Starting /dee2/code/volunteer_pipeline.sh ERR3317455 current disk space = 1524961615872 free memory = 1528566012 ERR3317455 SRAfilesize cde442f8edec351928ababa1010aeef2 ERR3317455.sra ERR3317455.sra file validated ERR3317455 is paired end ERR3317455 is conventional basespace ERR3317455 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317455_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.14025 34.0 31.0 34.0 30.0 34.0 2 32.11625 34.0 31.0 34.0 30.0 34.0 3 32.76225 34.0 31.0 34.0 30.0 34.0 4 36.368 37.0 37.0 37.0 35.0 37.0 5 36.36675 37.0 37.0 37.0 35.0 37.0 6 36.39275 37.0 37.0 37.0 35.0 37.0 7 36.3815 37.0 37.0 37.0 35.0 37.0 8 36.421 37.0 37.0 37.0 35.0 37.0 9 38.2575 39.0 39.0 39.0 37.0 39.0 10-11 38.228875 39.0 39.0 39.0 37.0 39.0 12-13 38.1515 39.0 39.0 39.0 37.0 39.0 14-15 39.656000000000006 41.0 40.0 41.0 37.0 41.0 16-17 39.6055 41.0 40.0 41.0 37.0 41.0 18-19 39.511875 41.0 39.5 41.0 36.5 41.0 20-21 39.58025 41.0 40.0 41.0 37.0 41.0 22-23 39.442499999999995 41.0 39.5 41.0 36.5 41.0 24-25 39.339375 41.0 39.0 41.0 36.0 41.0 26-27 39.12425 41.0 39.0 41.0 35.5 41.0 28-29 38.954375 40.5 39.0 41.0 35.0 41.0 30-31 38.73825 40.0 38.5 41.0 35.0 41.0 32-33 38.589125 40.0 38.0 41.0 34.5 41.0 34-35 38.318875000000006 40.0 38.0 41.0 34.0 41.0 36-37 38.018 40.0 38.0 41.0 33.0 41.0 38-39 37.77725 40.0 38.0 41.0 33.0 41.0 40-41 37.616125 40.0 37.5 41.0 32.5 41.0 42-43 37.630875 40.0 37.0 41.0 33.0 41.0 44-45 37.4525 40.0 37.0 41.0 32.5 41.0 46-47 37.161249999999995 40.0 36.5 41.0 31.5 41.0 48-49 36.755375 39.5 36.0 41.0 31.0 41.0 50-51 37.1725 40.0 36.0 41.0 32.0 41.0 52-53 37.020250000000004 40.0 35.0 41.0 32.0 41.0 54-55 36.670125 39.0 35.0 41.0 31.0 41.0 56-57 36.349000000000004 39.0 35.0 41.0 31.0 41.0 58-59 35.960375 38.5 35.0 41.0 30.5 41.0 60-61 35.580124999999995 37.5 35.0 40.5 30.0 41.0 62-63 35.225125 37.0 35.0 40.0 29.0 41.0 64-65 34.8425 36.5 34.0 39.5 29.0 41.0 66-67 34.389875 36.0 34.0 39.0 29.0 41.0 68-69 33.903375 35.0 34.0 39.0 27.5 41.0 70-71 33.531875 35.0 34.0 37.5 27.0 40.0 72-73 32.979124999999996 35.0 33.0 37.0 26.0 39.0 74-75 32.540875 35.0 33.0 36.5 25.5 39.0 76-77 31.380875 34.0 31.5 35.5 24.0 37.0 78-79 31.84 35.0 33.0 35.5 24.0 37.0 80-81 31.679625 35.0 33.0 35.0 23.5 37.0 82-83 31.423625 35.0 33.0 35.0 23.0 36.0 84-85 31.1075 35.0 32.0 35.0 21.0 36.0 86-87 30.873624999999997 35.0 32.0 35.0 20.0 36.0 88-89 30.55475 35.0 31.5 35.0 17.5 35.5 90-91 30.297375000000002 35.0 31.0 35.0 16.0 35.0 92-93 30.037625 34.5 31.0 35.0 8.5 35.0 94-95 29.664875 34.0 31.0 35.0 2.0 35.0 96-97 29.336375 34.0 31.0 35.0 2.0 35.0 98-99 28.931375 34.0 30.0 35.0 2.0 35.0 100-101 26.41875 32.0 24.