Starting /dee2/code/volunteer_pipeline.sh ERR3317458 current disk space = 1524844568576 free memory = 1595622924 ERR3317458 SRAfilesize 598daf7045624095d044c5d52ef0f5fa ERR3317458.sra ERR3317458.sra file validated ERR3317458 is paired end ERR3317458 is conventional basespace ERR3317458 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317458_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.49025 34.0 31.0 34.0 30.0 34.0 2 32.2285 34.0 31.0 34.0 30.0 34.0 3 32.727 34.0 31.0 34.0 30.0 34.0 4 36.28075 37.0 37.0 37.0 35.0 37.0 5 36.31725 37.0 37.0 37.0 35.0 37.0 6 36.351 37.0 37.0 37.0 35.0 37.0 7 36.31675 37.0 37.0 37.0 35.0 37.0 8 36.2765 37.0 37.0 37.0 35.0 37.0 9 38.049 39.0 39.0 39.0 35.0 39.0 10-11 38.025125 39.0 38.5 39.0 35.0 39.0 12-13 38.018874999999994 39.0 39.0 39.0 36.0 39.0 14-15 39.5475 41.0 40.0 41.0 37.0 41.0 16-17 39.51575 41.0 40.0 41.0 36.5 41.0 18-19 39.476124999999996 41.0 40.0 41.0 36.0 41.0 20-21 39.306250000000006 41.0 39.0 41.0 36.0 41.0 22-23 39.179875 41.0 39.0 41.0 36.0 41.0 24-25 39.102000000000004 41.0 39.0 41.0 36.0 41.0 26-27 39.018249999999995 40.5 39.0 41.0 35.5 41.0 28-29 38.619125 40.0 38.0 41.0 34.5 41.0 30-31 38.510875 40.0 38.0 41.0 34.5 41.0 32-33 38.43875 40.0 38.0 41.0 34.0 41.0 34-35 38.20675 40.0 38.0 41.0 33.5 41.0 36-37 38.077625 40.0 38.0 41.0 33.0 41.0 38-39 37.922 40.0 37.5 41.0 33.0 41.0 40-41 37.628249999999994 40.0 37.0 41.0 32.5 41.0 42-43 37.658375 40.0 37.0 41.0 32.5 41.0 44-45 37.34025 40.0 36.5 41.0 31.5 41.0 46-47 37.127250000000004 40.0 36.0 41.0 31.0 41.0 48-49 36.885125 39.5 35.5 41.0 31.0 41.0 50-51 37.177625 40.0 36.0 41.0 32.5 41.0 52-53 37.092875 39.5 35.5 41.0 31.5 41.0 54-55 36.8545 39.0 35.0 41.0 31.5 41.0 56-57 36.366875 39.0 35.0 41.0 31.0 41.0 58-59 35.970375000000004 38.0 35.0 41.0 30.0 41.0 60-61 35.662000000000006 37.5 35.0 40.0 29.5 41.0 62-63 35.36625 37.0 35.0 40.0 29.0 41.0 64-65 34.994625 36.5 34.5 39.5 29.0 41.0 66-67 34.650375 36.0 34.0 39.0 29.0 41.0 68-69 34.263374999999996 35.5 34.0 39.0 29.0 40.5 70-71 33.725375 35.0 34.0 37.5 27.5 40.0 72-73 33.29075 35.0 34.0 37.0 26.0 39.0 74-75 32.91875 35.0 33.0 36.5 26.0 39.0 76-77 31.68975 34.5 31.5 35.0 25.0 37.0 78-79 32.094875 35.0 33.0 36.0 25.5 37.0 80-81 32.008375 35.0 33.0 35.0 25.0 37.0 82-83 31.639125 35.0 33.0 35.0 24.0 36.0 84-85 31.503375 35.0 33.0 35.0 24.0 36.0 86-87 31.127125 35.0 32.0 35.0 23.5 36.0 88-89 30.95975 35.0 32.0 35.0 23.0 35.0 90-91 30.645625 35.0 31.5 35.0 19.5 35.0 92-93 30.31625 34.5 31.0 35.0 17.0 35.0 94-95 30.051125 34.0 31.0 35.0 8.5 35.0 96-97 29.80025 34.0 31.0 35.0 2.0 35.0 98-99 29.394375 34.0 31.0 35.0 2.0 35.0 100-101 27.155375 32.5 26.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 2.0 9 4.0 10 6.0 11 8.0 12 9.0 13 8.0 14 8.0 15 14.0 16 15.0 17 14.0 18 17.0 19 20.0 20 13.0 21 19.0 22 10.0 23 24.0 24 16.0 25 32.0 26 31.0 27 32.0 28 39.0 29 67.0 30 74.0 31 81.0 32 109.0 33 144.0 34 210.0 35 308.0 36 585.0 37 1015.0 38 962.0 39 101.