Starting /dee2/code/volunteer_pipeline.sh ERR3317454 current disk space = 1524937334784 free memory = 1513725980 ERR3317454 SRAfilesize fe70166fb737c4b12f8b04a958dd70ca ERR3317454.sra ERR3317454.sra file validated ERR3317454 is paired end ERR3317454 is conventional basespace ERR3317454 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317454_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6715 34.0 31.0 34.0 31.0 34.0 2 32.44525 34.0 33.0 34.0 31.0 34.0 3 32.95075 34.0 33.0 34.0 31.0 34.0 4 36.443 37.0 37.0 37.0 35.0 37.0 5 36.45125 37.0 37.0 37.0 35.0 37.0 6 36.5095 37.0 37.0 37.0 35.0 37.0 7 36.49075 37.0 37.0 37.0 35.0 37.0 8 36.46775 37.0 37.0 37.0 35.0 37.0 9 38.33275 39.0 39.0 39.0 37.0 39.0 10-11 38.2945 39.0 39.0 39.0 37.0 39.0 12-13 38.25775 39.0 39.0 39.0 37.0 39.0 14-15 39.833625 41.0 40.0 41.0 38.0 41.0 16-17 39.861875 41.0 40.0 41.0 38.0 41.0 18-19 39.835625 41.0 40.0 41.0 38.0 41.0 20-21 39.742125 41.0 40.0 41.0 37.5 41.0 22-23 39.632875 41.0 40.0 41.0 37.0 41.0 24-25 39.555375 41.0 40.0 41.0 37.0 41.0 26-27 39.42 41.0 40.0 41.0 36.5 41.0 28-29 39.178 41.0 39.0 41.0 36.0 41.0 30-31 39.145875000000004 41.0 39.0 41.0 35.5 41.0 32-33 38.746624999999995 40.0 38.5 41.0 34.5 41.0 34-35 38.677125000000004 40.0 38.0 41.0 35.0 41.0 36-37 38.428749999999994 40.0 38.0 41.0 34.0 41.0 38-39 38.23075 40.0 38.0 41.0 34.0 41.0 40-41 38.031625 40.0 37.5 41.0 33.0 41.0 42-43 38.03575 40.0 38.0 41.0 33.0 41.0 44-45 37.934 40.0 37.5 41.0 33.0 41.0 46-47 37.619625 40.0 36.5 41.0 32.5 41.0 48-49 37.282375 40.0 36.0 41.0 32.0 41.0 50-51 37.591750000000005 40.0 36.0 41.0 33.0 41.0 52-53 37.529375 40.0 36.0 41.0 33.0 41.0 54-55 37.231 39.5 35.0 41.0 33.0 41.0 56-57 36.954125000000005 39.0 35.0 41.0 32.0 41.0 58-59 36.577 39.0 35.0 41.0 32.0 41.0 60-61 36.22125 38.0 35.0 41.0 31.0 41.0 62-63 35.8505 37.0 35.0 40.0 31.0 41.0 64-65 35.407375 37.0 35.0 40.0 30.0 41.0 66-67 35.13725 36.0 35.0 39.0 30.0 41.0 68-69 34.77225 36.0 35.0 39.0 30.0 41.0 70-71 34.34525 35.0 34.0 38.0 30.0 40.0 72-73 33.98375 35.0 34.0 37.0 29.0 39.0 74-75 33.5275 35.0 34.0 37.0 28.0 39.0 76-77 32.297124999999994 34.5 32.5 36.0 26.5 37.0 78-79 32.721625 35.0 33.0 36.0 27.5 37.0 80-81 32.544375 35.0 33.5 35.5 27.0 37.0 82-83 32.36125 35.0 33.0 35.0 27.0 36.5 84-85 32.059250000000006 35.0 33.0 35.0 26.0 36.0 86-87 31.770375 35.0 33.0 35.0 25.0 36.0 88-89 31.653125 35.0 33.0 35.0 25.0 36.0 90-91 31.37325 35.0 33.0 35.0 24.0 35.0 92-93 31.211750000000002 35.0 33.0 35.0 24.0 35.0 94-95 31.009749999999997 35.0 32.0 35.0 23.0 35.0 96-97 30.68875 35.0 32.0 35.0 19.5 35.0 98-99 30.245375 35.0 32.0 35.0 6.0 35.0 100-101 27.78275 33.0 27.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 8.0 11 4.0 12 6.0 13 15.0 14 7.0 15 9.0 16 4.0 17 9.0 18 8.0 19 11.0 20 23.0 21 15.0 22 14.0 23 20.0 24 16.0 25 19.0 26 21.0 27 40.0 28 42.0 29 45.0 30 63.0 31 54.0 32 82.0 33 108.0 34 174.0 35 325.0 36 581.0 37 1043.0 38 1085.0 39 146.