Starting /dee2/code/volunteer_pipeline.sh ERR3317456 current disk space = 1524942012416 free memory = 1595825512 ERR3317456 SRAfilesize 4e4994078f9272a640fbc5952d2f7341 ERR3317456.sra ERR3317456.sra file validated ERR3317456 is paired end ERR3317456 is conventional basespace ERR3317456 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317456_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.76575 34.0 31.0 34.0 31.0 34.0 2 32.44775 34.0 31.0 34.0 31.0 34.0 3 32.93975 34.0 33.0 34.0 31.0 34.0 4 36.417 37.0 37.0 37.0 35.0 37.0 5 36.439 37.0 37.0 37.0 35.0 37.0 6 36.2815 37.0 37.0 37.0 35.0 37.0 7 36.37625 37.0 37.0 37.0 35.0 37.0 8 36.40875 37.0 37.0 37.0 35.0 37.0 9 38.204 39.0 39.0 39.0 37.0 39.0 10-11 38.165125 39.0 39.0 39.0 37.0 39.0 12-13 38.154875000000004 39.0 39.0 39.0 37.0 39.0 14-15 39.762625 41.0 40.0 41.0 37.0 41.0 16-17 39.732749999999996 41.0 40.0 41.0 37.0 41.0 18-19 39.710125000000005 41.0 40.0 41.0 37.0 41.0 20-21 39.7195 41.0 40.0 41.0 37.0 41.0 22-23 39.572375 41.0 40.0 41.0 37.0 41.0 24-25 39.399125 41.0 39.5 41.0 36.5 41.0 26-27 39.2765 41.0 39.0 41.0 36.0 41.0 28-29 39.268125 41.0 39.0 41.0 36.0 41.0 30-31 39.07725 41.0 39.0 41.0 35.5 41.0 32-33 38.78575 40.0 38.5 41.0 35.0 41.0 34-35 38.500875 40.0 38.0 41.0 34.5 41.0 36-37 38.338 40.0 38.0 41.0 34.5 41.0 38-39 38.067625 40.0 38.0 41.0 33.5 41.0 40-41 37.886 40.0 38.0 41.0 33.0 41.0 42-43 37.98575 40.0 38.0 41.0 33.0 41.0 44-45 37.8595 40.0 37.5 41.0 33.0 41.0 46-47 37.612375 40.0 37.0 41.0 32.5 41.0 48-49 37.35975 40.0 36.5 41.0 32.0 41.0 50-51 37.588750000000005 40.0 36.5 41.0 33.0 41.0 52-53 37.425875000000005 40.0 36.0 41.0 33.0 41.0 54-55 37.08075 39.0 35.5 41.0 32.5 41.0 56-57 36.937 39.0 35.0 41.0 32.0 41.0 58-59 36.646874999999994 39.0 35.0 41.0 32.0 41.0 60-61 36.265875 38.0 35.0 41.0 31.0 41.0 62-63 35.822 37.0 35.0 40.0 30.5 41.0 64-65 35.534499999999994 37.0 35.0 40.0 31.0 41.0 66-67 35.118875 36.0 35.0 39.0 30.0 41.0 68-69 34.78675 36.0 34.5 39.0 30.0 41.0 70-71 34.388625000000005 35.0 34.0 38.5 30.0 40.0 72-73 33.95425 35.0 34.0 37.0 29.0 39.5 74-75 33.482749999999996 35.0 34.0 37.0 28.0 39.0 76-77 32.146625 34.5 32.0 35.5 26.0 37.5 78-79 32.670500000000004 35.0 33.0 36.0 26.5 37.0 80-81 32.557874999999996 35.0 33.0 35.5 27.0 37.0 82-83 32.2395 35.0 33.0 35.0 26.5 36.5 84-85 31.903125 35.0 33.0 35.0 25.5 36.0 86-87 31.54 35.0 33.0 35.0 24.0 36.0 88-89 31.399625 35.0 33.0 35.0 24.0 36.0 90-91 31.146250000000002 35.0 33.0 35.0 23.0 35.0 92-93 30.933374999999998 35.0 32.0 35.0 21.5 35.0 94-95 30.738750000000003 35.0 32.0 35.0 19.5 35.0 96-97 30.372374999999998 35.0 32.0 35.0 16.0 35.0 98-99 29.977375 35.0 31.5 35.0 2.0 35.0 100-101 27.533749999999998 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 3.0 10 6.0 11 4.0 12 9.0 13 8.0 14 13.0 15 12.0 16 4.0 17 7.0 18 11.0 19 14.0 20 13.0 21 15.0 22 16.0 23 18.0 24 21.0 25 19.0 26 28.0 27 38.0 28 45.0 29 41.0 30 64.0 31 66.0 32 85.0 33 124.0 34 217.0 35 294.0 36 569.0 37 1004.0 38 1080.0 39 150.