Starting /dee2/code/volunteer_pipeline.sh ERR3317459 current disk space = 1524895100928 free memory = 1518366020 ERR3317459 SRAfilesize b8f839f8f11d2480e9f53b08aea57b3c ERR3317459.sra ERR3317459.sra file validated ERR3317459 is paired end ERR3317459 is conventional basespace ERR3317459 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317459_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.55175 34.0 31.0 34.0 30.0 34.0 2 32.27075 34.0 31.0 34.0 30.0 34.0 3 32.76575 34.0 31.0 34.0 31.0 34.0 4 36.2655 37.0 37.0 37.0 35.0 37.0 5 36.2495 37.0 37.0 37.0 35.0 37.0 6 36.33725 37.0 37.0 37.0 35.0 37.0 7 36.32075 37.0 37.0 37.0 35.0 37.0 8 36.30675 37.0 37.0 37.0 35.0 37.0 9 38.06725 39.0 39.0 39.0 37.0 39.0 10-11 38.019625 39.0 39.0 39.0 35.0 39.0 12-13 38.01475000000001 39.0 38.0 39.0 35.0 39.0 14-15 39.563500000000005 41.0 40.0 41.0 37.0 41.0 16-17 39.511624999999995 41.0 40.0 41.0 37.0 41.0 18-19 39.460875 41.0 39.0 41.0 36.0 41.0 20-21 39.336 41.0 39.0 41.0 36.0 41.0 22-23 39.19775 41.0 39.0 41.0 36.0 41.0 24-25 39.168125 41.0 39.0 41.0 35.5 41.0 26-27 39.079625 40.5 39.0 41.0 36.0 41.0 28-29 38.71775 40.0 38.0 41.0 35.0 41.0 30-31 38.558875 40.0 38.0 41.0 34.0 41.0 32-33 38.48725 40.0 38.0 41.0 34.0 41.0 34-35 38.381875 40.0 38.0 41.0 33.5 41.0 36-37 38.197125 40.0 38.0 41.0 33.0 41.0 38-39 37.921125 40.0 38.0 41.0 33.0 41.0 40-41 37.747 40.0 37.0 41.0 32.5 41.0 42-43 37.811 40.0 37.0 41.0 33.0 41.0 44-45 37.47625 40.0 36.5 41.0 32.0 41.0 46-47 37.271874999999994 40.0 36.0 41.0 32.0 41.0 48-49 37.081125 39.5 36.0 41.0 31.0 41.0 50-51 37.336875000000006 40.0 36.0 41.0 32.5 41.0 52-53 37.224125 40.0 36.0 41.0 32.0 41.0 54-55 37.017375 39.0 35.0 41.0 32.0 41.0 56-57 36.647000000000006 39.0 35.0 41.0 31.5 41.0 58-59 36.28675 38.5 35.0 41.0 30.5 41.0 60-61 35.913 37.5 35.0 40.5 30.0 41.0 62-63 35.598625 37.0 35.0 40.0 30.0 41.0 64-65 35.26475000000001 36.5 35.0 40.0 29.5 41.0 66-67 34.876374999999996 36.0 34.0 39.0 29.0 41.0 68-69 34.435875 35.5 34.0 39.0 29.0 41.0 70-71 34.005624999999995 35.0 34.0 37.5 29.0 40.0 72-73 33.604 35.0 33.5 37.0 27.5 39.5 74-75 33.255875 35.0 33.5 37.0 27.5 39.0 76-77 32.007374999999996 34.5 31.5 35.5 25.5 37.0 78-79 32.451125000000005 35.0 33.0 36.0 26.0 37.0 80-81 32.337125 35.0 33.0 35.5 26.0 37.0 82-83 31.973 35.0 33.0 35.0 25.0 36.5 84-85 31.6995 35.0 33.0 35.0 24.5 36.0 86-87 31.41075 35.0 32.0 35.0 24.5 36.0 88-89 31.181625 35.0 32.0 35.0 23.5 35.5 90-91 30.9065 35.0 32.0 35.0 21.5 35.0 92-93 30.572 35.0 32.0 35.0 18.5 35.0 94-95 30.434624999999997 35.0 32.0 35.0 18.0 35.0 96-97 30.079875 34.5 31.0 35.0 5.0 35.0 98-99 29.539125 34.0 31.0 35.0 2.0 35.0 100-101 26.937875 32.5 25.