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 26.971279373368144 26.057441253263708 19.89556135770235 27.075718015665796 2 25.95 24.6 19.025 30.425 3 24.525 27.625 17.2 30.65 4 26.575 26.974999999999998 17.075000000000003 29.375 5 27.28182045511378 24.731182795698924 17.104276069017253 30.882720680170046 6 29.425 26.85 18.975 24.75 7 29.9 23.5 21.65 24.95 8 32.074999999999996 25.874999999999996 24.05 18.0 9 31.825 26.900000000000002 23.275000000000002 18.0 10-11 31.900000000000002 27.35 21.3875 19.3625 12-13 30.8125 25.525 23.575 20.0875 14-15 28.4125 25.6 24.337500000000002 21.65 16-17 27.325 25.7 24.349999999999998 22.625 18-19 25.874999999999996 25.775 25.7625 22.5875 20-21 25.4625 26.950000000000003 24.525 23.0625 22-23 25.937500000000004 26.0 25.35 22.7125 24-25 25.4625 26.075 26.275 22.1875 26-27 26.150000000000002 26.400000000000002 24.474999999999998 22.975 28-29 26.05 26.450000000000003 24.8 22.7 30-31 26.337500000000002 25.337500000000002 25.8 22.525000000000002 32-33 25.724999999999998 26.025 25.2875 22.9625 34-35 26.1625 25.2625 25.224999999999998 23.35 36-37 26.200000000000003 26.5625 25.087500000000002 22.15 38-39 25.687500000000004 26.174999999999997 25.124999999999996 23.0125 40-41 26.224999999999998 25.937500000000004 24.9 22.9375 42-43 26.137500000000003 25.637500000000003 25.5 22.725 44-45 25.724999999999998 26.437500000000004 24.5375 23.3 46-47 26.1125 26.437500000000004 23.849999999999998 23.599999999999998 48-49 25.900000000000002 25.6 25.6125 22.8875 50-51 25.35 26.2875 25.3125 23.05 52-53 26.937499999999996 27.2625 23.9375 21.8625 54-55 26.1625 26.474999999999998 25.087500000000002 22.275 56-57 25.525 25.7875 25.1875 23.5 58-59 25.587500000000002 27.437499999999996 24.7875 22.1875 60-61 26.1 25.85 25.1875 22.8625 62-63 24.7375 27.487499999999997 24.712500000000002 23.0625 64-65 26.0375 27.025 24.3125 22.625 66-67 25.137500000000003 26.237500000000004 24.525 24.099999999999998 68-69 24.725 26.575 25.0625 23.6375 70-71 26.474999999999998 26.1625 24.55 22.8125 72-73 26.375 26.1125 24.075 23.4375 74-75 26.337500000000002 25.7625 25.6 22.3 76-77 26.3 27.200000000000003 22.75 23.75 78-79 25.7125 26.825 24.525 22.9375 80-81 25.624999999999996 27.0625 24.224999999999998 23.0875 82-83 25.85 26.6625 23.7375 23.75 84-85 25.775 26.987499999999997 24.0625 23.175 86-87 25.1 26.3125 24.5625 24.025 88-89 25.7375 26.337500000000002 23.5 24.425 90-91 25.0125 28.1375 24.0375 22.8125 92-93 24.8625 25.937500000000004 25.074999999999996 24.125 94-95 25.775 26.2125 23.974999999999998 24.0375 96-97 25.874999999999996 26.3 24.3625 23.4625 98-99 25.75 26.4125 23.7375 24.099999999999998 100-101 25.8625 26.0375 23.325000000000003 24.