7.0125 0.0 0.0 0.0 0.0 88-89 7.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1917637 spots for ERR3317453.sra Written 1917637 spots for ERR3317453.sra Read 1917637 spots for ERR3317453.sra Written 1917637 spots for ERR3317453.sra Read 1917637 spots for ERR3317453.sra Written 1917637 spots for ERR3317453.sra Read 1917637 spots for ERR3317453.sra Written 1917637 spots for ERR3317453.sra Read 1917637 spots for ERR3317453.sra Written 1917637 spots for ERR3317453.sra Read 1917637 spots for ERR3317453.sra Written 1917637 spots for ERR3317453.sra Read 1917650 spots for ERR3317453.sra Written 1917650 spots for ERR3317453.sra Read 1917637 spots for ERR3317453.sra Written 1917637 spots for ERR3317453.sra Read 1917637 spots for ERR3317453.sra Written 1917637 spots for ERR3317453.sra Read 1917637 spots for ERR3317453.sra Written 1917637 spots for ERR3317453.sra Read 1917637 spots for ERR3317453.sra Written 1917637 spots for ERR3317453.sra Read 1917637 spots for ERR3317453.sra Written 1917637 spots for ERR3317453.sra Read 1917637 spots for ERR3317453.sra Written 1917637 spots for ERR3317453.sra Read 1917637 spots for ERR3317453.sra Written 1917637 spots for ERR3317453.sra Read 1917637 spots for ERR3317453.sra Written 1917637 spots for ERR3317453.sra Read 1917637 spots for ERR3317453.sra Written 1917637 spots for ERR3317453.sra Read 1917637 spots for ERR3317453.sra Written 1917637 spots for ERR3317453.sra Read 1917637 spots for ERR3317453.sra Written 1917637 spots for ERR3317453.sra Read 1917637 spots for ERR3317453.sra Written 1917637 spots for ERR3317453.sra Read 1917637 spots for ERR3317453.sra Written 1917637 spots for ERR3317453.sra SRR ids: ['ERR3317453.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a_s99z47 ERR3317453.sra spots: 38352753 blocks: [[1, 1917637], [1917638, 3835274], [3835275, 5752911], [5752912, 7670548], [7670549, 9588185], [9588186, 11505822], [11505823, 13423459], [13423460, 15341096], [15341097, 17258733], [17258734, 19176370], [19176371, 21094007], [21094008, 23011644], [23011645, 24929281], [24929282, 26846918], [26846919, 28764555], [28764556, 30682192], [30682193, 32599829], [32599830, 34517466], [34517467, 36435103], [36435104, 38352753]] ERR3317453 file size 9229403 ERR3317453 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317453 ERR3317453_1.fastq ERR3317453_2.fastq Input file: ERR3317453_1.fastq Paired file: ERR3317453_2.fastq trimmed: ERR3317453-trimmed-pair1.fastq, ERR3317453-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:49:10 2024 >> started Tue Dec 10 09:50:33 2024 >> done (82.738s) 38352753 read pairs processed; of these: 299571 ( 0.78%) short read pairs filtered out after trimming by size control 685701 ( 1.79%) empty read pairs filtered out after trimming by size control 37367481 (97.43%) read pairs available; of these: 11156641 (29.86%) trimmed read pairs available after processing 26210840 (70.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1064 0.00% 19 1239 0.00% 20 1817 0.00% 21 2212 0.01% 22 2635 0.01% 23 3744 0.01% 24 4273 0.01% 25 5467 0.01% 26 5898 0.02% 27 7003 0.02% 28 7610 0.02% 29 9211 0.02% 30 10088 0.03% 31 13386 0.04% 32 11979 0.03% 33 12661 0.03% 34 15320 0.04% 35 15697 0.04% 36 17653 0.05% 37 18436 0.05% 38 21234 0.06% 39 22995 0.06% 40 22082 0.06% 41 23965 0.06% 42 25262 0.07% 43 27397 0.07% 44 29303 0.08% 45 29104 0.08% 46 31379 0.08% 47 34235 0.09% 48 35089 0.09% 49 36637 0.10% 50 40570 0.11% 51 40128 0.11% 52 41819 0.11% 53 46665 0.12% 54 50190 0.13% 55 52630 0.14% 56 53313 0.14% 57 55224 0.15% 58 61452 0.16% 59 76239 0.20% 60 86463 0.23% 61 93098 0.25% 62 97161 