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 26.793634229063397 25.82833289851291 19.071223584659535 28.30680928776415 2 25.7 25.85 18.375 30.075000000000003 3 25.35 27.325 18.6 28.725 4 27.075 25.424999999999997 17.7 29.799999999999997 5 28.257064266066518 26.406601650412604 15.478869717429358 29.857464366091524 6 28.725 27.275 18.825 25.174999999999997 7 29.925 23.974999999999998 21.825 24.275 8 30.925000000000004 26.224999999999998 23.95 18.9 9 31.775 27.425 24.15 16.650000000000002 10-11 32.45 26.637499999999996 22.425 18.4875 12-13 30.012499999999996 25.724999999999998 24.087500000000002 20.175 14-15 27.700000000000003 26.075 24.087500000000002 22.1375 16-17 27.0875 25.2875 25.137500000000003 22.4875 18-19 26.5875 26.35 25.5625 21.5 20-21 25.874999999999996 26.474999999999998 25.424999999999997 22.225 22-23 26.5 26.200000000000003 24.075 23.225 24-25 25.324999999999996 25.674999999999997 25.424999999999997 23.575 26-27 25.324999999999996 26.6 24.5625 23.5125 28-29 26.137500000000003 26.424999999999997 24.4375 23.0 30-31 25.5375 26.2125 25.7 22.55 32-33 25.362499999999997 26.687499999999996 25.5375 22.412499999999998 34-35 26.087500000000002 25.95 25.5625 22.400000000000002 36-37 25.6 26.400000000000002 24.962500000000002 23.0375 38-39 25.874999999999996 26.474999999999998 25.4 22.25 40-41 26.1625 26.487500000000004 24.1875 23.1625 42-43 25.95 25.924999999999997 25.124999999999996 23.0 44-45 25.474999999999998 25.775 26.1625 22.5875 46-47 26.825 25.087500000000002 24.2625 23.825 48-49 26.200000000000003 26.1625 24.5375 23.1 50-51 25.5125 26.200000000000003 25.4875 22.8 52-53 26.237500000000004 25.2875 24.5125 23.962500000000002 54-55 25.937500000000004 26.150000000000002 24.762500000000003 23.150000000000002 56-57 25.775 26.924999999999997 24.525 22.775000000000002 58-59 25.362499999999997 26.950000000000003 24.1875 23.5 60-61 25.137500000000003 26.5375 25.874999999999996 22.45 62-63 24.325 26.987499999999997 25.224999999999998 23.4625 64-65 25.4375 26.0 25.0375 23.525 66-67 26.174999999999997 26.200000000000003 24.525 23.1 68-69 26.3625 26.325 24.1875 23.125 70-71 26.0 26.25 24.275 23.474999999999998 72-73 25.674999999999997 26.5875 24.962500000000002 22.775000000000002 74-75 25.074999999999996 26.924999999999997 23.8625 24.1375 76-77 25.55 26.6 24.837500000000002 23.0125 78-79 25.9875 26.387500000000003 25.2875 22.3375 80-81 26.137500000000003 27.224999999999998 24.212500000000002 22.425 82-83 25.775 26.3125 24.762500000000003 23.150000000000002 84-85 25.05 26.150000000000002 25.775 23.025000000000002 86-87 25.9875 27.05 24.224999999999998 22.7375 88-89 25.5625 26.474999999999998 24.5375 23.425 90-91 26.387500000000003 26.6625 24.775 22.175 92-93 25.525 26.8625 24.337500000000002 23.275000000000002 94-95 25.874999999999996 26.8125 23.425 23.8875 96-97 25.15 27.3125 25.05 22.4875 98-99 25.6 27.1125 23.7625 23.525 100-101 25.650000000000002 26.974999999999998 23.5125 23.8625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 1.0 7 1.