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 2.0 15 2.0 16 0.5 17 0.0 18 1.0 19 2.0 20 1.0 21 0.5 22 0.5 23 0.5 24 1.5 25 3.0 26 4.0 27 4.0 28 4.0 29 3.5 30 5.5 31 10.0 32 11.5 33 16.5 34 26.0 35 29.0 36 42.5 37 59.5 38 71.0 39 89.0 40 119.0 41 149.0 42 173.5 43 175.0 44 187.0 45 217.5 46 224.0 47 217.0 48 193.5 49 176.0 50 167.0 51 158.5 52 140.0 53 129.0 54 123.5 55 102.0 56 89.0 57 77.0 58 71.5 59 72.0 60 62.5 61 52.5 62 48.0 63 44.0 64 48.5 65 53.5 66 41.0 67 34.0 68 36.5 69 34.0 70 26.5 71 21.0 72 20.0 73 23.5 74 21.0 75 13.5 76 11.0 77 11.5 78 9.5 79 5.0 80 2.5 81 4.0 82 4.0 83 1.5 84 3.5 85 3.5 86 2.0 87 2.0 88 1.5 89 1.0 90 1.0 91 1.0 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.25 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.23303457106275 95.89999999999999 2 1.357234314980794 2.65 3 0.28169014084507044 0.8250000000000001 4 0.05121638924455826 0.2 5 0.02560819462227913 0.125 6 0.05121638924455826 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCACGCACACCAGAGCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCA 6 0.15 No Hit ATGCCAGCTCTGACCGAAATCTTTGGGGATGATTCTGTATTACAATTTGG 6 0.15 No Hit AAACAACCAAGGACAGCTCCGTATTAAGATGGACCATATATAAAGTGTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.037500000000000006 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.2 0.0 0.0 0.0 0.0 36-37 0.25 0.0 0.0 0.0 0.0 38-39 0.3125 0.0 0.0 0.0 0.0 40-41 0.35 0.0 0.0 0.0 0.0 42-43 0.375 0.0 0.0 0.0 0.0 44-45 0.44999999999999996 0.0 0.0 0.0 0.0 46-47 0.525 0.0 0.0 0.0 0.0 48-49 0.675 0.0 0.0 0.0 0.0 50-51 0.9375 0.0 0.0 0.0 0.0 52-53 1.0 0.0 0.0 0.0 0.0 54-55 1.175 0.0 0.0 0.0 0.0 56-57 1.325 0.0 0.0 0.0 0.0 58-59 1.5625 0.0 0.0 0.0 0.0 60-61 1.8125 0.0 0.0 0.0 0.0 62-63 2.0 0.0 0.0 0.0 0.0 64-65 2.1375 0.0 0.0 0.0 0.0 66-67 2.55 0.0 0.0 0.0 0.0 68-69 3.1375 0.0 0.0 0.0 0.0 70-71 3.5625 0.0 0.0 0.0 0.0 72-73 3.9875 0.0 0.0 0.0 0.0 74-75 4.525 0.0 0.0 0.0 0.0 76-77 5.074999999999999 0.0 0.0 0.0 0.0 78-79 5.65 0.0 0.0 0.0 0.0 80-81 6.2125 0.0 0.0 0.0 0.0 82-83 6.7375 0.0 0.0 0.0 0.0 84-85 7.2125 0.0 0.0 0.0 0.0 86-87 7.725 0.0 0.0 0.0 0.0 88-89 8.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317454 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317454_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2405 34.0 31.0 34.0 31.0 34.0 2 31.887 34.0 31.0 34.0 30.0 34.0 3 32.41575 34.0 31.0 34.0 31.0 34.0 4 35.5925 37.0 37.0 37.0 35.0 37.0 5 35.76 37.0 37.0 37.0 35.0 37.0 6 35.8 37.0 37.0 37.0 35.0 37.0 7 35.8455 37.0 37.0 37.0 35.0 37.0 8 35.84475 37.0 37.0 37.0 35.0 37.0 9 37.63425 39.0 39.0 39.0 35.0 39.0 10-11 37.582125 39.0 39.0 39.0 35.0 39.0 12-13 37.566 39.0 39.0 39.0 35.0 39.0 14-15 39.163125 41.0 40.0 41.0 37.0 41.0 16-17 39.105374999999995 41.0 40.0 41.0 36.5 41.0 18-19 39.0015 41.0 40.0 41.0 36.0 41.0 20-21 38.900125 41.0 40.0 41.0 36.0 41.0 22-23 38.870999999999995 