0.26% 63 101596 0.27% 64 109426 0.29% 65 114160 0.31% 66 126804 0.34% 67 126321 0.34% 68 125628 0.34% 69 128645 0.34% 70 130413 0.35% 71 135661 0.36% 72 142780 0.38% 73 151769 0.41% 74 148674 0.40% 75 148259 0.40% 76 147443 0.39% 77 153527 0.41% 78 167800 0.45% 79 166561 0.45% 80 172006 0.46% 81 172882 0.46% 82 174433 0.47% 83 184327 0.49% 84 200408 0.54% 85 195068 0.52% 86 200334 0.54% 87 211015 0.56% 88 214207 0.57% 89 227800 0.61% 90 226429 0.61% 91 235464 0.63% 92 247939 0.66% 93 263039 0.70% 94 287167 0.77% 95 316341 0.85% 96 356802 0.95% 97 428031 1.15% 98 523454 1.40% 99 727716 1.95% 100 1965285 5.26% 101 26210840 70.14% 37367481 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=14 prefix-density=0.71 prefix-fanout=2.7 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.16 sequence-density-rank=10 fanout-score=18.07 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=6.3 sequence=TCCTCCTCCTCCGCCG criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=29 prefix-density=0.27 prefix-fanout=2.1 sequence=CTCCGATCCCGA criterion=fanout-score sequence-density=0.11 sequence-density-rank=17 fanout-score=79.79 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=17.0 sequence=CCTTCTTCTCCTCCTTGGTGGCCTTGGAGGAGATGACGGTCTTG ERR3317453 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:51:17 Started mapping on | Dec 10 09:51:17 Finished on | Dec 10 09:53:20 Mapping speed, Million of reads per hour | 1093.68 Number of input reads | 37367481 Average input read length | 192 UNIQUE READS: Uniquely mapped reads number | 34047833 Uniquely mapped reads % | 91.12% Average mapped length | 190.90 Number of splices: Total | 20430920 Number of splices: Annotated (sjdb) | 19395893 Number of splices: GT/AG | 20138289 Number of splices: GC/AG | 262175 Number of splices: AT/AC | 14999 Number of splices: Non-canonical | 15457 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.00% Deletion average length | 1.24 Insertion rate per base | 0.00% Insertion average length | 1.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1992587 % of reads mapped to multiple loci | 5.33% Number of reads mapped to too many loci | 87893 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.67% % of reads unmapped: other | 1.65% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1491346 1491346 1491346 N_multimapping 1992587 1992587 1992587 N_noFeature 1199249 2322129 32209884 N_ambiguous 993666 324497 14960 UnstrandedReadsAssigned:31854918 PositiveStrandReadsAssigned:31401207 NegativeStrandReadsAssigned:1822989 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 ERR3317453 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317453-trimmed-pair1.fastq ERR3317453-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,367,481 reads, 32,929,717 reads pseudoaligned [quant] estimated average fragment length: 192.161 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52973 ERR3317453.ke.tsv 35125 ERR3317453.se.tsv 88098 total ==> ERR3317453.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 745.048 0 0 PNS24247 1044 852.839 39.9805 2.12831 PNS24249 1928 1736.84 76.9993 2.01271 PNS24246 1044 852.839 39.9805 2.12831 PNS24248 1044 852.839 39.9805 2.12831 PNS24244 1471 1279.84 182.059 6.45821 PNS24243 293 132.498 1 0.342645 KQK14069 1603 1411.84 653.425 21.0119 KQK14071 474 290.407 4.24258 0.663252 ==> ERR3317453.se.tsv <== BRADI_1g14170v3 778 BRADI_1g53295v3 523 BRADI_1g59795v3 343 BRADI_1g07683v3 0 BRADI_1g00485v3 119 BRADI_1g20270v3 2875 BRADI_1g74790v3 310 BRADI_1g09890v3 12 BRADI_1g77505v3 466 BRADI_1g48960v3 0 ERR3317453 completed mapping pipeline successfully