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 5.0 9 6.0 10 9.0 11 8.0 12 14.0 13 11.0 14 9.0 15 14.0 16 14.0 17 11.0 18 21.0 19 20.0 20 15.0 21 16.0 22 24.0 23 27.0 24 24.0 25 21.0 26 28.0 27 34.0 28 36.0 29 53.0 30 67.0 31 83.0 32 102.0 33 155.0 34 210.0 35 311.0 36 592.0 37 1002.0 38 941.0 39 116.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.98781134075252 26.338102808691044 17.912029676735557 26.76205617382088 2 28.9 24.05 17.775 29.275000000000002 3 28.975 25.2 17.4 28.425 4 28.525 25.3 15.15 31.025000000000002 5 29.475 24.725 14.774999999999999 31.025000000000002 6 30.175 28.599999999999998 18.75 22.475 7 32.35 24.2 21.475 21.975 8 34.150000000000006 25.025 23.474999999999998 17.349999999999998 9 33.2 26.1 24.65 16.05 10-11 33.7 26.125 22.125 18.05 12-13 29.4125 27.025 24.0625 19.5 14-15 27.950000000000003 26.0375 24.875 21.1375 16-17 26.700000000000003 26.7125 25.724999999999998 20.8625 18-19 26.775 27.450000000000003 25.074999999999996 20.7 20-21 26.1125 27.3875 25.2625 21.2375 22-23 26.625 26.237500000000004 24.1625 22.975 24-25 24.9 26.575 25.624999999999996 22.900000000000002 26-27 25.137500000000003 27.375 25.674999999999997 21.8125 28-29 26.5125 24.3625 25.0625 24.0625 30-31 25.837500000000002 26.2625 25.3125 22.5875 32-33 26.125 26.35 25.162499999999998 22.3625 34-35 25.45 26.275 25.2875 22.9875 36-37 26.125 26.35 24.95 22.575 38-39 25.4625 26.775 25.025 22.7375 40-41 25.224999999999998 26.75 24.224999999999998 23.799999999999997 42-43 25.525 26.35 26.0625 22.0625 44-45 26.0 25.224999999999998 25.575 23.200000000000003 46-47 27.175 25.1875 24.1875 23.45 48-49 26.35 25.4375 25.7625 22.45 50-51 26.150000000000002 26.6125 24.8125 22.425 52-53 26.6125 26.137500000000003 23.962500000000002 23.2875 54-55 25.650000000000002 26.25 25.6 22.5 56-57 26.2625 25.2 24.55 23.9875 58-59 25.05 26.450000000000003 24.962500000000002 23.5375 60-61 26.3125 25.224999999999998 24.8 23.6625 62-63 26.174999999999997 25.937500000000004 24.349999999999998 23.5375 64-65 25.8625 25.874999999999996 25.05 23.2125 66-67 25.137500000000003 26.325 24.825 23.7125 68-69 25.4875 27.037499999999998 24.5125 22.9625 70-71 27.037499999999998 25.5125 23.65 23.799999999999997 72-73 26.424999999999997 26.125 25.124999999999996 22.325 74-75 26.2125 25.724999999999998 24.975 23.0875 76-77 26.5375 25.424999999999997 24.7375 23.3 78-79 26.3 25.424999999999997 25.162499999999998 23.1125 80-81 25.0625 26.5125 25.35 23.075000000000003 82-83 25.937500000000004 26.125 24.3875 23.549999999999997 84-85 25.3 26.674999999999997 24.8125 23.2125 86-87 25.5375 26.5 24.7875 23.175 88-89 27.025 26.450000000000003 23.525 23.0 90-91 25.9625 26.3 24.625 23.1125 92-93 25.8 25.8625 24.887500000000003 23.45 94-95 26.775 25.974999999999998 23.9375 23.3125 96-97 26.9125 26.775 24.212500000000002 22.1 98-99 24.9875 26.687499999999996 24.337500000000002 23.9875 100-101 26.424999999999997 26.575 22.2625 24.7375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 1.0 8 1.0 9 0.5 10 1.