Starting /dee2/code/volunteer_pipeline.sh ERR3317460 current disk space = 1524901806080 free memory = 1526848644 ERR3317460 SRAfilesize 247bff973dc4f4aa12b635ef884de7af ERR3317460.sra ERR3317460.sra file validated ERR3317460 is paired end ERR3317460 is conventional basespace ERR3317460 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317460_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.53825 34.0 31.0 34.0 30.0 34.0 2 32.25575 34.0 31.0 34.0 31.0 34.0 3 32.752 34.0 31.0 34.0 31.0 34.0 4 36.23325 37.0 37.0 37.0 35.0 37.0 5 36.27625 37.0 37.0 37.0 35.0 37.0 6 36.327 37.0 37.0 37.0 35.0 37.0 7 36.31125 37.0 37.0 37.0 35.0 37.0 8 36.27925 37.0 37.0 37.0 35.0 37.0 9 38.11675 39.0 39.0 39.0 37.0 39.0 10-11 38.034875 39.0 39.0 39.0 36.0 39.0 12-13 38.09475 39.0 39.0 39.0 37.0 39.0 14-15 39.58825 41.0 40.0 41.0 37.0 41.0 16-17 39.548874999999995 41.0 40.0 41.0 37.0 41.0 18-19 39.4645 41.0 39.5 41.0 36.0 41.0 20-21 39.3285 41.0 39.0 41.0 36.0 41.0 22-23 39.3015 41.0 39.0 41.0 36.0 41.0 24-25 39.301 41.0 39.0 41.0 36.0 41.0 26-27 39.11625 41.0 39.0 41.0 36.0 41.0 28-29 38.74025 40.0 38.0 41.0 35.0 41.0 30-31 38.592749999999995 40.0 38.0 41.0 34.5 41.0 32-33 38.46075 40.0 38.0 41.0 34.0 41.0 34-35 38.222624999999994 40.0 38.0 41.0 33.5 41.0 36-37 38.082875 40.0 38.0 41.0 33.0 41.0 38-39 37.901250000000005 40.0 38.0 41.0 33.0 41.0 40-41 37.728375 40.0 37.0 41.0 33.0 41.0 42-43 37.697 40.0 37.0 41.0 33.0 41.0 44-45 37.4165 40.0 36.5 41.0 31.5 41.0 46-47 37.275000000000006 40.0 36.5 41.0 32.0 41.0 48-49 37.057625 39.5 36.0 41.0 31.0 41.0 50-51 37.346000000000004 40.0 36.0 41.0 32.0 41.0 52-53 37.278625000000005 40.0 36.0 41.0 33.0 41.0 54-55 36.975624999999994 39.0 35.0 41.0 31.5 41.0 56-57 36.58175 39.0 35.0 41.0 31.0 41.0 58-59 36.17375 38.5 35.0 41.0 31.0 41.0 60-61 35.798125 37.5 35.0 40.0 30.0 41.0 62-63 35.470124999999996 37.0 35.0 40.0 30.0 41.0 64-65 35.103375 36.5 35.0 39.5 29.0 41.0 66-67 34.725625 36.0 34.0 39.0 29.0 41.0 68-69 34.356875 35.5 34.0 39.0 28.5 41.0 70-71 33.897999999999996 35.0 34.0 37.5 28.0 40.0 72-73 33.529375 35.0 34.0 37.0 27.0 39.0 74-75 33.1045 35.0 33.0 37.0 26.0 39.0 76-77 31.92775 34.5 31.5 35.5 25.0 37.0 78-79 32.293125 35.0 33.0 36.0 26.0 37.0 80-81 32.193375 35.0 33.0 35.0 26.0 37.0 82-83 31.88075 35.0 33.0 35.0 25.0 36.5 84-85 31.631625 35.0 33.0 35.0 24.5 36.0 86-87 31.255375 35.0 32.0 35.0 23.5 36.0 88-89 31.055500000000002 35.0 32.0 35.0 23.5 35.5 90-91 30.912750000000003 35.0 32.0 35.0 21.5 35.0 92-93 30.52875 34.5 31.5 35.0 18.5 35.0 94-95 30.255625000000002 34.5 31.0 35.0 16.0 35.0 96-97 29.887375 34.5 31.0 35.0 4.5 35.0 98-99 29.43225 34.0 31.0 35.0 2.0 35.0 100-101 27.086374999999997 32.5 25.