41.0 40.0 41.0 36.0 41.0 24-25 38.795874999999995 41.0 39.5 41.0 35.0 41.0 26-27 38.7555 41.0 39.0 41.0 35.0 41.0 28-29 38.673874999999995 41.0 39.0 41.0 35.0 41.0 30-31 38.451125000000005 41.0 39.0 41.0 35.0 41.0 32-33 38.36025 41.0 39.0 41.0 35.0 41.0 34-35 38.257125 40.0 38.5 41.0 34.5 41.0 36-37 38.01025 40.0 38.0 41.0 33.5 41.0 38-39 37.982749999999996 40.0 38.0 41.0 34.0 41.0 40-41 38.148250000000004 40.5 38.5 41.0 34.0 41.0 42-43 38.02025 41.0 38.0 41.0 34.0 41.0 44-45 37.866125 40.5 38.0 41.0 33.5 41.0 46-47 37.712875 40.0 38.0 41.0 33.0 41.0 48-49 37.480375 40.0 37.0 41.0 33.0 41.0 50-51 36.774125 39.5 36.0 40.5 32.0 41.0 52-53 36.662 39.5 36.0 40.5 31.5 41.0 54-55 36.808625000000006 40.0 35.5 41.0 32.0 41.0 56-57 36.694374999999994 39.5 35.0 41.0 31.5 41.0 58-59 36.40575 39.0 35.0 41.0 31.0 41.0 60-61 36.16525 39.0 35.0 41.0 31.0 41.0 62-63 35.874750000000006 38.5 35.0 41.0 30.5 41.0 64-65 35.57899999999999 37.5 35.0 40.0 30.5 41.0 66-67 35.580625 37.0 35.0 40.0 31.0 41.0 68-69 35.27275 37.0 35.0 39.5 31.0 41.0 70-71 34.92 36.0 35.0 39.0 31.0 41.0 72-73 34.558375 36.0 35.0 39.0 31.0 41.0 74-75 34.233000000000004 35.0 35.0 37.5 30.5 39.5 76-77 33.837374999999994 35.0 35.0 37.0 30.0 39.0 78-79 33.4695 35.0 34.5 36.5 29.5 39.0 80-81 33.152249999999995 35.0 34.0 36.0 29.0 37.0 82-83 32.873625 35.0 34.0 36.0 29.0 37.0 84-85 32.629875 35.0 34.0 35.0 28.5 36.5 86-87 32.45275 35.0 34.0 35.0 27.5 36.0 88-89 32.309375 35.0 34.0 35.0 27.5 36.0 90-91 32.149249999999995 35.0 34.0 35.0 27.0 36.0 92-93 32.07025 35.0 34.0 35.0 27.0 35.5 94-95 31.931625 35.0 34.0 35.0 27.5 35.0 96-97 31.69475 35.0 33.0 35.0 27.0 35.0 98-99 31.450249999999997 35.0 33.0 35.0 24.5 35.0 100-101 29.607625 33.5 30.0 34.5 13.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 52.0 3 6.0 4 2.0 5 5.0 6 6.0 7 3.0 8 2.0 9 6.0 10 5.0 11 6.0 12 10.0 13 9.0 14 9.0 15 7.0 16 1.0 17 6.0 18 11.0 19 5.0 20 6.0 21 5.0 22 8.0 23 14.0 24 20.0 25 14.0 26 23.0 27 20.0 28 23.0 29 25.0 30 40.0 31 46.0 32 74.0 33 88.0 34 127.0 35 245.0 36 443.0 37 970.0 38 1355.0 39 303.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.549999999999997 10.725 28.625 32.1 2 26.525 11.15 25.275 37.05 3 23.275000000000002 12.950000000000001 29.349999999999998 34.425 4 25.374999999999996 11.225 26.75 36.65 5 26.150000000000002 15.225 23.200000000000003 35.425000000000004 6 24.875 18.425 29.675 27.025 7 19.275000000000002 25.1 37.9 17.724999999999998 8 18.025 25.424999999999997 35.775 20.775 9 18.4 28.425 34.175 19.0 10-11 19.3125 27.05 32.15 21.4875 12-13 20.3 27.5875 31.4375 20.674999999999997 14-15 20.849999999999998 25.8125 30.3875 22.95 16-17 20.849999999999998 25.724999999999998 28.7 24.725 18-19 20.6875 26.5125 29.175 23.625 20-21 21.075 26.1 28.625 24.2 22-23 21.875 25.387500000000003 28.212500000000002 24.525 24-25 20.3125 26.075 