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 2.0 22 1.5 23 0.5 24 2.0 25 5.0 26 4.5 27 3.5 28 4.5 29 3.5 30 7.0 31 12.0 32 19.5 33 22.0 34 19.0 35 27.0 36 41.5 37 54.5 38 64.0 39 93.5 40 124.5 41 140.5 42 156.5 43 171.0 44 190.5 45 197.5 46 192.0 47 189.5 48 191.5 49 192.0 50 181.0 51 163.5 52 151.0 53 142.0 54 123.5 55 97.0 56 97.0 57 98.0 58 89.5 59 88.5 60 68.5 61 54.5 62 52.0 63 45.5 64 44.0 65 41.0 66 34.0 67 36.5 68 39.5 69 31.0 70 26.5 71 21.5 72 15.5 73 17.5 74 20.0 75 16.5 76 8.5 77 5.0 78 5.5 79 7.5 80 6.0 81 3.0 82 4.5 83 6.0 84 3.5 85 0.5 86 2.0 87 3.0 88 1.5 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 1.0 96 1.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.12868495257626 95.7 2 1.409894898743912 2.75 3 0.25634452704434757 0.75 4 0.20507562163547807 0.8 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.037500000000000006 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1125 0.0 0.0 0.0 0.0 34-35 0.1875 0.0 0.0 0.0 0.0 36-37 0.2 0.0 0.0 0.0 0.0 38-39 0.21250000000000002 0.0 0.0 0.0 0.0 40-41 0.225 0.0 0.0 0.0 0.0 42-43 0.2625 0.0 0.0 0.0 0.0 44-45 0.3375 0.0 0.0 0.0 0.0 46-47 0.4 0.0 0.0 0.0 0.0 48-49 0.475 0.0 0.0 0.0 0.0 50-51 0.575 0.0 0.0 0.0 0.0 52-53 0.6625000000000001 0.0 0.0 0.0 0.0 54-55 0.7625 0.0 0.0 0.0 0.0 56-57 0.975 0.0 0.0 0.0 0.0 58-59 1.0875 0.0 0.0 0.0 0.0 60-61 1.1875 0.0 0.0 0.0 0.0 62-63 1.375 0.0 0.0 0.0 0.0 64-65 1.5125000000000002 0.0 0.0 0.0 0.0 66-67 1.6625 0.0 0.0 0.0 0.0 68-69 1.9125 0.0 0.0 0.0 0.0 70-71 2.0999999999999996 0.0 0.0 0.0 0.0 72-73 2.425 0.0 0.0 0.0 0.0 74-75 2.6875 0.0 0.0 0.0 0.0 76-77 2.9375 0.0 0.0 0.0 0.0 78-79 3.2249999999999996 0.0 0.0 0.0 0.0 80-81 3.5875000000000004 0.0 0.0 0.0 0.0 82-83 3.9000000000000004 0.0 0.0 0.0 0.0 84-85 4.2875 0.0 0.0 0.0 0.0 86-87 4.625 0.0 0.0 0.0 0.0 88-89 5.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317455 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317455_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.06975 33.0 31.0 34.0 28.0 34.0 2 31.55775 33.0 31.0 34.0 30.0 34.0 3 31.8275 34.0 31.0 34.0 30.0 34.0 4 35.22125 37.0 35.0 37.0 33.0 37.0 5 34.23525 37.0 35.0 37.0 32.0 37.0 6 34.7505 37.0 35.0 37.0 32.0 37.0 7 35.2855 37.0 35.0 37.0 32.0 37.0 8 35.42025 37.0 36.0 37.0 35.0 37.0 9 37.23075 39.0 39.0 39.0 35.0 39.0 10-11 37.162875 39.0 38.0 39.0 35.0 39.0 12-13 37.134249999999994 39.0 38.0 39.0 35.0 39.0 14-15 38.618375 41.0 39.0 41.0 36.0 41.0 16-17 38.644625000000005 41.0 39.0 41.0 36.0 41.0 18-19 38.594750000000005 41.0 39.5 41.0 35.0 41.0 20-21 38.509625 41.0 39.5 41.0 35.0 41.0 22-23 38.297250000000005 41.0 39.0 41.0 35.0 41.0 24-25 38.2385 41.0 39.0 41.0 35.0 41.0 26-27 38.17175 41.0 39.0 41.0 34.5 41.0 28-29 37.991375000000005 41.0 38.5 41.0 34.0 41.0 