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 1.0 14 1.5 15 0.5 16 1.0 17 2.0 18 1.0 19 1.5 20 3.0 21 3.0 22 2.0 23 1.5 24 1.5 25 2.0 26 1.5 27 1.5 28 6.0 29 5.5 30 6.0 31 10.5 32 13.0 33 19.0 34 21.5 35 28.5 36 39.0 37 51.0 38 77.5 39 99.0 40 116.0 41 146.5 42 178.0 43 187.5 44 190.5 45 211.0 46 220.5 47 205.0 48 200.0 49 192.0 50 171.5 51 151.0 52 136.0 53 137.5 54 124.5 55 102.0 56 84.0 57 73.5 58 77.0 59 69.5 60 53.5 61 55.5 62 53.0 63 44.5 64 45.5 65 47.0 66 45.5 67 33.0 68 22.5 69 26.5 70 30.0 71 28.0 72 23.5 73 22.0 74 19.0 75 11.5 76 8.5 77 6.5 78 5.5 79 5.5 80 5.5 81 4.0 82 3.5 83 3.0 84 1.5 85 2.0 86 3.5 87 4.0 88 2.5 89 0.5 90 1.0 91 1.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.175 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.175 #Duplication Level Percentage of deduplicated Percentage of total 1 98.67583396995163 96.875 2 0.9931245225362872 1.95 3 0.17825311942959002 0.525 4 0.12732365673542145 0.5 5 0.0 0.0 6 0.025464731347084286 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAAAAGAGGAAAGGCTTGCGGTGGATACCTAGGCACCCAGAGACGAGGAA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.037500000000000006 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.0625 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.175 0.0 0.0 0.0 0.0 32-33 0.25 0.0 0.0 0.0 0.0 34-35 0.35 0.0 0.0 0.0 0.0 36-37 0.4125 0.0 0.0 0.0 0.0 38-39 0.5 0.0 0.0 0.0 0.0 40-41 0.575 0.0 0.0 0.0 0.0 42-43 0.6875 0.0 0.0 0.0 0.0 44-45 0.7124999999999999 0.0 0.0 0.0 0.0 46-47 0.7375 0.0 0.0 0.0 0.0 48-49 0.8374999999999999 0.0 0.0 0.0 0.0 50-51 0.9125000000000001 0.0 0.0 0.0 0.0 52-53 0.975 0.0 0.0 0.0 0.0 54-55 1.0375 0.0 0.0 0.0 0.0 56-57 1.1375000000000002 0.0 0.0 0.0 0.0 58-59 1.275 0.0 0.0 0.0 0.0 60-61 1.3875 0.0 0.0 0.0 0.0 62-63 1.6 0.0 0.0 0.0 0.0 64-65 1.875 0.0 0.0 0.0 0.0 66-67 2.1500000000000004 0.0 0.0 0.0 0.0 68-69 2.325 0.0 0.0 0.0 0.0 70-71 2.5250000000000004 0.0 0.0 0.0 0.0 72-73 2.7 0.0 0.0 0.0 0.0 74-75 3.0374999999999996 0.0 0.0 0.0 0.0 76-77 3.4625 0.0 0.0 0.0 0.0 78-79 3.8 0.0 0.0 0.0 0.0 80-81 4.15 0.0 0.0 0.0 0.0 82-83 4.4875 0.0 0.0 0.0 0.0 84-85 5.025 0.0 0.0 0.0 0.0 86-87 5.525 0.0 0.0 0.0 0.0 88-89 5.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317458 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317458_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.549 33.0 31.0 34.0 29.0 34.0 2 31.38625 33.0 31.0 34.0 28.0 34.0 3 31.7795 34.0 31.0 34.0 30.0 34.0 4 35.4195 37.0 35.0 37.0 33.0 37.0 5 35.49225 37.0 35.0 37.0 35.0 37.0 6 35.6215 37.0 36.0 37.0 35.0 37.0 7 35.56125 37.0 36.0 37.0 35.0 37.0 8 35.631 37.0 37.0 37.0 35.0 37.0 9 37.3075 39.0 38.0 39.0 35.0 39.0 10-11 37.404875000000004 39.0 38.0 39.0 35.0 39.0 12-13 37.357124999999996 39.0 38.0 39.0 35.0 39.0 14-15 38.85875 