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.592496091714438 24.960917144346016 20.37519541427827 27.071391349661283 2 25.874999999999996 25.2 18.675 30.25 3 24.675 27.1 19.0 29.225 4 26.474999999999998 25.424999999999997 18.125 29.975 5 27.85 24.4 17.275 30.475 6 28.249999999999996 27.224999999999998 20.125 24.4 7 28.825 25.650000000000002 21.525 24.0 8 31.55 24.7 24.3 19.45 9 30.85 26.075 25.275 17.8 10-11 32.625 26.5 22.650000000000002 18.224999999999998 12-13 29.725 27.400000000000002 22.975 19.900000000000002 14-15 26.650000000000002 26.8375 24.6625 21.85 16-17 26.450000000000003 26.487500000000004 24.1625 22.900000000000002 18-19 26.575 26.375 25.650000000000002 21.4 20-21 24.762500000000003 26.1 26.0 23.1375 22-23 25.2875 26.424999999999997 25.2375 23.05 24-25 24.85 26.3125 25.75 23.0875 26-27 24.5625 27.0125 25.424999999999997 23.0 28-29 25.974999999999998 26.0625 24.65 23.3125 30-31 24.95 27.3875 25.4875 22.175 32-33 25.650000000000002 26.75 24.675 22.925 34-35 25.0375 26.625 25.337500000000002 23.0 36-37 24.762500000000003 26.950000000000003 25.95 22.3375 38-39 25.087500000000002 26.5375 25.6 22.775000000000002 40-41 24.9875 26.35 25.1 23.5625 42-43 26.4125 25.0625 25.25 23.275000000000002 44-45 25.575 26.5625 24.8 23.0625 46-47 24.712500000000002 26.5 24.224999999999998 24.5625 48-49 25.924999999999997 27.212500000000002 24.575 22.287499999999998 50-51 24.825 26.787499999999998 25.687500000000004 22.7 52-53 26.1 26.3625 24.7375 22.8 54-55 25.587500000000002 26.337500000000002 25.162499999999998 22.912499999999998 56-57 24.9 25.775 24.7875 24.5375 58-59 24.9 26.900000000000002 24.625 23.575 60-61 25.35 26.0375 26.05 22.5625 62-63 25.324999999999996 26.650000000000002 25.337500000000002 22.6875 64-65 26.387500000000003 25.2375 25.0625 23.3125 66-67 25.0625 26.150000000000002 25.374999999999996 23.4125 68-69 25.587500000000002 26.75 24.837500000000002 22.825 70-71 25.637500000000003 26.7625 23.962500000000002 23.6375 72-73 25.674999999999997 27.0 24.8 22.525000000000002 74-75 25.4625 27.1625 24.9125 22.4625 76-77 25.95 25.887500000000003 23.9125 24.25 78-79 26.0625 25.924999999999997 25.4375 22.575 80-81 25.924999999999997 26.0125 24.675 23.3875 82-83 26.3125 26.55 23.1125 24.025 84-85 25.2625 26.6625 24.887500000000003 23.1875 86-87 24.9875 27.425 24.2 23.3875 88-89 25.4625 27.187499999999996 24.0625 23.2875 90-91 25.637500000000003 27.537499999999998 24.45 22.375 92-93 25.3 27.6875 24.775 22.237499999999997 94-95 25.3125 27.6375 24.1375 22.912499999999998 96-97 25.1 27.6125 24.575 22.7125 98-99 24.975 26.987499999999997 24.8125 23.225 100-101 25.5 25.974999999999998 24.337500000000002 24.1875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 1.5 6 1.0 7 0.0 8 2.5 9 3.5 10 1.5 11 1.5 12 2.0 13 1.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 1.