30-31 37.791125 40.0 38.0 41.0 33.0 41.0 32-33 37.678625 40.0 38.0 41.0 33.0 41.0 34-35 37.4835 40.0 38.0 41.0 33.0 41.0 36-37 37.51475 40.0 38.0 41.0 33.0 41.0 38-39 37.4555 40.0 38.0 41.0 33.0 41.0 40-41 37.4815 40.0 38.0 41.0 32.5 41.0 42-43 37.407375 40.0 38.0 41.0 32.5 41.0 44-45 37.276375 40.0 37.5 41.0 32.5 41.0 46-47 37.175 40.0 37.0 41.0 32.0 41.0 48-49 36.906875 40.0 37.0 41.0 31.0 41.0 50-51 36.075375 39.0 35.5 40.5 30.0 40.5 52-53 35.9935 39.0 35.0 40.5 30.0 41.0 54-55 36.226625 39.0 35.0 41.0 30.5 41.0 56-57 36.079499999999996 39.0 35.0 41.0 30.0 41.0 58-59 35.8645 39.0 35.0 41.0 30.0 41.0 60-61 35.548 38.5 35.0 41.0 29.5 41.0 62-63 35.217 38.0 35.0 40.0 29.0 41.0 64-65 34.84625 37.0 34.5 40.0 28.0 41.0 66-67 34.898875000000004 37.0 35.0 40.0 29.0 41.0 68-69 34.500625 36.0 35.0 39.0 29.0 41.0 70-71 34.208375000000004 36.0 35.0 39.0 28.5 41.0 72-73 33.833625 35.0 34.0 38.5 29.0 40.0 74-75 33.405125 35.0 34.0 37.0 27.5 39.0 76-77 33.094875 35.0 34.0 37.0 27.0 39.0 78-79 32.706500000000005 35.0 34.0 36.0 26.0 38.5 80-81 32.387875 35.0 34.0 36.0 26.0 37.0 82-83 32.159125 35.0 33.5 35.5 26.0 37.0 84-85 31.938375 35.0 33.0 35.0 25.0 36.5 86-87 31.738500000000002 35.0 33.0 35.0 24.5 36.0 88-89 31.540999999999997 35.0 33.0 35.0 24.0 36.0 90-91 31.356375 35.0 33.0 35.0 24.0 36.0 92-93 31.188000000000002 35.0 33.0 35.0 23.0 35.0 94-95 30.944875 35.0 33.0 35.0 19.5 35.0 96-97 30.79625 35.0 33.0 35.0 18.5 35.0 98-99 30.496125 35.0 33.0 35.0 6.0 35.0 100-101 28.461750000000002 33.5 28.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 71.0 3 14.0 4 3.0 5 11.0 6 6.0 7 4.0 8 6.0 9 2.0 10 4.0 11 7.0 12 14.0 13 4.0 14 5.0 15 8.0 16 5.0 17 10.0 18 7.0 19 14.0 20 12.0 21 10.0 22 11.0 23 13.0 24 16.0 25 16.0 26 27.0 27 35.0 28 31.0 29 55.0 30 47.0 31 54.0 32 79.0 33 111.0 34 151.0 35 267.0 36 446.0 37 975.0 38 1236.0 39 213.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.313656828414207 9.154577288644322 28.264132066033014 35.26763381690846 2 26.900000000000002 11.05 25.525 36.525 3 21.5 13.475000000000001 29.849999999999998 35.175 4 23.95 11.875 26.700000000000003 37.475 5 23.559803668302763 14.931542237148024 24.696460862826143 36.812193231723064 6 25.624999999999996 18.85 29.175 26.35 7 19.3 23.925 38.875 17.9 8 18.224999999999998 25.874999999999996 35.275 20.625 9 18.075 27.6 35.449999999999996 18.875 10-11 18.2625 26.887499999999996 32.625 22.225 12-13 19.425 25.775 32.300000000000004 22.5 14-15 20.1125 25.825 31.175000000000004 22.8875 16-17 20.4625 25.5375 30.45 23.549999999999997 18-19 20.7375 25.974999999999998 30.2875 23.0 20-21 20.9875 24.887500000000003 29.325000000000003 24.8 22-23 21.1375 24.5 29.012500000000003 25.35 24-25 20.75 24.525 30.099999999999998 24.625 26-27 21.075 26.187500000000004 27.5125 25.224999999999998 28-29 21.2 