41.0 39.0 41.0 36.0 41.0 16-17 38.783500000000004 41.0 39.0 41.0 36.0 41.0 18-19 38.700125 41.0 39.0 41.0 35.0 41.0 20-21 38.571625 41.0 39.0 41.0 34.5 41.0 22-23 38.501000000000005 41.0 39.0 41.0 35.0 41.0 24-25 38.454 41.0 39.0 41.0 34.0 41.0 26-27 38.44475 41.0 39.0 41.0 34.5 41.0 28-29 38.2625 40.5 38.0 41.0 34.0 41.0 30-31 37.932375 40.0 38.0 41.0 33.0 41.0 32-33 37.9815 40.0 38.0 41.0 33.5 41.0 34-35 37.977500000000006 40.0 38.0 41.0 33.5 41.0 36-37 37.863375000000005 40.0 38.0 41.0 33.0 41.0 38-39 37.65537500000001 40.0 38.0 41.0 33.0 41.0 40-41 37.80075 40.0 38.0 41.0 33.0 41.0 42-43 37.692499999999995 40.0 38.0 41.0 33.0 41.0 44-45 37.470625 40.0 37.5 41.0 32.5 41.0 46-47 37.309375 40.0 37.0 41.0 32.0 41.0 48-49 37.10325 40.0 36.5 41.0 31.5 41.0 50-51 36.418375 39.5 35.5 40.5 31.0 41.0 52-53 36.397875 39.0 35.0 40.5 31.0 41.0 54-55 36.484750000000005 39.0 35.0 41.0 31.0 41.0 56-57 36.313500000000005 39.0 35.0 41.0 30.0 41.0 58-59 36.09625 39.0 35.0 41.0 30.5 41.0 60-61 35.83625 39.0 35.0 41.0 30.0 41.0 62-63 35.489875 38.0 35.0 40.5 29.0 41.0 64-65 35.182125 37.0 35.0 40.0 29.0 41.0 66-67 35.136875 37.0 35.0 40.0 29.0 41.0 68-69 34.956625 36.5 35.0 39.5 30.0 41.0 70-71 34.673625 36.0 35.0 39.0 30.0 41.0 72-73 34.231625 35.5 35.0 39.0 29.0 40.5 74-75 33.855125 35.0 34.0 37.5 29.0 39.5 76-77 33.454750000000004 35.0 34.0 37.0 29.0 39.0 78-79 33.105625 35.0 34.0 37.0 28.0 39.0 80-81 32.702875000000006 35.0 34.0 36.0 27.0 37.0 82-83 32.41375 35.0 34.0 36.0 26.0 37.0 84-85 32.247249999999994 35.0 33.5 35.0 26.5 37.0 86-87 32.014 35.0 33.5 35.0 26.0 36.0 88-89 31.747875 35.0 33.0 35.0 25.0 36.0 90-91 31.61125 35.0 33.0 35.0 25.0 36.0 92-93 31.469875000000002 35.0 33.0 35.0 25.0 35.0 94-95 31.234 35.0 33.0 35.0 23.5 35.0 96-97 31.068375 35.0 33.0 35.0 23.0 35.0 98-99 30.8505 35.0 33.0 35.0 19.5 35.0 100-101 28.970125000000003 33.5 29.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 47.0 3 7.0 4 4.0 5 3.0 6 4.0 7 6.0 8 5.0 9 5.0 10 10.0 11 4.0 12 11.0 13 8.0 14 10.0 15 13.0 16 7.0 17 9.0 18 11.0 19 4.0 20 13.0 21 10.0 22 12.0 23 6.0 24 14.0 25 13.0 26 35.0 27 25.0 28 42.0 29 47.0 30 44.0 31 61.0 32 74.0 33 112.0 34 169.0 35 279.0 36 462.0 37 878.0 38 1259.0 39 277.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.525000000000002 11.55 28.025 30.9 2 26.8 10.875 24.5 37.824999999999996 3 22.8 13.450000000000001 29.775000000000002 33.975 4 25.624999999999996 11.625 27.0 35.75 5 25.681420355088775 15.103775943985998 23.055763940985248 36.159039759939986 6 26.724999999999998 19.0 29.125 25.15 7 17.875 24.75 40.025 17.349999999999998 8 17.349999999999998 26.55 36.375 19.725 9 19.35 27.500000000000004 34.375 18.775 10-11 19.375 27.3875 31.95 21.2875 12-13 20.1 26.987499999999997 32.25 20.6625 14-15 20.9375 25.650000000000002 30.925000000000004 22.4875 16-17 20.849999999999998 26.424999999999997 29.037499999999998 23.6875 18-19 20.724999999999998 26.7125 