Starting /dee2/code/volunteer_pipeline.sh ERR3317457 current disk space = 1524844568576 free memory = 1595523432 ERR3317457 SRAfilesize d949e0076814ab310b44132bd3be230a ERR3317457.sra ERR3317457.sra file validated ERR3317457 is paired end ERR3317457 is conventional basespace ERR3317457 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317457_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6995 34.0 31.0 34.0 31.0 34.0 2 32.3565 34.0 31.0 34.0 31.0 34.0 3 32.775 34.0 31.0 34.0 31.0 34.0 4 36.27425 37.0 37.0 37.0 35.0 37.0 5 36.313 37.0 37.0 37.0 35.0 37.0 6 36.39225 37.0 37.0 37.0 35.0 37.0 7 36.35925 37.0 37.0 37.0 35.0 37.0 8 36.33775 37.0 37.0 37.0 35.0 37.0 9 38.1325 39.0 39.0 39.0 37.0 39.0 10-11 38.082625 39.0 39.0 39.0 36.0 39.0 12-13 38.09675 39.0 39.0 39.0 36.0 39.0 14-15 39.59587500000001 41.0 40.0 41.0 37.0 41.0 16-17 39.583125 41.0 40.0 41.0 37.0 41.0 18-19 39.465125 41.0 39.5 41.0 36.0 41.0 20-21 39.372125 41.0 39.0 41.0 36.5 41.0 22-23 39.29875 41.0 39.0 41.0 36.0 41.0 24-25 39.274 41.0 39.0 41.0 36.0 41.0 26-27 39.15175 41.0 39.0 41.0 35.5 41.0 28-29 38.700625 40.0 38.0 41.0 34.5 41.0 30-31 38.672875000000005 40.0 38.0 41.0 34.5 41.0 32-33 38.580124999999995 40.0 38.0 41.0 34.5 41.0 34-35 38.32175 40.0 38.0 41.0 34.0 41.0 36-37 38.19525 40.0 38.0 41.0 33.5 41.0 38-39 38.087374999999994 40.0 38.0 41.0 33.5 41.0 40-41 37.78875 40.0 37.0 41.0 33.0 41.0 42-43 37.772375 40.0 37.0 41.0 33.0 41.0 44-45 37.477625 40.0 36.5 41.0 32.5 41.0 46-47 37.2995 40.0 36.0 41.0 32.0 41.0 48-49 36.96475 39.5 35.5 41.0 31.0 41.0 50-51 37.2765 40.0 36.0 41.0 32.5 41.0 52-53 37.221999999999994 40.0 35.0 41.0 32.5 41.0 54-55 36.93675 39.0 35.0 41.0 31.5 41.0 56-57 36.539625 39.0 35.0 41.0 31.0 41.0 58-59 36.227999999999994 38.0 35.0 41.0 31.0 41.0 60-61 35.858875 37.5 35.0 40.0 30.5 41.0 62-63 35.499125 37.0 35.0 40.0 30.0 41.0 64-65 35.188500000000005 36.5 34.0 39.5 30.0 41.0 66-67 34.81825 36.0 34.0 39.0 29.0 41.0 68-69 34.343875 35.0 34.0 39.0 29.0 40.5 70-71 33.876125 35.0 34.0 37.5 28.0 40.0 72-73 33.459374999999994 35.0 34.0 37.0 27.0 39.0 74-75 33.1115 35.0 33.5 36.5 26.5 39.0 76-77 31.857875 34.5 31.5 35.0 25.0 37.0 78-79 32.31625 35.0 33.0 36.0 26.0 37.0 80-81 32.10025 35.0 33.0 35.0 25.0 37.0 82-83 31.850375 35.0 33.0 35.0 25.0 36.0 84-85 31.503 35.0 32.5 35.0 24.0 36.0 86-87 31.3335 35.0 32.0 35.0 24.0 36.0 88-89 31.093375 35.0 32.0 35.0 23.0 35.5 90-91 30.798875000000002 35.0 32.0 35.0 20.0 35.0 92-93 30.444625000000002 34.5 31.5 35.0 18.5 35.0 94-95 30.286375 34.5 31.0 35.0 17.5 35.0 96-97 29.94725 34.0 31.0 35.0 6.0 35.0 98-99 29.55225 34.0 31.0 35.0 2.0 35.0 100-101 27.224249999999998 32.5 25.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 4.0 10 2.0 11 6.0 12 14.0 13 5.0 14 5.0 15 8.0 16 11.0 17 11.0 18 11.0 19 11.0 20 9.0 21 14.0 22 14.0 23 20.0 24 29.0 25 36.0 26 36.0 27 33.0 28 57.0 29 59.0 30 64.0 31 91.0 32 122.0 33 153.0 34 203.0 35 311.0 36 576.0 37 1027.0 38 944.0 39 110.