25.6125 27.187499999999996 26.0 30-31 20.4875 25.3125 28.95 25.25 32-33 22.1 25.2625 27.375 25.2625 34-35 21.5 24.6875 28.15 25.662499999999998 36-37 20.7625 24.587500000000002 28.725 25.924999999999997 38-39 21.212500000000002 24.4125 28.4375 25.937500000000004 40-41 22.15 24.6125 27.0125 26.224999999999998 42-43 22.1375 25.4 28.037499999999998 24.425 44-45 22.5625 25.7625 26.6625 25.0125 46-47 21.025 25.124999999999996 27.6125 26.237500000000004 48-49 22.775000000000002 26.625 26.787499999999998 23.8125 50-51 21.575 26.6625 26.737499999999997 25.025 52-53 21.6 25.374999999999996 27.3 25.724999999999998 54-55 21.224999999999998 25.5 28.999999999999996 24.275 56-57 21.3875 25.650000000000002 27.625 25.337500000000002 58-59 21.1375 25.137500000000003 27.375 26.35 60-61 21.15 25.6 28.6625 24.587500000000002 62-63 21.825 25.525 27.35 25.3 64-65 22.400000000000002 24.4 27.0625 26.137500000000003 66-67 21.9375 26.387500000000003 27.725 23.95 68-69 22.0625 25.974999999999998 26.2625 25.7 70-71 21.6875 26.0375 25.85 26.424999999999997 72-73 22.3875 24.6125 27.0625 25.937500000000004 74-75 21.7 24.8125 27.0875 26.400000000000002 76-77 23.549999999999997 25.45 26.0125 24.9875 78-79 21.837500000000002 26.2625 27.212500000000002 24.6875 80-81 23.625 25.337500000000002 25.7375 25.3 82-83 22.975 25.7875 25.624999999999996 25.6125 84-85 22.575 25.825 27.6125 23.9875 86-87 23.925 25.95 26.237500000000004 23.8875 88-89 22.675 25.7625 25.3125 26.25 90-91 23.3 26.187500000000004 26.85 23.6625 92-93 23.3125 25.4 26.1 25.1875 94-95 23.0125 24.9375 26.200000000000003 25.85 96-97 24.2625 25.662499999999998 25.775 24.3 98-99 23.825 25.5125 25.85 24.8125 100-101 24.6 23.7375 25.95 25.7125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 24.0 1 20.0 2 11.0 3 5.0 4 5.0 5 4.5 6 3.5 7 5.5 8 4.0 9 2.5 10 3.0 11 2.0 12 2.5 13 2.0 14 0.5 15 1.0 16 1.5 17 1.5 18 3.5 19 3.0 20 0.5 21 1.0 22 2.5 23 3.0 24 4.0 25 5.0 26 4.5 27 4.5 28 5.0 29 10.5 30 14.5 31 20.0 32 22.5 33 25.0 34 32.0 35 40.0 36 55.0 37 66.0 38 84.0 39 117.5 40 141.5 41 155.0 42 167.5 43 197.5 44 207.5 45 192.0 46 200.5 47 200.5 48 179.0 49 163.0 50 158.5 51 148.0 52 129.5 53 108.5 54 101.5 55 98.0 56 92.0 57 87.0 58 68.0 59 63.5 60 65.5 61 64.0 62 55.5 63 43.5 64 42.0 65 34.5 66 31.0 67 24.5 68 25.0 69 25.0 70 16.0 71 14.5 72 13.5 73 13.0 74 11.5 75 10.0 76 9.5 77 9.0 78 8.5 79 5.0 80 1.5 81 1.5 82 1.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 3.225 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.475 #Duplication Level Percentage of deduplicated Percentage of total 1 98.87150551423441 96.375 2 0.8207232623749678 1.6 3 0.15388561169530648 0.44999999999999996 4 0.05129520389843549 0.2 5 0.025647601949217745 0.125 6 0.05129520389843549 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025647601949217745 