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 2.5 26 2.0 27 1.5 28 3.5 29 9.0 30 11.5 31 12.5 32 16.5 33 17.5 34 20.5 35 31.0 36 43.5 37 62.0 38 81.0 39 102.0 40 125.5 41 141.5 42 164.0 43 187.5 44 197.5 45 203.0 46 220.0 47 227.5 48 194.0 49 187.0 50 179.0 51 155.5 52 140.0 53 119.0 54 113.5 55 92.5 56 80.0 57 85.0 58 81.0 59 66.0 60 54.5 61 62.0 62 62.0 63 51.5 64 45.0 65 36.0 66 37.0 67 37.5 68 27.0 69 22.5 70 23.0 71 22.0 72 21.0 73 20.0 74 16.5 75 12.0 76 9.0 77 4.5 78 3.5 79 5.0 80 6.0 81 5.5 82 4.5 83 3.5 84 2.0 85 2.0 86 1.5 87 2.0 88 2.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.225 #Duplication Level Percentage of deduplicated Percentage of total 1 98.70195978620514 96.95 2 0.9926189870195978 1.95 3 0.17816238228556885 0.525 4 0.050903537795876815 0.2 5 0.07635530669381523 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCCCTACCAAGCAGCAGCCATGGCAGCGTCTCTCCAGGCCGCCGCCACC 5 0.125 No Hit TTGGGGATGATTCTGTATTACAATTTGGTGGAGGAACTTTAGGACATCCT 5 0.125 No Hit TGCTCGTGAAGGTAATGAAATTATCCGAGCAGCTTGCAAATGGAGTCCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.0875 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.225 0.0 0.0 0.0 0.0 34-35 0.25 0.0 0.0 0.0 0.0 36-37 0.35 0.0 0.0 0.0 0.0 38-39 0.475 0.0 0.0 0.0 0.0 40-41 0.5375 0.0 0.0 0.0 0.0 42-43 0.625 0.0 0.0 0.0 0.0 44-45 0.6625000000000001 0.0 0.0 0.0 0.0 46-47 0.725 0.0 0.0 0.0 0.0 48-49 0.825 0.0 0.0 0.0 0.0 50-51 0.9625 0.0 0.0 0.0 0.0 52-53 1.1 0.0 0.0 0.0 0.0 54-55 1.2125 0.0 0.0 0.0 0.0 56-57 1.4 0.0 0.0 0.0 0.0 58-59 1.5750000000000002 0.0 0.0 0.0 0.0 60-61 1.8 0.0 0.0 0.0 0.0 62-63 2.0999999999999996 0.0 0.0 0.0 0.0 64-65 2.3125 0.0 0.0 0.0 0.0 66-67 2.5875000000000004 0.0 0.0 0.0 0.0 68-69 2.9625 0.0 0.0 0.0 0.0 70-71 3.2875 0.0 0.0 0.0 0.0 72-73 3.7375 0.0 0.0 0.0 0.0 74-75 4.074999999999999 0.0 0.0 0.0 0.0 76-77 4.4625 0.0 0.0 0.0 0.0 78-79 5.0 0.0 0.0 0.0 0.0 80-81 5.550000000000001 0.0 0.0 0.0 0.0 82-83 6.2125 0.0 0.0 0.0 0.0 84-85 6.875 0.0 0.0 0.0 0.0 86-87 7.887499999999999 0.0 0.0 0.0 0.0 88-89 8.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317456 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317456_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.13525 33.0 31.0 34.0 31.0 34.0 2 32.25 34.0 31.0 34.0 31.0 34.0 3 32.1995 34.0 31.0 34.0 30.0 34.0 4 35.5485 37.0 35.0 37.0 35.0 37.0 5 35.65 37.0 35.0 37.0 35.0 37.0 6 35.82325 37.0 37.0 37.0 35.0 37.0 7 35.832 37.0 37.0 37.0 35.0 37.0 8 35.798 37.0 37.0 37.0 35.0 37.0 9 37.53725 39.0 39.0 39.0 35.0 39.0 10-11 37.611125 39.0 39.0 39.0 35.0 39.0 12-13 37.619 39.0 39.0 39.0 35.0 39.0 14-15 39.16525 41.0 40.0 41.0 36.5 41.0 16-17 39.102500000000006 41.0 40.0 41.0 36.0 41.0 18-19 39.007374999999996 41.0 40.0 41.0 36.0 41.0 20-21 38.941125 41.0 40.0 41.0 36.0 41.0 22-23 38.898250000000004 41.0 40.0 41.0 35.5 41.0 24-25 38.813 41.0 39.0 41.0 35.0 41.0 26-27 38.72 41.0 39.0 41.0 35.0 