29.062500000000004 24.55 26-27 21.462500000000002 26.337500000000002 27.0625 25.137500000000003 28-29 21.6 25.5 27.05 25.85 30-31 21.8875 26.437500000000004 27.175 24.5 32-33 22.650000000000002 25.412499999999998 27.700000000000003 24.2375 34-35 21.8 25.0 27.775 25.424999999999997 36-37 21.8625 25.137500000000003 28.1375 24.8625 38-39 21.375 26.387500000000003 26.9625 25.275 40-41 22.4375 24.8125 27.075 25.674999999999997 42-43 21.825 25.887500000000003 26.5875 25.7 44-45 22.625 26.224999999999998 25.724999999999998 25.424999999999997 46-47 21.837500000000002 25.8125 27.125 25.224999999999998 48-49 20.7 26.437500000000004 28.075 24.7875 50-51 22.0125 25.6 26.3125 26.075 52-53 22.037499999999998 25.2375 27.3375 25.387500000000003 54-55 21.5625 26.3625 27.4125 24.6625 56-57 22.037499999999998 26.137500000000003 27.35 24.474999999999998 58-59 21.85 25.5375 26.7625 25.85 60-61 21.55 25.6125 27.437499999999996 25.4 62-63 23.474999999999998 25.687500000000004 25.9875 24.85 64-65 23.400000000000002 24.462500000000002 26.25 25.887500000000003 66-67 22.35 26.375 26.724999999999998 24.55 68-69 22.3375 26.525 26.25 24.887500000000003 70-71 23.3125 25.3125 25.9625 25.412499999999998 72-73 23.225 26.1 25.525 25.15 74-75 23.3875 26.137500000000003 25.95 24.525 76-77 23.7 26.174999999999997 25.087500000000002 25.0375 78-79 22.9875 27.3 24.8125 24.9 80-81 23.5875 26.075 25.8 24.5375 82-83 23.275000000000002 25.587500000000002 25.7125 25.424999999999997 84-85 23.775 26.8625 25.6 23.7625 86-87 24.325 26.0625 25.525 24.087500000000002 88-89 24.4375 25.35 25.224999999999998 24.9875 90-91 24.712500000000002 26.6 25.45 23.2375 92-93 24.212500000000002 25.650000000000002 25.324999999999996 24.8125 94-95 25.275 25.2625 24.975 24.4875 96-97 25.162499999999998 26.075 25.15 23.6125 98-99 25.424999999999997 26.2625 24.775 23.5375 100-101 25.162499999999998 26.2125 24.4 24.224999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 13.0 1 12.0 2 6.0 3 2.5 4 3.0 5 1.0 6 0.5 7 1.0 8 1.0 9 0.5 10 0.5 11 1.5 12 1.5 13 1.5 14 2.0 15 1.5 16 1.5 17 1.5 18 2.0 19 2.5 20 3.0 21 2.0 22 1.0 23 3.0 24 4.0 25 5.0 26 5.5 27 4.0 28 4.0 29 7.5 30 15.0 31 18.5 32 16.5 33 24.0 34 42.5 35 52.0 36 59.0 37 74.0 38 91.5 39 102.5 40 125.5 41 171.5 42 201.5 43 207.5 44 199.0 45 193.0 46 204.5 47 208.5 48 184.5 49 166.5 50 163.0 51 152.5 52 138.5 53 123.0 54 105.0 55 88.5 56 85.0 57 73.5 58 56.5 59 57.0 60 56.5 61 50.0 62 43.0 63 39.5 64 37.5 65 36.5 66 30.0 67 22.0 68 23.5 69 23.0 70 20.5 71 20.0 72 18.0 73 15.5 74 13.0 75 11.5 76 10.5 77 10.0 78 8.0 79 5.5 80 6.0 81 3.0 82 1.0 83 1.5 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.5 97 1.0 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03135355595208 97.125 2 0.7137394850879428 1.4000000000000001 3 0.15294417537598778 0.44999999999999996 4 0.0 0.0 5 0.025490695895997964 