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 5.0 10 3.0 11 12.0 12 11.0 13 8.0 14 4.0 15 10.0 16 13.0 17 8.0 18 12.0 19 14.0 20 21.0 21 6.0 22 12.0 23 20.0 24 17.0 25 38.0 26 26.0 27 35.0 28 52.0 29 62.0 30 74.0 31 88.0 32 121.0 33 123.0 34 217.0 35 316.0 36 566.0 37 966.0 38 1002.0 39 136.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 25.89030413309072 26.5401611645438 19.5996880686249 27.969846633740573 2 26.3 24.349999999999998 19.8 29.549999999999997 3 24.875 27.075 19.125 28.925 4 24.8 25.374999999999996 18.675 31.15 5 27.538769384692348 26.21310655327664 17.133566783391696 29.114557278639317 6 27.775 27.450000000000003 19.7 25.074999999999996 7 28.599999999999998 24.4 22.85 24.15 8 29.65 26.950000000000003 24.8 18.6 9 30.599999999999998 27.200000000000003 25.05 17.150000000000002 10-11 31.412499999999998 27.325 23.0375 18.224999999999998 12-13 28.8875 26.650000000000002 23.7 20.7625 14-15 26.9625 27.650000000000002 24.3875 21.0 16-17 27.3125 26.087500000000002 24.775 21.825 18-19 26.150000000000002 26.487500000000004 25.2375 22.125 20-21 24.837500000000002 27.224999999999998 25.4875 22.45 22-23 26.0375 26.0 25.362499999999997 22.6 24-25 25.162499999999998 27.0 25.937500000000004 21.9 26-27 25.0 27.150000000000002 25.374999999999996 22.475 28-29 25.650000000000002 26.650000000000002 24.175 23.525 30-31 24.4375 26.375 26.3625 22.825 32-33 26.125 26.2625 25.387500000000003 22.225 34-35 25.15 26.687499999999996 25.275 22.8875 36-37 25.75 26.7125 24.85 22.6875 38-39 24.9875 26.1625 25.9875 22.8625 40-41 24.9875 26.224999999999998 25.2375 23.549999999999997 42-43 25.1 27.1 25.45 22.35 44-45 26.075 26.437500000000004 25.174999999999997 22.3125 46-47 25.85 26.5875 24.224999999999998 23.3375 48-49 25.887500000000003 25.4875 25.9875 22.6375 50-51 24.762500000000003 27.6875 24.9125 22.6375 52-53 26.087500000000002 26.35 24.675 22.8875 54-55 25.5125 26.1 26.1125 22.275 56-57 25.9625 25.2125 25.25 23.575 58-59 25.362499999999997 27.3625 24.4 22.875 60-61 25.887500000000003 26.0375 25.324999999999996 22.75 62-63 25.887500000000003 26.937499999999996 24.325 22.85 64-65 25.45 27.1 23.9875 23.4625 66-67 25.624999999999996 26.8375 25.4 22.1375 68-69 25.137500000000003 26.6125 24.887500000000003 23.3625 70-71 25.837500000000002 27.1375 24.125 22.900000000000002 72-73 25.6 27.5125 25.15 21.7375 74-75 26.387500000000003 27.2625 23.9125 22.4375 76-77 26.25 26.987499999999997 24.275 22.4875 78-79 24.887500000000003 26.3 25.162499999999998 23.65 80-81 25.25 27.650000000000002 24.8 22.3 82-83 25.575 27.3 24.4875 22.6375 84-85 25.275 27.2625 25.112499999999997 22.35 86-87 25.275 27.5125 24.0375 23.175 88-89 25.374999999999996 27.750000000000004 23.4875 23.3875 90-91 25.362499999999997 27.175 25.0 22.4625 92-93 26.1125 28.175 23.7375 21.975 94-95 25.624999999999996 27.3125 23.8125 23.25 96-97 25.174999999999997 26.8625 24.15 