41.0 28-29 38.605125 41.0 39.0 41.0 35.0 41.0 30-31 38.555 41.0 39.0 41.0 35.0 41.0 32-33 38.43875 41.0 39.0 41.0 35.0 41.0 34-35 38.2345 40.0 38.0 41.0 34.5 41.0 36-37 38.06725 40.0 38.0 41.0 34.0 41.0 38-39 37.931250000000006 40.0 38.0 41.0 33.5 41.0 40-41 38.082499999999996 40.0 38.0 41.0 34.0 41.0 42-43 38.04475 40.0 38.0 41.0 34.0 41.0 44-45 37.885125 40.0 38.0 41.0 33.5 41.0 46-47 37.696250000000006 40.0 38.0 41.0 33.0 41.0 48-49 37.516125 40.0 37.0 41.0 33.0 41.0 50-51 36.557625 39.0 36.0 40.5 31.0 40.5 52-53 36.549375 39.0 35.5 40.5 31.5 41.0 54-55 36.821 40.0 35.5 41.0 31.5 41.0 56-57 36.6455 39.5 35.0 41.0 32.0 41.0 58-59 36.39575 39.0 35.0 41.0 31.0 41.0 60-61 36.047875000000005 39.0 35.0 41.0 30.0 41.0 62-63 35.8495 38.0 35.0 41.0 30.0 41.0 64-65 35.475625 37.5 35.0 40.0 29.5 41.0 66-67 35.455124999999995 37.0 35.0 40.0 31.0 41.0 68-69 35.036 36.5 35.0 39.5 30.0 41.0 70-71 34.861625000000004 36.0 35.0 39.0 30.0 41.0 72-73 34.512625 36.0 35.0 39.0 30.0 41.0 74-75 34.096875 35.0 35.0 37.5 30.0 39.5 76-77 33.809375 35.0 35.0 37.0 30.0 39.0 78-79 33.413624999999996 35.0 34.0 36.5 29.0 39.0 80-81 33.0635 35.0 34.0 36.0 29.0 37.0 82-83 32.83275 35.0 34.0 36.0 29.0 37.0 84-85 32.582625 35.0 34.0 35.0 29.0 37.0 86-87 32.274 35.0 34.0 35.0 27.0 36.0 88-89 32.078374999999994 35.0 34.0 35.0 26.5 36.0 90-91 31.916249999999998 35.0 34.0 35.0 26.0 36.0 92-93 31.7115 35.0 33.0 35.0 25.0 35.0 94-95 31.5815 35.0 33.0 35.0 25.0 35.0 96-97 31.264875 35.0 33.0 35.0 24.0 35.0 98-99 31.039625 35.0 33.0 35.0 23.0 35.0 100-101 29.067125 33.5 29.0 34.5 10.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 39.0 3 6.0 4 6.0 5 3.0 6 8.0 7 5.0 8 3.0 9 4.0 10 3.0 11 9.0 12 5.0 13 9.0 14 4.0 15 8.0 16 6.0 17 16.0 18 7.0 19 14.0 20 12.0 21 16.0 22 10.0 23 8.0 24 12.0 25 14.0 26 14.0 27 28.0 28 24.0 29 44.0 30 44.0 31 52.0 32 56.0 33 103.0 34 139.0 35 236.0 36 457.0 37 973.0 38 1317.0 39 286.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.825000000000003 11.025 29.349999999999998 28.799999999999997 2 26.775 10.75 25.775 36.7 3 22.55 13.175 29.775000000000002 34.5 4 23.05 10.725 28.075 38.15 5 24.825 14.174999999999999 24.9 36.1 6 25.45 17.925 30.775000000000002 25.85 7 19.0 24.474999999999998 38.800000000000004 17.724999999999998 8 17.9 25.85 35.575 20.674999999999997 9 17.875 29.075 34.175 18.875 10-11 19.67745968246031 26.64083010376297 32.341542692836605 21.340167520940117 12-13 19.489936242030254 27.628453556694588 31.928991123890487 20.952619077384675 14-15 19.99499812429661 25.797173940227587 30.949105914718018 23.258722020757787 16-17 20.46761690422606 25.081270317579396 29.657414353588397 24.793698424606152 18-19 20.27263631815908 26.550775387693847 29.977488744372188 23.19909954977489 20-21 21.370513942728522 26.259847442791045 28.460672752282107 23.908965862198325 22-23 21.585792896448226 25.737868934467233 28.16408204102051 24.512256128064035 24-25 