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 2.0 9 6.0 10 6.0 11 11.0 12 6.0 13 9.0 14 6.0 15 14.0 16 8.0 17 13.0 18 13.0 19 11.0 20 18.0 21 12.0 22 16.0 23 17.0 24 22.0 25 28.0 26 33.0 27 43.0 28 55.0 29 55.0 30 59.0 31 81.0 32 122.0 33 140.0 34 206.0 35 331.0 36 555.0 37 988.0 38 985.0 39 127.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.537740760020824 26.31441957313899 19.104633003643936 27.04320666319625 2 24.575 24.55 19.400000000000002 31.474999999999998 3 24.55 27.125 19.025 29.299999999999997 4 27.025 25.825 17.599999999999998 29.549999999999997 5 28.199999999999996 23.875 17.7 30.225 6 28.1 27.375 19.925 24.6 7 29.925 23.799999999999997 22.475 23.799999999999997 8 30.275000000000002 27.025 23.95 18.75 9 32.1 27.1 24.55 16.25 10-11 31.8125 26.75 23.5625 17.875 12-13 28.487499999999997 26.775 24.5375 20.200000000000003 14-15 26.7125 27.05 24.6875 21.55 16-17 26.724999999999998 26.637499999999996 24.3125 22.325 18-19 26.1625 27.4125 24.962500000000002 21.462500000000002 20-21 25.4875 26.625 25.85 22.037499999999998 22-23 25.5375 26.125 24.962500000000002 23.375 24-25 24.2625 26.375 25.1 24.2625 26-27 26.290786348293537 26.503312914114264 24.49056132016502 22.715339417427177 28-29 25.2625 26.7125 24.3 23.724999999999998 30-31 25.9875 25.324999999999996 25.7 22.9875 32-33 24.637500000000003 27.0625 25.0125 23.2875 34-35 25.525 25.85 25.900000000000002 22.725 36-37 26.237500000000004 26.1625 25.0625 22.537499999999998 38-39 25.474999999999998 26.3125 25.0625 23.150000000000002 40-41 26.125 25.2875 26.0125 22.575 42-43 25.687500000000004 26.4625 25.5375 22.3125 44-45 25.55 26.55 25.362499999999997 22.537499999999998 46-47 25.162499999999998 25.95 25.05 23.8375 48-49 24.8625 26.924999999999997 24.925 23.2875 50-51 25.587500000000002 26.6625 25.3125 22.4375 52-53 25.874999999999996 26.487500000000004 24.3875 23.25 54-55 25.1875 26.75 25.2 22.8625 56-57 24.8125 26.6625 24.5375 23.9875 58-59 25.174999999999997 26.275 25.2625 23.2875 60-61 25.4 26.200000000000003 26.474999999999998 21.925 62-63 25.374999999999996 26.3 25.2125 23.1125 64-65 26.087500000000002 25.95 24.2875 23.674999999999997 66-67 25.5625 26.05 24.9875 23.400000000000002 68-69 25.474999999999998 27.05 24.7875 22.6875 70-71 25.7125 26.075 24.625 23.5875 72-73 25.687500000000004 26.525 24.6625 23.125 74-75 25.912499999999998 26.1125 24.95 23.025000000000002 76-77 25.5625 26.375 24.125 23.9375 78-79 25.587500000000002 25.724999999999998 25.7375 22.95 80-81 25.637500000000003 27.1625 24.212500000000002 22.9875 82-83 25.424999999999997 26.125 24.8125 23.6375 84-85 25.687500000000004 26.2625 24.587500000000002 23.4625 86-87 25.0625 26.85 24.9 23.1875 88-89 26.325 27.1125 23.974999999999998 22.5875 90-91 25.1875 27.275 24.5375 23.0 92-93 25.775 26.75 24.325 23.150000000000002 94-95 25.887500000000003 26.7125 24.2 23.200000000000003 96-97 25.362499999999997 26.8125 24.375 23.45 98-99 25.275 26.987499999999997 23.9 23.8375 100-101 25.8 26.650000000000002 23.0125 24.5375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 1.0 7 1.