23.8125 98-99 25.4625 27.9125 23.875 22.75 100-101 25.362499999999997 27.474999999999998 23.549999999999997 23.6125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.5 13 0.5 14 0.5 15 1.5 16 1.5 17 0.5 18 0.0 19 0.0 20 1.5 21 3.5 22 2.5 23 1.0 24 1.5 25 3.5 26 4.0 27 4.5 28 5.0 29 8.5 30 12.0 31 12.0 32 17.0 33 23.5 34 30.0 35 38.5 36 47.0 37 64.0 38 82.5 39 104.5 40 126.5 41 143.5 42 168.0 43 185.5 44 202.5 45 211.5 46 206.5 47 216.0 48 218.5 49 187.5 50 164.5 51 147.0 52 133.5 53 125.5 54 110.0 55 95.0 56 87.0 57 84.0 58 72.5 59 59.5 60 52.0 61 56.5 62 54.0 63 47.5 64 48.5 65 43.0 66 36.5 67 32.5 68 27.5 69 26.5 70 24.0 71 20.5 72 21.5 73 20.5 74 14.0 75 9.0 76 7.5 77 10.0 78 8.0 79 5.0 80 4.5 81 2.0 82 2.0 83 1.5 84 1.0 85 1.5 86 1.0 87 0.0 88 0.0 89 0.0 90 1.0 91 1.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.8249999999999997 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.78357830714648 97.45 2 1.0643689812468322 2.1 3 0.15205271160669032 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.16249999999999998 0.0 0.0 0.0 0.0 36-37 0.1875 0.0 0.0 0.0 0.0 38-39 0.25 0.0 0.0 0.0 0.0 40-41 0.325 0.0 0.0 0.0 0.0 42-43 0.425 0.0 0.0 0.0 0.0 44-45 0.5125 0.0 0.0 0.0 0.0 46-47 0.65 0.0 0.0 0.0 0.0 48-49 0.7375 0.0 0.0 0.0 0.0 50-51 0.85 0.0 0.0 0.0 0.0 52-53 1.0125 0.0 0.0 0.0 0.0 54-55 1.1375000000000002 0.0 0.0 0.0 0.0 56-57 1.3375 0.0 0.0 0.0 0.0 58-59 1.625 0.0 0.0 0.0 0.0 60-61 1.8624999999999998 0.0 0.0 0.0 0.0 62-63 2.125 0.0 0.0 0.0 0.0 64-65 2.4749999999999996 0.0 0.0 0.0 0.0 66-67 2.8 0.0 0.0 0.0 0.0 68-69 3.1500000000000004 0.0 0.0 0.0 0.0 70-71 3.5 0.0 0.0 0.0 0.0 72-73 3.975 0.0 0.0 0.0 0.0 74-75 4.425000000000001 0.0 0.0 0.0 0.0 76-77 5.0 0.0 0.0 0.0 0.0 78-79 5.4625 0.0 0.0 0.0 0.0 80-81 6.025 0.0 0.0 0.0 0.0 82-83 6.6125 0.0 0.0 0.0 0.0 84-85 7.225 0.0 0.0 0.0 0.0 86-87 7.9125 0.0 0.0 0.0 0.0 88-89 8.600000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317459 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317459_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.443 33.0 31.0 34.0 29.0 34.0 2 31.29175 33.0 31.0 34.0 28.0 34.0 3 31.7955 34.0 31.0 34.0 30.0 34.0 4 35.34125 37.0 35.0 37.0 33.0 37.0 5 35.3065 37.0 35.0 37.0 33.0 37.0 6 35.478 37.0 36.0 37.0 35.0 37.0 7 35.51625 37.0 37.0 37.0 35.0 37.0 8 35.56075 37.0 37.0 37.0 35.0 37.0 9 37.21075 39.0 38.0 39.0 35.0 39.0 10-11 37.26 39.0 38.0 39.0 35.0 39.0 12-13 37.224374999999995 39.0 38.0 39.0 35.0 39.0 14-15 38.672375 41.0 39.5 41.0 36.0 41.0 16-17 38.626125 41.0 39.5 41.0 35.5 41.0 18-19 38.538250000000005 41.0 39.0 41.0 35.0 41.0 20-21 38.454625 41.0 39.0 41.0 34.5 41.0 22-23 38.42825 41.0 39.0 41.0 34.5 41.0 24-25 38.410375 41.0 39.0 41.0 35.0 41.0 26-27 38.302375 41.0 39.0 41.0 34.5 41.0 28-29 38.1755 41.0 38.5 41.0 34.0 