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.395132055929572 27.03262558259969 19.86017607457276 25.71206628689798 2 26.3 24.099999999999998 19.425 30.175 3 26.775 26.125 18.075 29.025000000000002 4 26.400000000000002 25.6 16.925 31.075000000000003 5 28.050000000000004 26.1 15.875 29.975 6 28.925 27.400000000000002 18.6 25.074999999999996 7 30.175 23.375 21.175 25.275 8 32.15 25.6 23.775 18.475 9 33.4 26.35 23.200000000000003 17.05 10-11 33.25 26.437500000000004 22.0 18.3125 12-13 31.5 25.55 23.6125 19.3375 14-15 28.525 25.387500000000003 25.4375 20.65 16-17 26.85 25.5 24.925 22.725 18-19 25.424999999999997 26.5 26.05 22.025 20-21 25.7375 26.525 25.137500000000003 22.6 22-23 26.1125 26.0625 25.0 22.825 24-25 25.4375 26.3 25.775 22.4875 26-27 25.2125 26.2875 25.4875 23.0125 28-29 26.5375 26.437500000000004 24.125 22.900000000000002 30-31 26.2125 25.1875 25.674999999999997 22.925 32-33 25.2875 26.5125 25.337500000000002 22.8625 34-35 25.5625 26.525 24.4 23.5125 36-37 25.9875 26.0 25.8125 22.2 38-39 25.0625 26.7625 25.324999999999996 22.85 40-41 26.1 25.275 24.975 23.65 42-43 25.575 25.837500000000002 26.0375 22.55 44-45 25.5 26.087500000000002 26.4625 21.95 46-47 26.150000000000002 25.0375 24.825 23.9875 48-49 26.375 25.874999999999996 25.474999999999998 22.275 50-51 26.2625 26.4625 24.975 22.3 52-53 25.6 26.8625 24.75 22.787499999999998 54-55 26.325 26.1125 25.124999999999996 22.4375 56-57 25.4375 26.2625 25.0125 23.2875 58-59 25.974999999999998 26.087500000000002 24.6875 23.25 60-61 26.4125 25.85 24.9125 22.825 62-63 25.55 26.400000000000002 24.875 23.175 64-65 26.025 25.5125 25.924999999999997 22.537499999999998 66-67 25.4 26.174999999999997 25.074999999999996 23.35 68-69 25.624999999999996 25.95 24.637500000000003 23.7875 70-71 25.3125 27.037499999999998 24.6 23.05 72-73 25.1875 26.125 24.962500000000002 23.724999999999998 74-75 25.45 26.2875 24.5 23.7625 76-77 25.9625 27.037499999999998 23.799999999999997 23.200000000000003 78-79 25.124999999999996 26.8125 25.35 22.7125 80-81 24.887500000000003 26.2125 24.6625 24.2375 82-83 26.325 26.5875 23.9375 23.150000000000002 84-85 25.4 27.1625 24.5375 22.900000000000002 86-87 25.2625 26.5625 24.8125 23.3625 88-89 24.9125 27.525 24.349999999999998 23.2125 90-91 25.275 27.175 24.2875 23.2625 92-93 25.6125 27.437499999999996 24.3625 22.5875 94-95 26.8 26.400000000000002 23.1375 23.6625 96-97 24.337500000000002 27.325 25.362499999999997 22.975 98-99 24.6 26.3125 25.0125 24.075 100-101 25.9625 26.687499999999996 22.5625 24.7875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.0 4 0.5 5 0.5 6 1.0 7 1.0 8 1.0 9 3.0 10 2.0 11 0.5 12 0.5 13 0.0 14 1.0 15 1.5 16 1.5 17 1.0 18 0.0 19 0.5 20 2.0 21 2.0 22 1.0 23 0.5 24 1.5 25 4.0 26 4.0 27 3.5 28 5.5 29 9.0 30 12.5 31 16.0 32 15.0 33 16.5 34 24.0 35 30.0 36 38.5 37 55.5 38 71.0 39 91.0 40 124.5 41 155.0 42 175.5 43 191.0 44 200.0 45 201.0 46 193.5 47 204.0 48 204.0 49 178.0 50 158.5 51 149.0 52 129.5 53 113.0 54 110.5 55 93.0 56 83.0 57 83.0 58 84.0 59 79.0 60 68.5 61 62.0 62 56.5 63 52.0 64 52.5 65 47.5 66 39.5 67 37.5 68 31.5 69 28.5 70 26.0 71 22.5 72 25.0 73 25.5 74 21.0 75 15.0 76 10.5 77 7.0 78 4.5 79 5.5 80 6.0 81 3.0 82 2.5 83 3.0 84 4.0 85 3.5 86 1.5 87 1.0 88 2.0 89 1.5 90 0.5 91 0.5 92 0.0 93 0.0 94 1.0 95 1.