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.5 13 1.0 14 1.5 15 1.5 16 1.0 17 0.5 18 0.5 19 0.5 20 0.5 21 3.0 22 3.0 23 0.5 24 0.5 25 2.5 26 3.0 27 3.5 28 4.5 29 6.5 30 11.0 31 13.0 32 14.5 33 16.5 34 22.5 35 36.0 36 47.5 37 62.0 38 84.0 39 99.5 40 116.0 41 141.5 42 166.0 43 190.0 44 209.0 45 216.0 46 213.0 47 223.0 48 217.0 49 175.0 50 156.0 51 153.0 52 136.0 53 119.0 54 103.5 55 98.5 56 89.0 57 74.5 58 74.5 59 61.0 60 50.5 61 54.0 62 52.0 63 46.5 64 51.5 65 48.5 66 40.5 67 40.0 68 32.0 69 25.0 70 27.0 71 29.0 72 25.5 73 21.5 74 15.0 75 11.0 76 10.5 77 8.0 78 4.5 79 3.5 80 4.0 81 4.0 82 2.5 83 3.0 84 3.5 85 2.0 86 2.0 87 2.5 88 1.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0642387455741 97.925 2 0.7587253414264037 1.5 3 0.15174506828528073 0.44999999999999996 4 0.0 0.0 5 0.025290844714213456 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCGAGTTCGCGCCGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.0875 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.1375 0.0 0.0 0.0 0.0 30-31 0.16249999999999998 0.0 0.0 0.0 0.0 32-33 0.175 0.0 0.0 0.0 0.0 34-35 0.2 0.0 0.0 0.0 0.0 36-37 0.2375 0.0 0.0 0.0 0.0 38-39 0.2625 0.0 0.0 0.0 0.0 40-41 0.3125 0.0 0.0 0.0 0.0 42-43 0.35 0.0 0.0 0.0 0.0 44-45 0.42500000000000004 0.0 0.0 0.0 0.0 46-47 0.475 0.0 0.0 0.0 0.0 48-49 0.575 0.0 0.0 0.0 0.0 50-51 0.675 0.0 0.0 0.0 0.0 52-53 0.85 0.0 0.0 0.0 0.0 54-55 0.8875 0.0 0.0 0.0 0.0 56-57 1.025 0.0 0.0 0.0 0.0 58-59 1.1875 0.0 0.0 0.0 0.0 60-61 1.4 0.0 0.0 0.0 0.0 62-63 1.625 0.0 0.0 0.0 0.0 64-65 1.8625 0.0 0.0 0.0 0.0 66-67 2.3 0.0 0.0 0.0 0.0 68-69 2.6125 0.0 0.0 0.0 0.0 70-71 2.9375 0.0 0.0 0.0 0.0 72-73 3.4625000000000004 0.0 0.0 0.0 0.0 74-75 3.7375 0.0 0.0 0.0 0.0 76-77 4.0875 0.0 0.0 0.0 0.0 78-79 4.362500000000001 0.0 0.0 0.0 0.0 80-81 4.9 0.0 0.0 0.0 0.0 82-83 5.362500000000001 0.0 0.0 0.0 0.0 84-85 5.887499999999999 0.0 0.0 0.0 0.0 86-87 6.3875 0.0 0.0 0.0 0.0 88-89 6.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317460 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317460_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.40225 33.0 31.0 34.0 28.0 34.0 2 31.264 33.0 31.0 34.0 28.0 34.0 3 31.745 34.0 31.0 34.0 30.0 34.0 4 35.3095 37.0 35.0 37.0 33.0 37.0 5 35.32675 37.0 35.0 37.0 33.0 37.0 6 35.46225 37.0 36.0 37.0 35.0 37.0 7 35.487 37.0 36.0 37.0 35.0 37.0 8 35.51675 37.0 37.0 37.0 35.0 37.0 9 37.23625 39.0 38.0 39.0 35.0 39.0 10-11 37.1985 39.0 38.0 39.0 35.0 39.0 12-13 37.183625000000006 39.0 38.0 39.0 35.0 39.0 14-15 38.7645 41.0 