41.0 30-31 37.845124999999996 40.0 38.0 41.0 33.5 41.0 32-33 37.87975 40.0 38.0 41.0 33.0 41.0 34-35 37.812 40.0 38.0 41.0 33.0 41.0 36-37 37.7205 40.0 38.0 41.0 33.0 41.0 38-39 37.638125 40.0 38.0 41.0 33.0 41.0 40-41 37.718875 40.0 38.0 41.0 33.0 41.0 42-43 37.626000000000005 40.0 38.0 41.0 33.0 41.0 44-45 37.37175 40.0 37.5 41.0 32.5 41.0 46-47 37.288375 40.0 37.0 41.0 32.0 41.0 48-49 37.0555 40.0 37.0 41.0 31.5 41.0 50-51 36.448125000000005 39.5 36.0 40.5 31.0 41.0 52-53 36.338875 39.0 35.5 40.5 30.5 41.0 54-55 36.448875 40.0 35.0 41.0 31.0 41.0 56-57 36.314125000000004 39.0 35.0 41.0 30.5 41.0 58-59 36.106875 39.0 35.0 41.0 30.0 41.0 60-61 35.707750000000004 38.5 35.0 41.0 29.0 41.0 62-63 35.5015 38.0 35.0 40.5 29.0 41.0 64-65 35.016999999999996 37.0 35.0 40.0 28.5 41.0 66-67 34.999125 37.0 35.0 40.0 28.5 41.0 68-69 34.78175 36.5 35.0 39.5 29.0 41.0 70-71 34.466 36.0 35.0 39.0 29.5 41.0 72-73 34.076750000000004 35.5 34.0 39.0 29.0 41.0 74-75 33.687375 35.0 34.0 37.0 28.0 39.5 76-77 33.38225 35.0 34.0 37.0 28.0 39.0 78-79 33.039 35.0 34.0 36.5 27.0 39.0 80-81 32.759625 35.0 34.0 36.0 27.0 37.0 82-83 32.397999999999996 35.0 34.0 36.0 26.0 37.0 84-85 32.115375 35.0 33.5 35.0 25.5 37.0 86-87 31.976125000000003 35.0 33.5 35.0 26.0 36.0 88-89 31.632625 35.0 33.0 35.0 24.5 36.0 90-91 31.48225 35.0 33.0 35.0 24.5 36.0 92-93 31.320999999999998 35.0 33.0 35.0 23.5 35.5 94-95 31.1545 35.0 33.0 35.0 23.0 35.0 96-97 31.074 35.0 33.0 35.0 23.0 35.0 98-99 30.842624999999998 35.0 33.0 35.0 19.0 35.0 100-101 28.968 33.5 29.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 59.0 3 8.0 4 5.0 5 4.0 6 8.0 7 3.0 8 4.0 9 9.0 10 5.0 11 9.0 12 4.0 13 10.0 14 8.0 15 13.0 16 8.0 17 6.0 18 13.0 19 8.0 20 7.0 21 12.0 22 13.0 23 16.0 24 11.0 25 16.0 26 23.0 27 18.0 28 46.0 29 43.0 30 52.0 31 68.0 32 69.0 33 108.0 34 161.0 35 250.0 36 441.0 37 913.0 38 1261.0 39 288.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.799999999999997 11.85 27.825 31.525 2 26.8 10.424999999999999 24.474999999999998 38.3 3 23.0 13.375 30.375000000000004 33.25 4 24.975 11.325000000000001 26.125 37.574999999999996 5 25.31898924193145 14.16062046534901 25.21891418563923 35.30147610708031 6 26.1 17.925 29.099999999999998 26.875 7 19.325 24.15 39.324999999999996 17.2 8 17.7 25.374999999999996 35.85 21.075 9 18.05 28.749999999999996 34.0 19.2 10-11 19.1375 27.5625 32.487500000000004 20.8125 12-13 19.8375 27.200000000000003 31.337500000000002 21.625 14-15 20.674999999999997 26.724999999999998 30.7625 21.837500000000002 16-17 20.6125 26.487500000000004 29.037499999999998 23.8625 18-19 20.890111263907986 27.028378547318415 29.22865358169771 22.852856607075882 20-21 21.7375 26.237500000000004 27.8125 24.212500000000002 22-23 20.9 25.45 28.549999999999997 25.1 24-25 