29.362500000000004 23.200000000000003 20-21 21.125 26.0625 28.6875 24.125 22-23 22.3125 25.1 28.299999999999997 24.2875 24-25 20.7625 26.387500000000003 28.9 23.95 26-27 20.9 26.35 27.250000000000004 25.5 28-29 21.975 25.1875 27.650000000000002 25.1875 30-31 20.724999999999998 25.887500000000003 29.6625 23.724999999999998 32-33 21.975 26.0125 27.224999999999998 24.7875 34-35 21.725 25.25 26.7625 26.2625 36-37 21.6125 25.937500000000004 28.349999999999998 24.099999999999998 38-39 21.85 26.137500000000003 26.7125 25.3 40-41 21.6625 25.1 26.987499999999997 26.25 42-43 22.662499999999998 25.8625 26.0375 25.4375 44-45 22.05 27.0 26.35 24.6 46-47 22.037499999999998 25.5125 26.325 26.125 48-49 20.7625 27.537499999999998 26.7625 24.9375 50-51 22.287499999999998 26.700000000000003 25.674999999999997 25.337500000000002 52-53 23.150000000000002 25.124999999999996 26.375 25.35 54-55 21.275 26.0375 28.012500000000003 24.675 56-57 21.725 25.650000000000002 27.125 25.5 58-59 22.7125 25.35 26.85 25.087500000000002 60-61 20.6625 26.237500000000004 28.000000000000004 25.1 62-63 23.225 25.3 25.7 25.775 64-65 22.0 23.9875 27.224999999999998 26.787499999999998 66-67 22.225 26.337500000000002 27.725 23.7125 68-69 22.8 25.3 26.75 25.15 70-71 22.0625 26.05 26.8 25.087500000000002 72-73 21.85 25.687500000000004 27.05 25.412499999999998 74-75 22.825 25.025 27.275 24.875 76-77 23.775 24.925 25.837500000000002 25.4625 78-79 22.650000000000002 25.337500000000002 26.6625 25.35 80-81 23.0125 26.0625 25.924999999999997 25.0 82-83 23.075000000000003 25.5125 25.4 26.0125 84-85 23.599999999999998 25.5125 26.275 24.6125 86-87 24.3 25.937500000000004 25.224999999999998 24.5375 88-89 23.7625 25.0125 25.7625 25.4625 90-91 22.875 27.1375 25.4375 24.55 92-93 23.4625 25.7375 27.075 23.724999999999998 94-95 24.4375 25.687500000000004 25.112499999999997 24.762500000000003 96-97 24.375 25.7125 26.337500000000002 23.575 98-99 23.1 25.95 25.5375 25.412499999999998 100-101 23.6125 26.5625 24.8625 24.962500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 14.0 1 10.5 2 6.0 3 2.5 4 0.5 5 2.5 6 3.0 7 2.0 8 1.5 9 2.5 10 2.0 11 0.0 12 1.0 13 3.0 14 2.5 15 0.5 16 0.5 17 1.5 18 1.0 19 0.5 20 1.5 21 1.5 22 2.5 23 2.5 24 1.5 25 2.5 26 4.0 27 5.5 28 5.0 29 8.5 30 12.5 31 15.0 32 15.0 33 22.0 34 38.5 35 46.5 36 56.0 37 80.0 38 95.5 39 120.5 40 142.5 41 177.5 42 221.0 43 213.5 44 218.0 45 221.0 46 202.0 47 190.5 48 175.5 49 163.0 50 156.5 51 145.0 52 128.0 53 116.0 54 95.5 55 85.5 56 78.5 57 66.5 58 65.5 59 54.5 60 45.5 61 46.0 62 47.0 63 38.5 64 36.5 65 39.5 66 33.5 67 26.0 68 24.5 69 25.0 70 18.5 71 15.0 72 18.0 73 17.0 74 12.5 75 12.5 76 11.5 77 8.5 78 6.5 79 6.0 80 3.0 81 0.5 82 0.5 83 0.5 84 1.0 85 1.5 86 1.