19.889986248281037 26.16577072134017 30.003750468808597 23.940492561570196 26-27 21.025 26.25 27.85 24.875 28-29 21.15 24.9375 27.462500000000002 26.450000000000003 30-31 19.9625 26.137500000000003 29.2875 24.6125 32-33 22.225 25.924999999999997 27.650000000000002 24.2 34-35 21.05 25.5125 27.05 26.387500000000003 36-37 21.75 25.474999999999998 28.4375 24.337500000000002 38-39 22.1375 26.937499999999996 26.35 24.575 40-41 23.2125 25.45 26.237500000000004 25.1 42-43 22.075 25.25 26.8125 25.8625 44-45 22.62782847855982 26.67833479184898 25.703212901612705 24.990623827978496 46-47 21.465183147893487 26.140767595949495 26.378297287160894 26.015751968996128 48-49 21.7875 27.325 26.625 24.2625 50-51 22.825 25.7 26.5125 24.962500000000002 52-53 22.025 25.25 26.950000000000003 25.775 54-55 22.45 25.75 27.987499999999997 23.8125 56-57 22.1375 24.6125 27.925 25.324999999999996 58-59 22.0 24.3125 27.8375 25.85 60-61 21.15 25.5375 28.249999999999996 25.0625 62-63 22.75 26.0625 26.5375 24.65 64-65 22.8125 25.525 26.5625 25.1 66-67 23.175 25.324999999999996 28.499999999999996 23.0 68-69 22.7 26.0625 26.8 24.4375 70-71 22.490311288911112 25.528191023877984 26.465808226028255 25.51568946118265 72-73 22.8 25.887500000000003 25.7625 25.55 74-75 21.265158144768094 25.50318789848731 28.078509813726715 25.153144143017876 76-77 23.625 25.7375 25.05 25.587500000000002 78-79 23.125 26.5 25.674999999999997 24.7 80-81 23.625 26.375 26.25 23.75 82-83 23.7875 26.325 25.0625 24.825 84-85 22.9375 26.8125 26.137500000000003 24.1125 86-87 25.2625 24.55 26.1 24.087500000000002 88-89 24.375 25.55 25.4625 24.6125 90-91 24.0625 26.825 25.6 23.5125 92-93 24.6875 25.724999999999998 25.0 24.587500000000002 94-95 23.5875 25.924999999999997 25.374999999999996 25.112499999999997 96-97 25.074999999999996 26.0375 25.4375 23.45 98-99 24.6625 26.150000000000002 24.925 24.2625 100-101 25.4 25.525 25.3 23.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 13.0 1 9.5 2 6.5 3 5.5 4 3.0 5 2.5 6 3.5 7 3.0 8 1.0 9 0.5 10 1.0 11 1.0 12 0.5 13 1.0 14 2.0 15 2.0 16 2.0 17 3.0 18 5.0 19 4.0 20 1.0 21 0.5 22 1.5 23 2.0 24 1.5 25 3.0 26 5.0 27 5.5 28 9.0 29 9.5 30 9.0 31 12.5 32 15.5 33 24.5 34 32.5 35 41.0 36 56.0 37 71.0 38 99.0 39 122.0 40 139.5 41 178.0 42 201.5 43 202.5 44 201.5 45 201.0 46 205.5 47 203.5 48 188.5 49 174.0 50 166.0 51 163.5 52 146.5 53 121.5 54 101.0 55 80.0 56 77.5 57 73.5 58 60.0 59 53.5 60 49.5 61 46.5 62 46.5 63 46.5 64 40.0 65 33.0 66 28.5 67 24.5 68 24.0 69 20.0 70 17.0 71 17.0 72 17.0 73 13.5 74 11.0 75 8.5 76 4.5 77 3.5 78 3.0 79 5.0 80 5.0 81 3.0 82 2.5 83 2.5 84 1.5 85 1.0 86 0.