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.45 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.875 #Duplication Level Percentage of deduplicated Percentage of total 1 98.26309067688378 96.175 2 1.4303959131545338 2.8000000000000003 3 0.20434227330779056 0.6 4 0.07662835249042146 0.3 5 0.02554278416347382 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGCAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0125 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.0875 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.2 0.0 0.0 0.0 0.0 40-41 0.2625 0.0 0.0 0.0 0.0 42-43 0.3375 0.0 0.0 0.0 0.0 44-45 0.45 0.0 0.0 0.0 0.0 46-47 0.475 0.0 0.0 0.0 0.0 48-49 0.5375000000000001 0.0 0.0 0.0 0.0 50-51 0.675 0.0 0.0 0.0 0.0 52-53 0.7124999999999999 0.0 0.0 0.0 0.0 54-55 0.775 0.0 0.0 0.0 0.0 56-57 0.95 0.0 0.0 0.0 0.0 58-59 1.0875 0.0 0.0 0.0 0.0 60-61 1.2374999999999998 0.0 0.0 0.0 0.0 62-63 1.4125 0.0 0.0 0.0 0.0 64-65 1.625 0.0 0.0 0.0 0.0 66-67 1.825 0.0 0.0 0.0 0.0 68-69 2.125 0.0 0.0 0.0 0.0 70-71 2.375 0.0 0.0 0.0 0.0 72-73 2.625 0.0 0.0 0.0 0.0 74-75 2.875 0.0 0.0 0.0 0.0 76-77 3.2750000000000004 0.0 0.0 0.0 0.0 78-79 3.6875 0.0 0.0 0.0 0.0 80-81 3.9749999999999996 0.0 0.0 0.0 0.0 82-83 4.3625 0.0 0.0 0.0 0.0 84-85 4.725 0.0 0.0 0.0 0.0 86-87 5.300000000000001 0.0 0.0 0.0 0.0 88-89 5.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317457 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317457_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.51575 33.0 31.0 34.0 30.0 34.0 2 31.405 33.0 31.0 34.0 28.0 34.0 3 31.87025 34.0 31.0 34.0 30.0 34.0 4 35.48125 37.0 35.0 37.0 33.0 37.0 5 35.3975 37.0 35.0 37.0 35.0 37.0 6 35.56025 37.0 36.0 37.0 35.0 37.0 7 35.59475 37.0 36.0 37.0 35.0 37.0 8 35.6075 37.0 37.0 37.0 35.0 37.0 9 37.38475 39.0 38.0 39.0 35.0 39.0 10-11 37.4065 39.0 38.0 39.0 35.0 39.0 12-13 37.358625 39.0 38.0 39.0 35.0 39.0 14-15 38.84162499999999 41.0 39.0 41.0 36.0 41.0 16-17 38.788 41.0 39.0 41.0 36.0 41.0 18-19 38.646375000000006 41.0 39.0 41.0 35.0 41.0 20-21 38.540625000000006 41.0 39.0 41.0 34.5 41.0 22-23 38.495000000000005 41.0 39.0 41.0 35.0 41.0 24-25 38.504125 41.0 39.0 41.0 35.0 41.0 26-27 38.399125 41.0 39.0 41.0 35.0 41.0 28-29 38.2085 40.5 38.5 41.0 34.5 41.0 30-31 37.854 40.0 38.0 41.0 33.5 41.0 32-33 37.961749999999995 40.0 38.0 41.0 33.5 41.0 34-35 37.87775 40.0 38.0 41.0 33.0 41.0 36-37 37.7825 40.0 38.0 41.0 33.0 41.0 38-39 37.62775 40.0 38.0 41.0 33.0 41.0 40-41 37.741125 40.0 38.0 41.0 33.0 41.0 42-43 37.645125 40.0 38.0 41.0 33.0 41.0 44-45 37.434 40.0 37.5 41.0 33.0 41.0 46-47 37.366 40.0 37.0 41.0 32.5 41.0 48-49 37.027625 40.0 36.5 