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.10394265232975 96.775 2 0.5376344086021506 1.05 3 0.15360983102918588 0.44999999999999996 4 0.051203277009728626 0.2 5 0.0 0.0 6 0.051203277009728626 0.3 7 0.0 0.0 8 0.025601638504864313 0.2 9 0.025601638504864313 0.22499999999999998 >10 0.051203277009728626 0.8 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 19 0.475 No Hit TCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 13 0.325 No Hit CCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGG 9 0.22499999999999998 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 8 0.2 No Hit TCTTCGTATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 6 0.15 No Hit CCACCGAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.037500000000000006 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.0625 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.175 0.0 0.0 0.0 0.0 32-33 0.25 0.0 0.0 0.0 0.0 34-35 0.3625 0.0 0.0 0.0 0.0 36-37 0.4375 0.0 0.0 0.0 0.0 38-39 0.525 0.0 0.0 0.0 0.0 40-41 0.6 0.0 0.0 0.0 0.0 42-43 0.6625000000000001 0.0 0.0 0.0 0.0 44-45 0.6875 0.0 0.0 0.0 0.0 46-47 0.7124999999999999 0.0 0.0 0.0 0.0 48-49 0.8125 0.0 0.0 0.0 0.0 50-51 0.8875 0.0 0.0 0.0 0.0 52-53 0.9375 0.0 0.0 0.0 0.0 54-55 0.9875 0.0 0.0 0.0 0.0 56-57 1.1124999999999998 0.0 0.0 0.0 0.0 58-59 1.2625 0.0 0.0 0.0 0.0 60-61 1.3875 0.0 0.0 0.0 0.0 62-63 1.5875 0.0 0.0 0.0 0.0 64-65 1.85 0.0 0.0 0.0 0.0 66-67 2.175 0.0 0.0 0.0 0.0 68-69 2.375 0.0 0.0 0.0 0.0 70-71 2.5875 0.0 0.0 0.0 0.0 72-73 2.8125 0.0 0.0 0.0 0.0 74-75 3.175 0.0 0.0 0.0 0.0 76-77 3.6375 0.0 0.0 0.0 0.0 78-79 3.9625000000000004 0.0 0.0 0.0 0.0 80-81 4.3125 0.0 0.0 0.0 0.0 82-83 4.65 0.0 0.0 0.0 0.0 84-85 5.175 0.0 0.0 0.0 0.0 86-87 5.7125 0.0 0.0 0.0 0.0 88-89 6.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2065959 spots for ERR3317458.sra Written 2065959 spots for ERR3317458.sra Read 2065959 spots for ERR3317458.sra Written 2065959 spots for ERR3317458.sra Read 2065959 spots for ERR3317458.sra Written 2065959 spots for ERR3317458.sra Read 2065959 spots for ERR3317458.sra Written 2065959 spots for ERR3317458.sra Read 2065959 spots for ERR3317458.sra Written 2065959 spots for ERR3317458.sra Read 2065959 spots for ERR3317458.sra Written 2065959 spots for ERR3317458.sra Read 2065959 spots for ERR3317458.sra Written 2065959 spots for ERR3317458.sra Read 2065959 spots for ERR3317458.sra Written 2065959 spots for ERR3317458.sra Read 2065959 spots for ERR3317458.sra Written 2065959 spots for ERR3317458.sra Read 2065959 spots for ERR3317458.sra Written 2065959 spots for ERR3317458.sra Read 2065959 spots for ERR3317458.sra Written 2065959 spots for ERR3317458.sra Read 2065959 spots for ERR3317458.sra Written 2065959 spots for ERR3317458.sra Read 2065959 spots for ERR3317458.sra Written 2065959 spots for ERR3317458.sra Read 2065959 spots for ERR3317458.sra Written 2065959 spots for ERR3317458.sra Read 2065959 spots for ERR3317458.sra Written 2065959 spots for ERR3317458.sra Read 2065976 spots for ERR3317458.sra Written 2065976 spots for ERR3317458.sra Read 2065959 spots for ERR3317458.sra Written 2065959 spots for ERR3317458.sra Read 2065959 spots for ERR3317458.sra Written 2065959 spots for ERR3317458.sra Read 2065959 spots for ERR3317458.sra Written 2065959 spots for ERR3317458.sra Read 2065959 spots for ERR3317458.sra Written 2065959 spots for ERR3317458.sra SRR ids: ['ERR3317458.