0.125 6 0.025490695895997964 0.15 7 0.0 0.0 8 0.025490695895997964 0.2 9 0.0 0.0 >10 0.025490695895997964 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 22 0.5499999999999999 No Hit TCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 8 0.2 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 6 0.15 No Hit CCACCGAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.037500000000000006 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.2 0.0 0.0 0.0 0.0 36-37 0.2375 0.0 0.0 0.0 0.0 38-39 0.2875 0.0 0.0 0.0 0.0 40-41 0.325 0.0 0.0 0.0 0.0 42-43 0.35 0.0 0.0 0.0 0.0 44-45 0.42500000000000004 0.0 0.0 0.0 0.0 46-47 0.5 0.0 0.0 0.0 0.0 48-49 0.6499999999999999 0.0 0.0 0.0 0.0 50-51 0.9125000000000001 0.0 0.0 0.0 0.0 52-53 0.975 0.0 0.0 0.0 0.0 54-55 1.1375 0.0 0.0 0.0 0.0 56-57 1.3 0.0 0.0 0.0 0.0 58-59 1.575 0.0 0.0 0.0 0.0 60-61 1.8375 0.0 0.0 0.0 0.0 62-63 2.0250000000000004 0.0 0.0 0.0 0.0 64-65 2.1625 0.0 0.0 0.0 0.0 66-67 2.575 0.0 0.0 0.0 0.0 68-69 3.15 0.0 0.0 0.0 0.0 70-71 3.5875000000000004 0.0 0.0 0.0 0.0 72-73 4.025 0.0 0.0 0.0 0.0 74-75 4.5875 0.0 0.0 0.0 0.0 76-77 5.1625 0.0 0.0 0.0 0.0 78-79 5.725 0.0 0.0 0.0 0.0 80-81 6.275 0.0 0.0 0.0 0.0 82-83 6.8 0.0 0.0 0.0 0.0 84-85 7.275 0.0 0.0 0.0 0.0 86-87 7.762499999999999 0.0 0.0 0.0 0.0 88-89 8.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1691908 spots for ERR3317454.sra Written 1691908 spots for ERR3317454.sra Read 1691908 spots for ERR3317454.sra Written 1691908 spots for ERR3317454.sra Read 1691908 spots for ERR3317454.sra Written 1691908 spots for ERR3317454.sra Read 1691918 spots for ERR3317454.sra Written 1691918 spots for ERR3317454.sra Read 1691908 spots for ERR3317454.sra Written 1691908 spots for ERR3317454.sra Read 1691908 spots for ERR3317454.sra Written 1691908 spots for ERR3317454.sra Read 1691908 spots for ERR3317454.sra Written 1691908 spots for ERR3317454.sra Read 1691908 spots for ERR3317454.sra Written 1691908 spots for ERR3317454.sra Read 1691908 spots for ERR3317454.sra Written 1691908 spots for ERR3317454.sra Read 1691908 spots for ERR3317454.sra Written 1691908 spots for ERR3317454.sra Read 1691908 spots for ERR3317454.sra Written 1691908 spots for ERR3317454.sra Read 1691908 spots for ERR3317454.sra Written 1691908 spots for ERR3317454.sra Read 1691908 spots for ERR3317454.sra Written 1691908 spots for ERR3317454.sra Read 1691908 spots for ERR3317454.sra Written 1691908 spots for ERR3317454.sra Read 1691908 spots for ERR3317454.sra Written 1691908 spots for ERR3317454.sra Read 1691908 spots for ERR3317454.sra Written 1691908 spots for ERR3317454.sra Read 1691908 spots for ERR3317454.sra Written 1691908 spots for ERR3317454.sra Read 1691908 spots for ERR3317454.sra Written 1691908 spots for ERR3317454.sra Read 1691908 spots for ERR3317454.sra Written 1691908 spots for ERR3317454.sra Read 1691908 spots for ERR3317454.sra Written 1691908 spots for ERR3317454.sra SRR ids: ['ERR3317454.