0.95 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 38 0.95 No Hit CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 6 0.15 No Hit CCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.037500000000000006 0.0 0.0 0.0 0.0 34-35 0.0875 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1125 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.1625 0.0 0.0 0.0 0.0 44-45 0.2375 0.0 0.0 0.0 0.0 46-47 0.3 0.0 0.0 0.0 0.0 48-49 0.375 0.0 0.0 0.0 0.0 50-51 0.475 0.0 0.0 0.0 0.0 52-53 0.5625 0.0 0.0 0.0 0.0 54-55 0.625 0.0 0.0 0.0 0.0 56-57 0.825 0.0 0.0 0.0 0.0 58-59 0.9375 0.0 0.0 0.0 0.0 60-61 1.0375 0.0 0.0 0.0 0.0 62-63 1.2375 0.0 0.0 0.0 0.0 64-65 1.3624999999999998 0.0 0.0 0.0 0.0 66-67 1.5 0.0 0.0 0.0 0.0 68-69 1.75 0.0 0.0 0.0 0.0 70-71 1.95 0.0 0.0 0.0 0.0 72-73 2.3 0.0 0.0 0.0 0.0 74-75 2.55 0.0 0.0 0.0 0.0 76-77 2.8 0.0 0.0 0.0 0.0 78-79 3.0999999999999996 0.0 0.0 0.0 0.0 80-81 3.45 0.0 0.0 0.0 0.0 82-83 3.7249999999999996 0.0 0.0 0.0 0.0 84-85 4.1125 0.0 0.0 0.0 0.0 86-87 4.4625 0.0 0.0 0.0 0.0 88-89 4.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2061821 spots for ERR3317455.sra Written 2061821 spots for ERR3317455.sra Read 2061821 spots for ERR3317455.sra Written 2061821 spots for ERR3317455.sra Read 2061821 spots for ERR3317455.sra Written 2061821 spots for ERR3317455.sra Read 2061821 spots for ERR3317455.sra Written 2061821 spots for ERR3317455.sra Read 2061821 spots for ERR3317455.sra Written 2061821 spots for ERR3317455.sra Read 2061821 spots for ERR3317455.sra Written 2061821 spots for ERR3317455.sra Read 2061821 spots for ERR3317455.sra Written 2061821 spots for ERR3317455.sra Read 2061821 spots for ERR3317455.sra Written 2061821 spots for ERR3317455.sra Read 2061821 spots for ERR3317455.sra Written 2061821 spots for ERR3317455.sra Read 2061821 spots for ERR3317455.sra Written 2061821 spots for ERR3317455.sra Read 2061821 spots for ERR3317455.sra Written 2061821 spots for ERR3317455.sra Read 2061821 spots for ERR3317455.sra Written 2061821 spots for ERR3317455.sra Read 2061821 spots for ERR3317455.sra Written 2061821 spots for ERR3317455.sra Read 2061821 spots for ERR3317455.sra Written 2061821 spots for ERR3317455.sra Read 2061821 spots for ERR3317455.sra Written 2061821 spots for ERR3317455.sra Read 2061821 spots for ERR3317455.sra Written 2061821 spots for ERR3317455.sra Read 2061821 spots for ERR3317455.sra Written 2061821 spots for ERR3317455.sra Read 2061829 spots for ERR3317455.sra Written 2061829 spots for ERR3317455.sra Read 2061821 spots for ERR3317455.sra Written 2061821 spots for ERR3317455.sra Read 2061821 spots for ERR3317455.sra Written 2061821 spots for ERR3317455.sra SRR ids: ['ERR3317455.