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iocyr7cf ERR3317458.sra spots: 41319197 blocks: [[1, 2065959], [2065960, 4131918], [4131919, 6197877], [6197878, 8263836], [8263837, 10329795], [10329796, 12395754], [12395755, 14461713], [14461714, 16527672], [16527673, 18593631], [18593632, 20659590], [20659591, 22725549], [22725550, 24791508], [24791509, 26857467], [26857468, 28923426], [28923427, 30989385], [30989386, 33055344], [33055345, 35121303], [35121304, 37187262], [37187263, 39253221], [39253222, 41319197]] ERR3317458 file size 9944941 ERR3317458 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317458 ERR3317458_1.fastq ERR3317458_2.fastq Input file: ERR3317458_1.fastq Paired file: ERR3317458_2.fastq trimmed: ERR3317458-trimmed-pair1.fastq, ERR3317458-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 10:01:12 2024 >> started Tue Dec 10 10:02:02 2024 >> done (49.625s) 41319197 read pairs processed; of these: 301397 ( 0.73%) short read pairs filtered out after trimming by size control 706014 ( 1.71%) empty read pairs filtered out after trimming by size control 40311786 (97.56%) read pairs available; of these: 11995005 (29.76%) trimmed read pairs available after processing 28316781 (70.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 784 0.00% 19 1002 0.00% 20 1462 0.00% 21 1831 0.00% 22 2163 0.01% 23 3047 0.01% 24 3626 0.01% 25 4446 0.01% 26 5163 0.01% 27 6073 0.02% 28 6460 0.02% 29 8260 0.02% 30 9767 0.02% 31 13044 0.03% 32 11512 0.03% 33 12084 0.03% 34 14721 0.04% 35 14822 0.04% 36 16792 0.04% 37 17771 0.04% 38 20780 0.05% 39 22184 0.06% 40 21682 0.05% 41 23377 0.06% 42 24301 0.06% 43 26018 0.06% 44 27305 0.07% 45 27908 0.07% 46 30159 0.07% 47 33994 0.08% 48 35130 0.09% 49 36414 0.09% 50 40801 0.10% 51 40492 0.10% 52 42331 0.11% 53 45916 0.11% 54 49380 0.12% 55 55877 0.14% 56 54080 0.13% 57 57376 0.14% 58 62561 0.16% 59 77921 0.19% 60 88069 0.22% 61 97857 0.24% 62 100578 0.25% 63 105977 0.26% 64 113505 0.28% 65 117077 0.29% 66 130851 0.32% 67 131349 0.33% 68 131537 0.33% 69 135197 0.34% 70 138545 0.34% 71 143292 0.36% 72 148333 0.37% 73 158437 0.39% 74 158533 0.39% 75 158281 0.39% 76 156659 0.39% 77 163282 0.41% 78 177716 0.44% 79 177690 0.44% 80 181049 0.45% 81 184119 0.46% 82 187732 0.47% 83 196165 0.49% 84 205376 0.51% 85 218082 0.54% 86 226223 0.56% 87 233464 0.58% 88 233829 0.58% 89 254301 0.63% 90 253023 0.63% 91 260641 0.65% 92 274836 0.68% 93 290340 0.72% 94 317289 0.79% 95 348834 0.87% 96 395639 0.98% 97 468019 1.16% 98 593369 1.47% 99 828922 2.06% 100 2100171 5.21% 101 28316781 70.24% 40311786 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.48 