20.7625 26.4125 28.725 24.099999999999998 26-27 20.4625 26.35 27.8875 25.3 28-29 21.25 26.35 27.187499999999996 25.2125 30-31 20.5875 26.400000000000002 28.762500000000003 24.25 32-33 21.837500000000002 26.0375 28.4 23.724999999999998 34-35 20.875 25.8 27.950000000000003 25.374999999999996 36-37 20.7625 25.4875 28.975 24.775 38-39 22.0125 25.900000000000002 27.375 24.712500000000002 40-41 22.6375 25.55 26.375 25.4375 42-43 21.3875 25.687500000000004 27.725 25.2 44-45 21.625 26.724999999999998 25.662499999999998 25.9875 46-47 21.224999999999998 25.2 28.125 25.45 48-49 20.95 26.8625 28.025 24.1625 50-51 22.3875 25.387500000000003 26.687499999999996 25.5375 52-53 22.8375 25.887500000000003 27.125 24.15 54-55 20.875 26.575 27.725 24.825 56-57 22.0 26.025 26.637499999999996 25.337500000000002 58-59 21.212500000000002 25.424999999999997 27.0125 26.35 60-61 21.6125 26.2875 27.8125 24.2875 62-63 22.45 25.95 27.0125 24.587500000000002 64-65 22.7 24.962500000000002 27.1125 25.224999999999998 66-67 21.95 26.9125 26.825 24.3125 68-69 23.0 26.5625 26.3625 24.075 70-71 22.037499999999998 26.224999999999998 25.6 26.137500000000003 72-73 22.725 25.687500000000004 26.650000000000002 24.9375 74-75 22.025 26.387500000000003 26.437500000000004 25.15 76-77 23.2625 25.75 25.424999999999997 25.5625 78-79 22.45 26.85 26.5875 24.1125 80-81 22.975 26.5875 26.4125 24.025 82-83 23.1625 25.85 25.7 25.2875 84-85 23.3875 25.424999999999997 26.700000000000003 24.4875 86-87 24.1375 26.450000000000003 24.675 24.7375 88-89 24.175 26.3125 24.9 24.6125 90-91 23.9125 26.35 26.337500000000002 23.400000000000002 92-93 24.3875 26.625 24.625 24.3625 94-95 25.3 25.162499999999998 25.5375 24.0 96-97 24.462500000000002 25.775 26.8375 22.925 98-99 24.3 26.575 25.174999999999997 23.95 100-101 24.55 26.75 25.025 23.674999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 15.0 1 10.5 2 3.0 3 0.0 4 1.0 5 1.5 6 1.0 7 1.5 8 1.5 9 0.5 10 0.5 11 2.5 12 4.5 13 2.5 14 0.5 15 1.5 16 3.0 17 3.5 18 2.0 19 1.0 20 1.5 21 3.0 22 2.0 23 1.5 24 3.5 25 3.5 26 4.0 27 7.5 28 10.0 29 8.5 30 12.5 31 17.5 32 19.5 33 25.5 34 39.5 35 51.5 36 67.0 37 84.5 38 91.5 39 124.5 40 157.0 41 170.0 42 199.5 43 207.5 44 206.0 45 213.0 46 197.5 47 198.5 48 192.0 49 174.5 50 157.5 51 139.0 52 131.5 53 118.5 54 98.0 55 85.5 56 76.5 57 63.5 58 61.0 59 53.5 60 50.0 61 53.5 62 48.5 63 39.5 64 33.0 65 30.0 66 32.5 67 29.0 68 25.0 69 19.5 70 17.0 71 19.0 72 13.5 73 13.0 74 11.0 75 5.5 76 6.5 77 7.5 78 4.5 79 2.5 80 2.5 81 1.5 82 1.5 83 1.5 84 0.5 85 0.5 86 1.0 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0125 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44374209860936 98.32499999999999 2 0.37926675094816686 0.75 3 0.12642225031605564 0.375 4 0.0 0.0 5 0.025284450063211124 