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_75vhr3xi ERR3317455.sra spots: 41236428 blocks: [[1, 2061821], [2061822, 4123642], [4123643, 6185463], [6185464, 8247284], [8247285, 10309105], [10309106, 12370926], [12370927, 14432747], [14432748, 16494568], [16494569, 18556389], [18556390, 20618210], [20618211, 22680031], [22680032, 24741852], [24741853, 26803673], [26803674, 28865494], [28865495, 30927315], [30927316, 32989136], [32989137, 35050957], [35050958, 37112778], [37112779, 39174599], [39174600, 41236428]] ERR3317455 file size 9924977 ERR3317455 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317455 ERR3317455_1.fastq ERR3317455_2.fastq Input file: ERR3317455_1.fastq Paired file: ERR3317455_2.fastq trimmed: ERR3317455-trimmed-pair1.fastq, ERR3317455-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:51:42 2024 >> started Tue Dec 10 09:52:29 2024 >> done (47.444s) 41236428 read pairs processed; of these: 288147 ( 0.70%) short read pairs filtered out after trimming by size control 859609 ( 2.08%) empty read pairs filtered out after trimming by size control 40088672 (97.22%) read pairs available; of these: 11202081 (27.94%) trimmed read pairs available after processing 28886591 (72.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 563 0.00% 19 538 0.00% 20 735 0.00% 21 880 0.00% 22 1304 0.00% 23 1768 0.00% 24 2243 0.01% 25 2668 0.01% 26 3276 0.01% 27 3774 0.01% 28 4016 0.01% 29 4510 0.01% 30 4934 0.01% 31 6314 0.02% 32 6601 0.02% 33 7223 0.02% 34 8453 0.02% 35 9219 0.02% 36 10103 0.03% 37 10841 0.03% 38 12635 0.03% 39 13013 0.03% 40 13831 0.03% 41 15677 0.04% 42 16835 0.04% 43 17536 0.04% 44 19007 0.05% 45 19875 0.05% 46 21418 0.05% 47 24173 0.06% 48 24906 0.06% 49 25939 0.06% 50 29860 0.07% 51 29473 0.07% 52 30822 0.08% 53 33574 0.08% 54 38491 0.10% 55 42014 0.10% 56 41797 0.10% 57 46133 0.12% 58 46855 0.12% 59 65138 0.16% 60 76860 0.19% 61 82459 0.21% 62 90653 0.23% 63 96439 0.24% 64 100383 0.25% 65 107426 0.27% 66 116998 0.29% 67 116108 0.29% 68 119539 0.30% 69 122199 0.30% 70 128504 0.32% 71 137084 0.34% 72 146493 0.37% 73 144924 0.36% 74 145154 0.36% 75 144716 0.36% 76 147355 0.37% 77 151023 0.38% 78 165893 0.41% 79 159715 0.40% 80 165001 0.41% 81 171556 0.43% 82 169930 0.42% 83 181840 0.45% 84 182118 0.45% 85 196237 0.49% 86 201739 0.50% 87 210517 0.53% 88 215575 0.54% 89 238240 0.59% 90 230727 0.58% 91 247102 0.62% 92 256223 0.64% 93 282344 0.70% 94 307174 0.77% 95 329765 0.82% 96 367712 0.92% 97 443029 1.11% 98 616507 1.54% 99 795287 1.98% 100 2174568 5.42% 101 28886591 72.06% 40088672 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=26 prefix-density=0.57 prefix-fanout=2.0 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=34.88 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=8.7 sequence=GAGGAGAAGAAACTTACAAGGATTCCCCTAGTAACGGCGAGCGAACCGGGAGCAGCCCAGCTTGAGAATCGGGCGGCC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=25 