fanout-score-rank=20 prefix-density=0.55 prefix-fanout=3.0 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=280.17 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=27.6 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=1.81 fanout-score-rank=36 prefix-density=0.44 prefix-fanout=1.0 sequence=ATGCACTGCACTTGCCTGGTGTTGTCGA criterion=fanout-score sequence-density=0.12 sequence-density-rank=6 fanout-score=80.41 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=16.8 sequence=CCTTCTTCTCCTCCTTGGTGGCCTTGGAGGAGATGACGGTCTT ERR3317458 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 10:02:54 Started mapping on | Dec 10 10:02:54 Finished on | Dec 10 10:04:43 Mapping speed, Million of reads per hour | 1331.40 Number of input reads | 40311786 Average input read length | 192 UNIQUE READS: Uniquely mapped reads number | 37040142 Uniquely mapped reads % | 91.88% Average mapped length | 191.23 Number of splices: Total | 23352794 Number of splices: Annotated (sjdb) | 22190793 Number of splices: GT/AG | 23010723 Number of splices: GC/AG | 304373 Number of splices: AT/AC | 20239 Number of splices: Non-canonical | 17459 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.00% Deletion average length | 1.21 Insertion rate per base | 0.00% Insertion average length | 1.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2405133 % of reads mapped to multiple loci | 5.97% Number of reads mapped to too many loci | 43016 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.39% % of reads unmapped: other | 0.66% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1038185 1038185 1038185 N_multimapping 2405133 2405133 2405133 N_noFeature 1342889 2725069 34914804 N_ambiguous 1002019 280140 13442 UnstrandedReadsAssigned:34695234 PositiveStrandReadsAssigned:34034933 NegativeStrandReadsAssigned:2111896 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=99 echo kmer=95 ERR3317458 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317458-trimmed-pair1.fastq ERR3317458-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,311,786 reads, 35,826,073 reads pseudoaligned [quant] estimated average fragment length: 191.076 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52973 ERR3317458.ke.tsv 35125 ERR3317458.se.tsv 88098 total ==> ERR3317458.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 746.124 0 0 PNS24247 1044 853.924 71.0214 3.53195 PNS24249 1928 1737.92 205.507 5.0216 PNS24246 1044 853.924 71.0214 3.53195 PNS24248 1044 853.924 71.0214 3.53195 PNS24244 1471 1280.92 245.428 8.13667 PNS24243 293 131.416 2 0.646289 KQK14069 1603 1412.92 7124.49 214.131 KQK14071 474 291.758 27.8666 4.05608 ==> ERR3317458.se.tsv <== BRADI_1g14170v3 8445 BRADI_1g53295v3 213 BRADI_1g59795v3 850 BRADI_1g07683v3 0 BRADI_1g00485v3 84 BRADI_1g20270v3 1380 BRADI_1g74790v3 633 BRADI_1g09890v3 20 BRADI_1g77505v3 419 BRADI_1g48960v3 1 ERR3317458 completed mapping pipeline successfully