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025284450063211124 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 17 0.42500000000000004 No Hit TGGGGTTGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.16249999999999998 0.0 0.0 0.0 0.0 36-37 0.1875 0.0 0.0 0.0 0.0 38-39 0.25 0.0 0.0 0.0 0.0 40-41 0.325 0.0 0.0 0.0 0.0 42-43 0.4375 0.0 0.0 0.0 0.0 44-45 0.5375000000000001 0.0 0.0 0.0 0.0 46-47 0.675 0.0 0.0 0.0 0.0 48-49 0.7625 0.0 0.0 0.0 0.0 50-51 0.875 0.0 0.0 0.0 0.0 52-53 1.0125 0.0 0.0 0.0 0.0 54-55 1.1375000000000002 0.0 0.0 0.0 0.0 56-57 1.3375 0.0 0.0 0.0 0.0 58-59 1.6375000000000002 0.0 0.0 0.0 0.0 60-61 1.875 0.0 0.0 0.0 0.0 62-63 2.1125 0.0 0.0 0.0 0.0 64-65 2.45 0.0 0.0 0.0 0.0 66-67 2.7874999999999996 0.0 0.0 0.0 0.0 68-69 3.175 0.0 0.0 0.0 0.0 70-71 3.4875 0.0 0.0 0.0 0.0 72-73 3.9499999999999997 0.0 0.0 0.0 0.0 74-75 4.387499999999999 0.0 0.0 0.0 0.0 76-77 4.925 0.0 0.0 0.0 0.0 78-79 5.3625 0.0 0.0 0.0 0.0 80-81 5.9 0.0 0.0 0.0 0.0 82-83 6.4375 0.0 0.0 0.0 0.0 84-85 7.0 0.0 0.0 0.0 0.0 86-87 7.7 0.0 0.0 0.0 0.0 88-89 8.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1974965 spots for ERR3317459.sra Written 1974965 spots for ERR3317459.sra Read 1974965 spots for ERR3317459.sra Written 1974965 spots for ERR3317459.sra Read 1974965 spots for ERR3317459.sra Written 1974965 spots for ERR3317459.sra Read 1974965 spots for ERR3317459.sra Written 1974965 spots for ERR3317459.sra Read 1974965 spots for ERR3317459.sra Written 1974965 spots for ERR3317459.sra Read 1974965 spots for ERR3317459.sra Written 1974965 spots for ERR3317459.sra Read 1974965 spots for ERR3317459.sra Written 1974965 spots for ERR3317459.sra Read 1974965 spots for ERR3317459.sra Written 1974965 spots for ERR3317459.sra Read 1974965 spots for ERR3317459.sra Written 1974965 spots for ERR3317459.sra Read 1974965 spots for ERR3317459.sra Written 1974965 spots for ERR3317459.sra Read 1974965 spots for ERR3317459.sra Written 1974965 spots for ERR3317459.sra Read 1974965 spots for ERR3317459.sra Written 1974965 spots for ERR3317459.sra Read 1974965 spots for ERR3317459.sra Written 1974965 spots for ERR3317459.sra Read 1974965 spots for ERR3317459.sra Written 1974965 spots for ERR3317459.sra Read 1974965 spots for ERR3317459.sra Written 1974965 spots for ERR3317459.sra Read 1974969 spots for ERR3317459.sra Written 1974969 spots for ERR3317459.sra Read 1974965 spots for ERR3317459.sra Written 1974965 spots for ERR3317459.sra Read 1974965 spots for ERR3317459.sra Written 1974965 spots for ERR3317459.sra Read 1974965 spots for ERR3317459.sra Written 1974965 spots for ERR3317459.sra Read 1974965 spots for ERR3317459.sra Written 1974965 spots for ERR3317459.sra SRR ids: ['ERR3317459.