41.0 31.0 41.0 50-51 36.379625000000004 39.5 35.5 40.5 30.5 41.0 52-53 36.324 39.0 35.0 40.5 31.0 41.0 54-55 36.429249999999996 39.0 35.0 41.0 31.0 41.0 56-57 36.236625000000004 39.0 35.0 41.0 31.0 41.0 58-59 36.080749999999995 39.0 35.0 41.0 31.0 41.0 60-61 35.668 38.5 35.0 41.0 29.5 41.0 62-63 35.44225 37.5 35.0 40.0 29.5 41.0 64-65 35.051125 37.0 35.0 40.0 29.0 41.0 66-67 34.9225 37.0 35.0 39.5 29.0 41.0 68-69 34.761250000000004 36.0 35.0 39.0 29.0 41.0 70-71 34.434375 36.0 35.0 39.0 29.0 41.0 72-73 33.9755 35.0 34.0 38.0 29.0 40.5 74-75 33.636375 35.0 34.0 37.0 28.5 39.0 76-77 33.263625000000005 35.0 34.0 37.0 28.0 39.0 78-79 32.93375 35.0 34.0 36.0 27.0 38.5 80-81 32.5845 35.0 34.0 36.0 27.0 37.0 82-83 32.336375000000004 35.0 34.0 35.5 26.5 37.0 84-85 32.11475 35.0 34.0 35.0 26.0 36.5 86-87 31.816875 35.0 33.0 35.0 25.0 36.0 88-89 31.485375 35.0 33.0 35.0 24.0 36.0 90-91 31.398875 35.0 33.0 35.0 23.5 36.0 92-93 31.37675 35.0 33.0 35.0 24.0 35.0 94-95 31.214375 35.0 33.0 35.0 23.0 35.0 96-97 31.08025 35.0 33.0 35.0 21.5 35.0 98-99 30.8595 35.0 33.0 35.0 19.5 35.0 100-101 28.949624999999997 33.5 29.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 54.0 3 6.0 4 2.0 5 4.0 6 7.0 7 4.0 8 5.0 9 4.0 10 5.0 11 10.0 12 9.0 13 4.0 14 11.0 15 9.0 16 6.0 17 10.0 18 6.0 19 10.0 20 13.0 21 12.0 22 13.0 23 17.0 24 13.0 25 23.0 26 23.0 27 27.0 28 35.0 29 49.0 30 50.0 31 57.0 32 87.0 33 113.0 34 165.0 35 280.0 36 427.0 37 977.0 38 1224.0 39 229.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.825 10.0 27.825 33.35 2 25.8 10.05 24.9 39.25 3 22.275 12.675 30.025000000000002 35.025 4 23.275000000000002 12.975 26.974999999999998 36.775000000000006 5 25.087543771885944 13.606803401700851 25.212606303151574 36.09304652326163 6 25.650000000000002 18.975 29.775000000000002 25.6 7 19.575 23.625 39.525 17.275 8 17.454363590897724 26.85671417854464 35.708927231807955 19.979994998749685 9 17.724999999999998 29.375 33.45 19.45 10-11 19.55 26.5625 33.037499999999994 20.849999999999998 12-13 19.62745343167896 27.240905113139142 31.84148018502313 21.29016127015877 14-15 20.474999999999998 26.174999999999997 30.562499999999996 22.787499999999998 16-17 21.175 25.2 29.7 23.925 18-19 19.954988747186796 27.144286071517882 29.719929982495625 23.1807951987997 20-21 20.927615951994 26.20327540942618 29.47868483560445 23.39042380297537 22-23 21.952744093011624 24.640580072509064 28.853606700837602 24.553069133641706 24-25 20.150000000000002 26.4125 29.612500000000004 23.825 26-27 20.2875 26.2625 28.075 25.374999999999996 28-29 20.7125 26.025 27.1375 26.125 30-31 20.0875 26.400000000000002 29.25 24.2625 32-33 22.3875 25.662499999999998 27.400000000000002 24.55 34-35 20.9 25.0 27.4125 26.687499999999996 36-37 21.0375 25.624999999999996 28.9 24.4375 38-39 21.212500000000002 26.487500000000004 26.8625 25.4375 40-41 22.3375 24.4 27.725 25.5375 42-43 21.7 26.075 28.175 24.05 44-45 21.502687835979497 26.690836354544317 26.978372296537067 