prefix-density=0.63 prefix-fanout=2.2 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=83.29 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=2.0 sequence=TATAAGAAAGAAAGTGATTTTCTCAACTCTTTCAAACTTTTAGGAATTCACATATGCAAGCTAGCTCCTCGATCGAGAGCCAGGTTGCTACACACAACAACAATCTTGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTGAGCTGACACTTTATATATGGTCCATCTTAATACGGAGCTGTCCTTGGTTGTTTATGCCTTGCCGGATTCCTCGCAGCCCGGTGGCTT ERR3317455 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:53:14 Started mapping on | Dec 10 09:53:14 Finished on | Dec 10 09:55:44 Mapping speed, Million of reads per hour | 962.13 Number of input reads | 40088672 Average input read length | 193 UNIQUE READS: Uniquely mapped reads number | 34753887 Uniquely mapped reads % | 86.69% Average mapped length | 192.61 Number of splices: Total | 22450561 Number of splices: Annotated (sjdb) | 21427995 Number of splices: GT/AG | 22124797 Number of splices: GC/AG | 291531 Number of splices: AT/AC | 16407 Number of splices: Non-canonical | 17826 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.00% Deletion average length | 1.21 Insertion rate per base | 0.00% Insertion average length | 1.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2855374 % of reads mapped to multiple loci | 7.12% Number of reads mapped to too many loci | 207240 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.40% % of reads unmapped: other | 3.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2709851 2709851 2709851 N_multimapping 2855374 2855374 2855374 N_noFeature 1403441 2974259 32445856 N_ambiguous 1026876 323935 17513 UnstrandedReadsAssigned:32323570 PositiveStrandReadsAssigned:31455693 NegativeStrandReadsAssigned:2290518 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=99 echo kmer=95 ERR3317455 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317455-trimmed-pair1.fastq ERR3317455-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,088,672 reads, 33,445,158 reads pseudoaligned [quant] estimated average fragment length: 199.877 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52973 ERR3317455.ke.tsv 35125 ERR3317455.se.tsv 88098 total ==> ERR3317455.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 737.338 0 0 PNS24247 1044 845.123 51.1611 2.69621 PNS24249 1928 1729.12 102.94 2.65151 PNS24246 1044 845.123 51.1611 2.69621 PNS24248 1044 845.123 51.1611 2.69621 PNS24244 1471 1272.12 239.577 8.38782 PNS24243 293 123.389 1 0.360958 KQK14069 1603 1404.12 2034.93 64.5473 KQK14071 474 282.371 12.1844 1.92184 ==> ERR3317455.se.tsv <== BRADI_1g14170v3 2296 BRADI_1g53295v3 269 BRADI_1g59795v3 574 BRADI_1g07683v3 1 BRADI_1g00485v3 99 BRADI_1g20270v3 2555 BRADI_1g74790v3 483 BRADI_1g09890v3 5 BRADI_1g77505v3 432 BRADI_1g48960v3 0 ERR3317455 completed mapping pipeline successfully