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0125 12-13 0.0125 14-15 0.0375 16-17 0.025 18-19 0.05 20-21 0.0375 22-23 0.05 24-25 0.0125 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0125 46-47 0.0125 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0125 72-73 0.0 74-75 0.0125 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08116385911178 97.05 2 0.587034201123022 1.15 3 0.17866258295048493 0.525 4 0.05104645227156713 0.2 5 0.025523226135783564 0.125 6 0.025523226135783564 0.15 7 0.025523226135783564 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025523226135783564 0.625 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 25 0.625 No Hit TCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 7 0.17500000000000002 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 6 0.15 No Hit TCTTCGTATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.0875 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.225 0.0 0.0 0.0 0.0 34-35 0.225 0.0 0.0 0.0 0.0 36-37 0.32499999999999996 0.0 0.0 0.0 0.0 38-39 0.44999999999999996 0.0 0.0 0.0 0.0 40-41 0.5125 0.0 0.0 0.0 0.0 42-43 0.6 0.0 0.0 0.0 0.0 44-45 0.6375 0.0 0.0 0.0 0.0 46-47 0.7 0.0 0.0 0.0 0.0 48-49 0.8 0.0 0.0 0.0 0.0 50-51 0.9375 0.0 0.0 0.0 0.0 52-53 1.075 0.0 0.0 0.0 0.0 54-55 1.1875 0.0 0.0 0.0 0.0 56-57 1.35 0.0 0.0 0.0 0.0 58-59 1.525 0.0 0.0 0.0 0.0 60-61 1.7375 0.0 0.0 0.0 0.0 62-63 2.05 0.0 0.0 0.0 0.0 64-65 2.2375 0.0 0.0 0.0 0.0 66-67 2.4875 0.0 0.0 0.0 0.0 68-69 2.8625 0.0 0.0 0.0 0.0 70-71 3.2125 0.0 0.0 0.0 0.0 72-73 3.6625 0.0 0.0 0.0 0.0 74-75 3.9875 0.0 0.0 0.0 0.0 76-77 4.375 0.0 0.0 0.0 0.0 78-79 4.9 0.0 0.0 0.0 0.0 80-81 5.449999999999999 0.0 0.0 0.0 0.0 82-83 6.112500000000001 0.0 0.0 0.0 0.0 84-85 6.8125 0.0 0.0 0.0 0.0 86-87 7.8500000000000005 0.0 0.0 0.0 0.0 88-89 8.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2029139 spots for ERR3317456.sra Written 2029139 spots for ERR3317456.sra Read 2029139 spots for ERR3317456.sra Written 2029139 spots for ERR3317456.sra Read 2029139 spots for ERR3317456.sra Written 2029139 spots for ERR3317456.sra Read 2029139 spots for ERR3317456.sra Written 2029139 spots for ERR3317456.sra Read 2029139 spots for ERR3317456.sra Written 2029139 spots for ERR3317456.sra Read 2029139 spots for ERR3317456.sra Written 2029139 spots for ERR3317456.sra Read 2029144 spots for ERR3317456.sra Written 2029144 spots for ERR3317456.sra Read 2029139 spots for ERR3317456.sra Written 2029139 spots for ERR3317456.sra Read 2029139 spots for ERR3317456.sra Written 2029139 spots for ERR3317456.sra Read 2029139 spots for ERR3317456.sra Written 2029139 spots for ERR3317456.sra Read 2029139 spots for ERR3317456.sra Written 2029139 spots for ERR3317456.sra Read 2029139 spots for ERR3317456.sra Written 2029139 spots for ERR3317456.sra Read 2029139 spots for ERR3317456.sra Written 2029139 spots for ERR3317456.sra Read 2029139 spots for ERR3317456.sra Written 2029139 spots for ERR3317456.sra Read 2029139 spots for ERR3317456.sra Written 2029139 spots for ERR3317456.sra Read 2029139 spots for ERR3317456.sra Written 2029139 spots for ERR3317456.sra Read 2029139 spots for ERR3317456.sra Written 2029139 spots for ERR3317456.sra Read 2029139 spots for ERR3317456.sra Written 2029139 spots for ERR3317456.sra Read 2029139 spots for ERR3317456.sra Written 2029139 spots for ERR3317456.sra Read 2029139 spots for ERR3317456.sra Written 2029139 spots for ERR3317456.sra SRR ids: ['ERR3317456.