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1j1me0ja ERR3317459.sra spots: 39499304 blocks: [[1, 1974965], [1974966, 3949930], [3949931, 5924895], [5924896, 7899860], [7899861, 9874825], [9874826, 11849790], [11849791, 13824755], [13824756, 15799720], [15799721, 17774685], [17774686, 19749650], [19749651, 21724615], [21724616, 23699580], [23699581, 25674545], [25674546, 27649510], [27649511, 29624475], [29624476, 31599440], [31599441, 33574405], [33574406, 35549370], [35549371, 37524335], [37524336, 39499304]] ERR3317459 file size 9505963 ERR3317459 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317459 ERR3317459_1.fastq ERR3317459_2.fastq Input file: ERR3317459_1.fastq Paired file: ERR3317459_2.fastq trimmed: ERR3317459-trimmed-pair1.fastq, ERR3317459-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 10:02:02 2024 >> started Tue Dec 10 10:02:42 2024 >> done (40.058s) 39499304 read pairs processed; of these: 304673 ( 0.77%) short read pairs filtered out after trimming by size control 781329 ( 1.98%) empty read pairs filtered out after trimming by size control 38413302 (97.25%) read pairs available; of these: 12072220 (31.43%) trimmed read pairs available after processing 26341082 (68.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 653 0.00% 19 754 0.00% 20 1160 0.00% 21 1439 0.00% 22 1716 0.00% 23 2472 0.01% 24 2787 0.01% 25 3468 0.01% 26 4366 0.01% 27 4893 0.01% 28 5742 0.01% 29 6868 0.02% 30 7845 0.02% 31 10038 0.03% 32 9803 0.03% 33 10560 0.03% 34 12998 0.03% 35 12989 0.03% 36 15032 0.04% 37 15780 0.04% 38 19025 0.05% 39 20302 0.05% 40 20120 0.05% 41 21654 0.06% 42 23086 0.06% 43 25496 0.07% 44 26328 0.07% 45 27234 0.07% 46 29144 0.08% 47 33270 0.09% 48 35189 0.09% 49 36514 0.10% 50 40564 0.11% 51 41446 0.11% 52 43182 0.11% 53 47420 0.12% 54 50934 0.13% 55 56950 0.15% 56 55940 0.15% 57 59849 0.16% 58 65647 0.17% 59 81869 0.21% 60 91482 0.24% 61 100822 0.26% 62 105719 0.28% 63 110476 0.29% 64 118273 0.31% 65 122203 0.32% 66 134382 0.35% 67 137273 0.36% 68 137374 0.36% 69 141897 0.37% 70 145100 0.38% 71 151626 0.39% 72 155874 0.41% 73 166922 0.43% 74 167990 0.44% 75 168153 0.44% 76 166814 0.43% 77 174172 0.45% 78 187947 0.49% 79 189705 0.49% 80 193331 0.50% 81 196110 0.51% 82 198954 0.52% 83 208514 0.54% 84 217690 0.57% 85 230784 0.60% 86 239909 0.62% 87 246265 0.64% 88 246393 0.64% 89 263870 0.69% 90 263716 0.69% 91 269725 0.70% 92 284426 0.74% 93 296459 0.77% 94 321978 0.84% 95 352059 0.92% 96 397046 1.03% 97 460995 1.20% 98 577473 1.50% 99 789132 2.05% 100 1950661 5.08% 101 26341082 68.57% 38413302 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=3.73 fanout-score-rank=19 prefix-density=0.49 prefix-fanout=3.1 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=15 fanout-score=235.56 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=27.1 