24.82810351293912 46-47 22.6375 25.6 26.4625 25.3 48-49 21.7375 27.212500000000002 27.675 23.375 50-51 22.537499999999998 26.650000000000002 25.825 24.9875 52-53 22.15 24.9875 27.275 25.587500000000002 54-55 21.6125 26.6125 28.025 23.75 56-57 22.1 24.425 27.375 26.1 58-59 21.6625 25.5375 27.5875 25.2125 60-61 21.475 26.35 28.225 23.95 62-63 23.2125 26.187500000000004 25.9875 24.6125 64-65 22.7125 25.162499999999998 26.387500000000003 25.7375 66-67 21.375 27.0 27.3125 24.3125 68-69 22.237499999999997 25.5 26.674999999999997 25.587500000000002 70-71 21.375 26.4625 26.525 25.637500000000003 72-73 21.915239404925615 26.128266033254157 27.090886360795096 24.86560820102513 74-75 21.837500000000002 25.575 27.0625 25.525 76-77 22.525000000000002 24.762500000000003 26.437500000000004 26.275 78-79 22.2125 26.0 27.175 24.6125 80-81 22.787499999999998 25.95 26.887499999999996 24.375 82-83 23.1125 25.0 25.75 26.137500000000003 84-85 22.5125 25.825 26.8 24.8625 86-87 23.3625 25.8 25.874999999999996 24.962500000000002 88-89 22.975 25.337500000000002 27.037499999999998 24.65 90-91 23.724999999999998 26.35 26.2625 23.6625 92-93 23.3125 25.3125 26.0125 25.362499999999997 94-95 23.3625 24.5625 26.6 25.474999999999998 96-97 23.200000000000003 26.5875 27.0125 23.200000000000003 98-99 24.099999999999998 25.7125 25.412499999999998 24.775 100-101 24.575 25.374999999999996 25.3125 24.7375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 23.0 1 16.5 2 8.5 3 5.5 4 3.5 5 3.0 6 2.0 7 1.5 8 1.0 9 0.0 10 0.5 11 0.5 12 1.5 13 3.5 14 3.5 15 2.5 16 3.0 17 4.0 18 2.5 19 1.5 20 1.5 21 2.0 22 4.0 23 5.5 24 5.5 25 8.0 26 6.5 27 6.0 28 10.0 29 11.5 30 13.5 31 15.5 32 15.0 33 19.0 34 37.5 35 51.0 36 60.0 37 83.5 38 95.0 39 109.0 40 141.0 41 173.0 42 202.0 43 213.0 44 208.5 45 208.5 46 199.0 47 175.5 48 165.5 49 162.0 50 159.0 51 157.0 52 137.0 53 104.5 54 88.0 55 85.5 56 85.5 57 79.5 58 69.0 59 58.5 60 60.0 61 58.5 62 51.0 63 47.0 64 31.0 65 23.5 66 25.5 67 27.0 68 22.0 69 19.0 70 18.0 71 12.0 72 15.5 73 16.5 74 11.5 75 8.0 76 7.0 77 9.5 78 9.5 79 5.5 80 3.5 81 2.5 82 1.0 83 1.5 84 2.0 85 2.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.025 9 0.0 10-11 0.0 12-13 0.0125 14-15 0.0 16-17 0.0 18-19 0.025 20-21 0.0125 22-23 0.0125 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0125 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0125 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.9252814738997 96.65 2 0.8188331627430911 1.6 3 0.1023541453428864 0.3 4 0.0511770726714432 0.2 5 0.0255885363357216 0.125 6 0.0 0.0 7 0.0255885363357216 0.17500000000000002 8 0.0255885363357216 0.2 9 0.0 0.0 >10 0.0255885363357216 0.75 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 30 0.75 No Hit TCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 8 0.2 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 7 0.17500000000000002 No Hit CCACCGAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.037500000000000006 