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p4j82gyn ERR3317456.sra spots: 40582785 blocks: [[1, 2029139], [2029140, 4058278], [4058279, 6087417], [6087418, 8116556], [8116557, 10145695], [10145696, 12174834], [12174835, 14203973], [14203974, 16233112], [16233113, 18262251], [18262252, 20291390], [20291391, 22320529], [22320530, 24349668], [24349669, 26378807], [26378808, 28407946], [28407947, 30437085], [30437086, 32466224], [32466225, 34495363], [34495364, 36524502], [36524503, 38553641], [38553642, 40582785]] ERR3317456 file size 9767311 ERR3317456 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317456 ERR3317456_1.fastq ERR3317456_2.fastq Input file: ERR3317456_1.fastq Paired file: ERR3317456_2.fastq trimmed: ERR3317456-trimmed-pair1.fastq, ERR3317456-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 09:51:44 2024 >> started Tue Dec 10 09:52:22 2024 >> done (38.025s) 40582785 read pairs processed; of these: 275074 ( 0.68%) short read pairs filtered out after trimming by size control 691550 ( 1.70%) empty read pairs filtered out after trimming by size control 39616161 (97.62%) read pairs available; of these: 12682288 (32.01%) trimmed read pairs available after processing 26933873 (67.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1091 0.00% 19 1210 0.00% 20 1678 0.00% 21 2065 0.01% 22 2388 0.01% 23 3370 0.01% 24 4031 0.01% 25 4767 0.01% 26 5823 0.01% 27 6971 0.02% 28 7347 0.02% 29 9018 0.02% 30 9941 0.03% 31 13714 0.03% 32 12443 0.03% 33 13509 0.03% 34 16478 0.04% 35 16634 0.04% 36 18639 0.05% 37 19470 0.05% 38 22446 0.06% 39 23863 0.06% 40 24173 0.06% 41 26298 0.07% 42 27815 0.07% 43 29596 0.07% 44 31569 0.08% 45 32325 0.08% 46 35168 0.09% 47 39688 0.10% 48 41195 0.10% 49 43479 0.11% 50 47942 0.12% 51 47839 0.12% 52 49570 0.13% 53 53868 0.14% 54 59227 0.15% 55 61742 0.16% 56 63613 0.16% 57 67847 0.17% 58 72800 0.18% 59 90429 0.23% 60 100579 0.25% 61 109065 0.28% 62 115087 0.29% 63 120905 0.31% 64 130137 0.33% 65 141832 0.36% 66 150902 0.38% 67 150778 0.38% 68 149605 0.38% 69 150706 0.38% 70 155351 0.39% 71 161833 0.41% 72 165890 0.42% 73 177630 0.45% 74 176824 0.45% 75 175860 0.44% 76 176155 0.44% 77 184300 0.47% 78 200620 0.51% 79 199841 0.50% 80 202717 0.51% 81 208152 0.53% 82 208948 0.53% 83 217712 0.55% 84 224880 0.57% 85 239068 0.60% 86 246552 0.62% 87 255233 0.64% 88 255160 0.64% 89 275548 0.70% 90 269289 0.68% 91 276485 0.70% 92 291736 0.74% 93 307777 0.78% 94 334003 0.84% 95 381005 0.96% 96 407280 1.03% 97 465676 1.18% 98 572510 1.45% 99 779768 1.97% 100 2005810 5.06% 101 26933873 67.99% 39616161 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=24 prefix-density=0.35 