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ifhrxldf ERR3317454.sra spots: 33838170 blocks: [[1, 1691908], [1691909, 3383816], [3383817, 5075724], [5075725, 6767632], [6767633, 8459540], [8459541, 10151448], [10151449, 11843356], [11843357, 13535264], [13535265, 15227172], [15227173, 16919080], [16919081, 18610988], [18610989, 20302896], [20302897, 21994804], [21994805, 23686712], [23686713, 25378620], [25378621, 27070528], [27070529, 28762436], [28762437, 30454344], [30454345, 32146252], [32146253, 33838170]] ERR3317454 file size 8140436 ERR3317454 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317454 ERR3317454_1.fastq ERR3317454_2.fastq Input file: ERR3317454_1.fastq Paired file: ERR3317454_2.fastq trimmed: ERR3317454-trimmed-pair1.fastq, ERR3317454-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:50:41 2024 >> started Tue Dec 10 09:51:14 2024 >> done (32.888s) 33838170 read pairs processed; of these: 204319 ( 0.60%) short read pairs filtered out after trimming by size control 537955 ( 1.59%) empty read pairs filtered out after trimming by size control 33095896 (97.81%) read pairs available; of these: 10114843 (30.56%) trimmed read pairs available after processing 22981053 (69.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 783 0.00% 19 857 0.00% 20 1221 0.00% 21 1508 0.00% 22 1857 0.01% 23 2576 0.01% 24 3155 0.01% 25 3721 0.01% 26 4280 0.01% 27 5269 0.02% 28 5400 0.02% 29 6846 0.02% 30 7627 0.02% 31 9791 0.03% 32 9219 0.03% 33 10103 0.03% 34 11796 0.04% 35 12664 0.04% 36 14134 0.04% 37 14728 0.04% 38 16995 0.05% 39 18324 0.06% 40 18025 0.05% 41 19605 0.06% 42 20663 0.06% 43 22101 0.07% 44 23979 0.07% 45 24259 0.07% 46 25888 0.08% 47 28586 0.09% 48 30110 0.09% 49 31774 0.10% 50 35269 0.11% 51 35305 0.11% 52 36381 0.11% 53 40186 0.12% 54 44458 0.13% 55 49884 0.15% 56 49205 0.15% 57 49886 0.15% 58 56369 0.17% 59 68330 0.21% 60 77251 0.23% 61 83065 0.25% 62 87589 0.26% 63 91404 0.28% 64 97864 0.30% 65 102013 0.31% 66 113811 0.34% 67 112311 0.34% 68 113825 0.34% 69 115808 0.35% 70 124644 0.38% 71 132732 0.40% 72 136447 0.41% 73 139101 0.42% 74 138252 0.42% 75 138357 0.42% 76 138366 0.42% 77 144035 0.44% 78 153524 0.46% 79 154419 0.47% 80 158752 0.48% 81 162147 0.49% 82 162938 0.49% 83 171727 0.52% 84 178076 0.54% 85 190440 0.58% 86 198881 0.60% 87 203829 0.62% 88 202601 0.61% 89 222048 0.67% 90 216716 0.65% 91 224572 0.68% 92 236053 0.71% 93 249499 0.75% 94 272181 0.82% 95 292374 0.88% 96 325293 0.98% 97 381387 1.15% 98 484015 1.46% 99 634667 1.92% 100 1678712 5.07% 101 22981053 69.44% 33095896 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=14 prefix-density=0.58 prefix-fanout=3.0 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=61.15 