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.1125 0.0 0.0 0.0 0.0 36-37 0.175 0.0 0.0 0.0 0.0 38-39 0.225 0.0 0.0 0.0 0.0 40-41 0.2875 0.0 0.0 0.0 0.0 42-43 0.3625 0.0 0.0 0.0 0.0 44-45 0.475 0.0 0.0 0.0 0.0 46-47 0.5 0.0 0.0 0.0 0.0 48-49 0.5625 0.0 0.0 0.0 0.0 50-51 0.675 0.0 0.0 0.0 0.0 52-53 0.7124999999999999 0.0 0.0 0.0 0.0 54-55 0.775 0.0 0.0 0.0 0.0 56-57 0.975 0.0 0.0 0.0 0.0 58-59 1.1125 0.0 0.0 0.0 0.0 60-61 1.25 0.0 0.0 0.0 0.0 62-63 1.4375 0.0 0.0 0.0 0.0 64-65 1.625 0.0 0.0 0.0 0.0 66-67 1.8375 0.0 0.0 0.0 0.0 68-69 2.15 0.0 0.0 0.0 0.0 70-71 2.4 0.0 0.0 0.0 0.0 72-73 2.6625 0.0 0.0 0.0 0.0 74-75 2.925 0.0 0.0 0.0 0.0 76-77 3.325 0.0 0.0 0.0 0.0 78-79 3.7625 0.0 0.0 0.0 0.0 80-81 4.050000000000001 0.0 0.0 0.0 0.0 82-83 4.4625 0.0 0.0 0.0 0.0 84-85 4.8125 0.0 0.0 0.0 0.0 86-87 5.375 0.0 0.0 0.0 0.0 88-89 5.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATTTAG 15 6.142176E-4 95.0 7 ATTTAGT 15 6.142176E-4 95.0 8 TTTAGTT 20 0.0019257745 71.25 9 CGCGAAC 15 0.009957196 47.5 44-45 ACCGGCG 15 0.009957196 47.5 38-39 CGCCTTC 15 0.009957196 47.5 62-63 TCGATAG 15 0.009957196 47.5 26-27 AGGACTC 15 0.009957196 47.5 94-95 AATTTGA 15 0.009957196 47.5 54-55 GGCGCGA 15 0.009957196 47.5 42-43 GTTCCTC 15 0.009957196 47.5 80-81 ATCTATT 15 0.009957196 47.5 18-19 TTATCTA 15 0.009957196 47.5 16-17 CACAAGC 15 0.009957196 47.5 76-77 TGATCGC 15 0.009957196 47.5 58-59 GTATCTA 15 0.009957196 47.5 32-33 GCGAACT 15 0.009957196 47.5 44-45 GATCGCC 15 0.009957196 47.5 58-59 GCGCGAA 15 0.009957196 47.5 42-43 GTTTTAT 15 0.009957196 47.5 12-13 >>END_MODULE Read 1926088 spots for ERR3317457.sra Written 1926088 spots for ERR3317457.sra Read 1926088 spots for ERR3317457.sra Written 1926088 spots for ERR3317457.sra Read 1926088 spots for ERR3317457.sra Written 1926088 spots for ERR3317457.sra Read 1926088 spots for ERR3317457.sra Written 1926088 spots for ERR3317457.sra Read 1926088 spots for ERR3317457.sra Written 1926088 spots for ERR3317457.sra Read 1926088 spots for ERR3317457.sra Written 1926088 spots for ERR3317457.sra Read 1926088 spots for ERR3317457.sra Written 1926088 spots for ERR3317457.sra Read 1926088 spots for ERR3317457.sra Written 1926088 spots for ERR3317457.sra Read 1926088 spots for ERR3317457.sra Written 1926088 spots for ERR3317457.sra Read 1926088 spots for ERR3317457.sra Written 1926088 spots for ERR3317457.sra Read 1926088 spots for ERR3317457.sra Written 1926088 spots for ERR3317457.sra Read 1926088 spots for ERR3317457.sra Written 1926088 spots for ERR3317457.sra Read 1926088 spots for ERR3317457.sra Written 1926088 spots for ERR3317457.sra Read 1926088 spots for ERR3317457.sra Written 1926088 spots for ERR3317457.sra Read 1926088 spots for ERR3317457.sra Written 1926088 spots for ERR3317457.sra Read 1926088 spots for ERR3317457.sra Written 1926088 spots for ERR3317457.sra Read 1926088 spots for ERR3317457.sra Written 1926088 spots for ERR3317457.sra Read 1926088 spots for ERR3317457.sra Written 1926088 spots for ERR3317457.sra Read 1926103 spots for ERR3317457.sra Written 1926103 spots for ERR3317457.sra Read 1926088 spots for ERR3317457.sra Written 1926088 spots for ERR3317457.sra SRR ids: ['ERR3317457.