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.81 fanout-score-rank=38 prefix-density=0.39 prefix-fanout=1.0 sequence=ATGCACTGCACTTGCCTGGTGTTGTCGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=350.97 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=14.8 sequence=TCTTCTTGAAGACTTCTTGCTCATCCGCTTCCAGCTTGGGAGTCAGGTTCTTGATGTAGCGCTTAATGTAGGCGACAAACTGCTTCTTGTCAAAAGCAGGTTGCTCCTGAAGACGGAAGGTGTCAACAATGTC ERR3317459 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 10:03:16 Started mapping on | Dec 10 10:03:16 Finished on | Dec 10 10:05:12 Mapping speed, Million of reads per hour | 1192.14 Number of input reads | 38413302 Average input read length | 191 UNIQUE READS: Uniquely mapped reads number | 35410765 Uniquely mapped reads % | 92.18% Average mapped length | 190.41 Number of splices: Total | 22591903 Number of splices: Annotated (sjdb) | 21458469 Number of splices: GT/AG | 22259630 Number of splices: GC/AG | 294443 Number of splices: AT/AC | 19693 Number of splices: Non-canonical | 18137 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.00% Deletion average length | 1.22 Insertion rate per base | 0.00% Insertion average length | 1.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2093398 % of reads mapped to multiple loci | 5.45% Number of reads mapped to too many loci | 38097 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.68% % of reads unmapped: other | 0.58% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1098558 1098558 1098558 N_multimapping 2093398 2093398 2093398 N_noFeature 1363769 2768748 33324942 N_ambiguous 912829 251018 13621 UnstrandedReadsAssigned:33134167 PositiveStrandReadsAssigned:32390999 NegativeStrandReadsAssigned:2072202 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=98 echo kmer=93 ERR3317459 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317459-trimmed-pair1.fastq ERR3317459-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,413,302 reads, 33,933,880 reads pseudoaligned [quant] estimated average fragment length: 187.93 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52973 ERR3317459.ke.tsv 35125 ERR3317459.se.tsv 88098 total ==> ERR3317459.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 749.419 0 0 PNS24247 1044 857.07 58.4342 3.12103 PNS24249 1928 1741.07 177.179 4.65847 PNS24246 1044 857.07 58.4342 3.12103 PNS24248 1044 857.07 58.4342 3.12103 PNS24244 1471 1284.07 261.519 9.32314 PNS24243 293 135.588 3 1.01286 KQK14069 1603 1416.07 6590.74 213.058 KQK14071 474 295.637 30.4244 4.71098 ==> ERR3317459.se.tsv <== BRADI_1g14170v3 7744 BRADI_1g53295v3 228 BRADI_1g59795v3 911 BRADI_1g07683v3 0 BRADI_1g00485v3 99 BRADI_1g20270v3 1612 BRADI_1g74790v3 401 BRADI_1g09890v3 12 BRADI_1g77505v3 415 BRADI_1g48960v3 0 ERR3317459 completed mapping pipeline successfully