prefix-fanout=2.0 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=116.98 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=17.3 sequence=CCGCCGCCGCCG criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=29 prefix-density=0.34 prefix-fanout=2.2 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCT criterion=fanout-score sequence-density=0.12 sequence-density-rank=10 fanout-score=69.94 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=15.3 sequence=CCTTCTTCTCCTCCTTGGTGGCCTTGGAGGAGATGACGGTCTTGAGGTCGTA ERR3317456 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 09:52:58 Started mapping on | Dec 10 09:52:58 Finished on | Dec 10 09:54:58 Mapping speed, Million of reads per hour | 1188.48 Number of input reads | 39616161 Average input read length | 191 UNIQUE READS: Uniquely mapped reads number | 35900047 Uniquely mapped reads % | 90.62% Average mapped length | 189.67 Number of splices: Total | 22081364 Number of splices: Annotated (sjdb) | 20977694 Number of splices: GT/AG | 21753777 Number of splices: GC/AG | 289836 Number of splices: AT/AC | 17476 Number of splices: Non-canonical | 20275 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.00% Deletion average length | 1.23 Insertion rate per base | 0.00% Insertion average length | 1.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2578970 % of reads mapped to multiple loci | 6.51% Number of reads mapped to too many loci | 53649 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.97% % of reads unmapped: other | 0.76% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1353179 1353179 1353179 N_multimapping 2578970 2578970 2578970 N_noFeature 1276033 3306551 33150101 N_ambiguous 953126 250559 16243 UnstrandedReadsAssigned:33670888 PositiveStrandReadsAssigned:32342937 NegativeStrandReadsAssigned:2733703 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=97 echo kmer=93 ERR3317456 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317456-trimmed-pair1.fastq ERR3317456-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,616,161 reads, 34,182,093 reads pseudoaligned [quant] estimated average fragment length: 185.38 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52973 ERR3317456.ke.tsv 35125 ERR3317456.se.tsv 88098 total ==> ERR3317456.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 751.944 0 0 PNS24247 1044 859.62 68.3334 3.52819 PNS24249 1928 1743.62 206.812 5.26442 PNS24246 1044 859.62 68.3334 3.52819 PNS24248 1044 859.62 68.3334 3.52819 PNS24244 1471 1286.62 268.187 9.25154 PNS24243 293 136.992 3 0.971965 KQK14069 1603 1418.62 6429.16 201.147 KQK14071 474 297.034 23.0392 3.44261 ==> ERR3317456.se.tsv <== BRADI_1g14170v3 7489 BRADI_1g53295v3 219 BRADI_1g59795v3 769 BRADI_1g07683v3 0 BRADI_1g00485v3 77 BRADI_1g20270v3 1191 BRADI_1g74790v3 590 BRADI_1g09890v3 13 BRADI_1g77505v3 456 BRADI_1g48960v3 0 ERR3317456 completed mapping pipeline successfully