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_asznnnt5 ERR3317457.sra spots: 38521775 blocks: [[1, 1926088], [1926089, 3852176], [3852177, 5778264], [5778265, 7704352], [7704353, 9630440], [9630441, 11556528], [11556529, 13482616], [13482617, 15408704], [15408705, 17334792], [17334793, 19260880], [19260881, 21186968], [21186969, 23113056], [23113057, 25039144], [25039145, 26965232], [26965233, 28891320], [28891321, 30817408], [30817409, 32743496], [32743497, 34669584], [34669585, 36595672], [36595673, 38521775]] ERR3317457 file size 9270173 ERR3317457 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317457 ERR3317457_1.fastq ERR3317457_2.fastq Input file: ERR3317457_1.fastq Paired file: ERR3317457_2.fastq trimmed: ERR3317457-trimmed-pair1.fastq, ERR3317457-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 10:00:36 2024 >> started Tue Dec 10 10:01:13 2024 >> done (36.340s) 38521775 read pairs processed; of these: 283285 ( 0.74%) short read pairs filtered out after trimming by size control 741730 ( 1.93%) empty read pairs filtered out after trimming by size control 37496760 (97.34%) read pairs available; of these: 11397961 (30.40%) trimmed read pairs available after processing 26098799 (69.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 626 0.00% 19 684 0.00% 20 949 0.00% 21 1153 0.00% 22 1549 0.00% 23 2179 0.01% 24 2584 0.01% 25 3222 0.01% 26 3755 0.01% 27 4356 0.01% 28 4711 0.01% 29 5971 0.02% 30 6658 0.02% 31 9076 0.02% 32 8217 0.02% 33 9015 0.02% 34 10933 0.03% 35 10999 0.03% 36 12495 0.03% 37 13225 0.04% 38 15646 0.04% 39 16184 0.04% 40 16853 0.04% 41 18424 0.05% 42 19501 0.05% 43 20694 0.06% 44 22279 0.06% 45 22640 0.06% 46 24696 0.07% 47 28076 0.07% 48 29016 0.08% 49 30859 0.08% 50 34166 0.09% 51 34771 0.09% 52 36142 0.10% 53 39529 0.11% 54 42659 0.11% 55 48301 0.13% 56 47336 0.13% 57 50284 0.13% 58 54791 0.15% 59 71844 0.19% 60 83383 0.22% 61 90065 0.24% 62 95798 0.26% 63 101293 0.27% 64 106984 0.29% 65 112856 0.30% 66 124803 0.33% 67 125031 0.33% 68 125787 0.34% 69 130532 0.35% 70 133901 0.36% 71 139610 0.37% 72 144525 0.39% 73 154551 0.41% 74 152823 0.41% 75 153776 0.41% 76 152270 0.41% 77 160896 0.43% 78 173280 0.46% 79 171689 0.46% 80 175335 0.47% 81 181655 0.48% 82 182160 0.49% 83 190190 0.51% 84 198602 0.53% 85 211882 0.57% 86 220220 0.59% 87 226565 0.60% 88 227410 0.61% 89 249251 0.66% 90 245613 0.66% 91 252514 0.67% 92 265260 0.71% 93 282926 0.75% 94 307160 0.82% 95 337176 0.90% 96 379041 1.01% 97 447377 1.19% 98 570242 1.52% 99 791086 2.11% 100 1985395 5.29% 101 26098799 69.60% 37496760 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=30 prefix-density=0.41 prefix-fanout=2.0 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCC criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=73.17 