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=2.4 sequence=ACAACACCAGCCACCAGCTCATCTCTCACTGACCTTACCACTTGAATTGGGATCGAAATGGCCGCGTCGGCGCTGCACCAGACCACCAGCTTCCTCGGCACCGCCCCACGCCGCGATGACCTCGTCCGCAGCGTCGGCGACTTC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=30 prefix-density=0.26 prefix-fanout=2.1 sequence=CTCCGATCCCGA criterion=fanout-score sequence-density=0.05 sequence-density-rank=22 fanout-score=172.76 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=14.6 sequence=CCTTCTTCTCCGGGTCC ERR3317454 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:51:56 Started mapping on | Dec 10 09:52:12 Finished on | Dec 10 09:53:48 Mapping speed, Million of reads per hour | 1241.10 Number of input reads | 33095896 Average input read length | 191 UNIQUE READS: Uniquely mapped reads number | 29755684 Uniquely mapped reads % | 89.91% Average mapped length | 190.67 Number of splices: Total | 17737448 Number of splices: Annotated (sjdb) | 16855468 Number of splices: GT/AG | 17483027 Number of splices: GC/AG | 226166 Number of splices: AT/AC | 14291 Number of splices: Non-canonical | 13964 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.00% Deletion average length | 1.24 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2040982 % of reads mapped to multiple loci | 6.17% Number of reads mapped to too many loci | 119781 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.57% % of reads unmapped: other | 1.99% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1431627 1431627 1431627 N_multimapping 2040982 2040982 2040982 N_noFeature 1140979 2226828 28053617 N_ambiguous 845901 260668 11886 UnstrandedReadsAssigned:27768804 PositiveStrandReadsAssigned:27268188 NegativeStrandReadsAssigned:1690181 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=99 echo kmer=95 ERR3317454 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317454-trimmed-pair1.fastq ERR3317454-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,095,896 reads, 28,748,835 reads pseudoaligned [quant] estimated average fragment length: 183.311 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,206 rounds 52973 ERR3317454.ke.tsv 35125 ERR3317454.se.tsv 88098 total ==> ERR3317454.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 753.913 0 0 PNS24247 1044 861.689 50.8615 3.06877 PNS24249 1928 1745.69 118.775 3.5374 PNS24246 1044 861.689 50.8615 3.06877 PNS24248 1044 861.689 50.8615 3.06877 PNS24244 1471 1288.69 318.641 12.8552 PNS24243 293 138.179 1 0.376257 KQK14069 1603 1420.69 2615.02 95.6976 KQK14071 474 298.944 10.6812 1.85761 ==> ERR3317454.se.tsv <== BRADI_1g14170v3 3120 BRADI_1g53295v3 175 BRADI_1g59795v3 792 BRADI_1g07683v3 0 BRADI_1g00485v3 97 BRADI_1g20270v3 2263 BRADI_1g74790v3 390 BRADI_1g09890v3 8 BRADI_1g77505v3 379 BRADI_1g48960v3 1 ERR3317454 completed mapping pipeline successfully