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=11.1 sequence=GCCGCCGCCGCCA criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=33 prefix-density=0.38 prefix-fanout=2.1 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=83.88 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=2.1 sequence=TTATAAGAAAGAAAGTGATTTTCTCAACTCTTTCAAACTTTTAGGAATTCACATATGCAAGCTAGCTCCTCGATCGAGAGCCAGGTTGCTACACACAACAACAATCTTGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTGAGCTGACACTTTATATATGGTCCATCTTAATACGGAGCTGTCCTTGGTTGTTTATGCCTTGCCGGATTCCTCGCAGCCCGGTGGCTT ERR3317457 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 10:01:54 Started mapping on | Dec 10 10:01:54 Finished on | Dec 10 10:03:49 Mapping speed, Million of reads per hour | 1173.81 Number of input reads | 37496760 Average input read length | 192 UNIQUE READS: Uniquely mapped reads number | 33977538 Uniquely mapped reads % | 90.61% Average mapped length | 191.16 Number of splices: Total | 21182277 Number of splices: Annotated (sjdb) | 20131734 Number of splices: GT/AG | 20871770 Number of splices: GC/AG | 276864 Number of splices: AT/AC | 15316 Number of splices: Non-canonical | 18327 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.00% Deletion average length | 1.22 Insertion rate per base | 0.00% Insertion average length | 1.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2519597 % of reads mapped to multiple loci | 6.72% Number of reads mapped to too many loci | 38668 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.93% % of reads unmapped: other | 0.63% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1216516 1216516 1216516 N_multimapping 2519597 2519597 2519597 N_noFeature 1208763 2714741 31734827 N_ambiguous 1007552 291778 15893 UnstrandedReadsAssigned:31761223 PositiveStrandReadsAssigned:30971019 NegativeStrandReadsAssigned:2226818 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=99 echo kmer=95 ERR3317457 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317457-trimmed-pair1.fastq ERR3317457-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,496,760 reads, 32,909,973 reads pseudoaligned [quant] estimated average fragment length: 195.457 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52973 ERR3317457.ke.tsv 35125 ERR3317457.se.tsv 88098 total ==> ERR3317457.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 741.755 0 0 PNS24247 1044 849.543 67.7189 3.63079 PNS24249 1928 1733.54 169.831 4.46231 PNS24246 1044 849.543 67.7189 3.63079 PNS24248 1044 849.543 67.7189 3.63079 PNS24244 1471 1276.54 287.012 10.241 PNS24243 293 130.939 1 0.347864 KQK14069 1603 1408.54 6521.26 210.882 KQK14071 474 288.87 39.3167 6.19942 ==> ERR3317457.se.tsv <== BRADI_1g14170v3 7618 BRADI_1g53295v3 193 BRADI_1g59795v3 822 BRADI_1g07683v3 0 BRADI_1g00485v3 68 BRADI_1g20270v3 1185 BRADI_1g74790v3 574 BRADI_1g09890v3 8 BRADI_1g77505v3 433 BRADI_1g48960v3 1 ERR3317457 completed mapping pipeline successfully