40.0 41.0 36.0 41.0 16-17 38.61425 41.0 39.0 41.0 35.5 41.0 18-19 38.496625 41.0 39.0 41.0 35.0 41.0 20-21 38.351124999999996 41.0 39.0 41.0 34.5 41.0 22-23 38.393249999999995 41.0 39.0 41.0 35.0 41.0 24-25 38.360875 41.0 39.0 41.0 35.0 41.0 26-27 38.260125 41.0 39.0 41.0 34.0 41.0 28-29 38.108374999999995 40.5 38.0 41.0 34.0 41.0 30-31 37.79375 40.0 38.0 41.0 33.0 41.0 32-33 37.885999999999996 40.0 38.0 41.0 33.0 41.0 34-35 37.814 40.0 38.0 41.0 33.0 41.0 36-37 37.658625 40.0 38.0 41.0 33.0 41.0 38-39 37.560874999999996 40.0 38.0 41.0 33.0 41.0 40-41 37.64725 40.0 38.0 41.0 33.0 41.0 42-43 37.547875000000005 40.0 38.0 41.0 33.0 41.0 44-45 37.343 40.0 37.5 41.0 32.5 41.0 46-47 37.164500000000004 40.0 37.0 41.0 31.5 41.0 48-49 36.963625 40.0 36.5 41.0 31.5 41.0 50-51 36.331625 39.5 35.5 40.5 30.5 41.0 52-53 36.275000000000006 39.0 35.0 40.5 30.5 41.0 54-55 36.395624999999995 40.0 35.0 41.0 31.0 41.0 56-57 36.233000000000004 39.0 35.0 41.0 30.5 41.0 58-59 35.986000000000004 39.0 35.0 41.0 30.0 41.0 60-61 35.680499999999995 39.0 35.0 41.0 29.0 41.0 62-63 35.392875000000004 38.0 35.0 40.5 28.5 41.0 64-65 35.039874999999995 37.0 35.0 40.0 28.5 41.0 66-67 35.011125 37.0 35.0 40.0 29.0 41.0 68-69 34.820750000000004 37.0 35.0 39.5 29.5 41.0 70-71 34.44375 36.0 35.0 39.0 29.0 41.0 72-73 33.970875 35.5 34.5 39.0 28.0 40.5 74-75 33.61025 35.0 34.0 37.0 28.0 39.5 76-77 33.295874999999995 35.0 34.0 37.0 29.0 39.0 78-79 32.872 35.0 34.0 36.5 27.0 39.0 80-81 32.55925 35.0 34.0 36.0 27.0 37.0 82-83 32.291875000000005 35.0 34.0 35.5 26.0 37.0 84-85 32.10275 35.0 34.0 35.0 26.0 37.0 86-87 31.859875000000002 35.0 33.0 35.0 25.5 36.0 88-89 31.5315 35.0 33.0 35.0 24.0 36.0 90-91 31.514000000000003 35.0 33.0 35.0 24.5 36.0 92-93 31.347250000000003 35.0 33.0 35.0 24.0 35.5 94-95 31.182000000000002 35.0 33.0 35.0 22.5 35.0 96-97 31.035625000000003 35.0 33.0 35.0 21.5 35.0 98-99 30.802 35.0 33.0 35.0 17.5 35.0 100-101 28.955750000000002 33.5 29.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 61.0 3 6.0 4 3.0 5 6.0 6 7.0 7 3.0 8 8.0 9 8.0 10 7.0 11 8.0 12 12.0 13 6.0 14 7.0 15 12.0 16 14.0 17 9.0 18 15.0 19 9.0 20 14.0 21 8.0 22 6.0 23 9.0 24 15.0 25 20.0 26 22.0 27 25.0 28 32.0 29 27.0 30 45.0 31 64.0 32 95.0 33 91.0 34 184.0 35 257.0 36 431.0 37 856.0 38 1345.0 39 253.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.349999999999998 11.525 31.025000000000002 28.1 2 25.724999999999998 11.15 26.5 36.625 3 22.95 12.575 30.15 34.325 4 24.15 12.174999999999999 27.925 35.75 5 26.025 15.125 24.825 34.025 6 25.624999999999996 18.5 28.575 27.3 7 18.725 24.775 38.975 17.525 8 18.37959489872468 26.006501625406354 35.13378344586147 20.4801200300075 9 17.95448862215554 28.157039259814955 35.13378344586147 18.754688672168044 10-11 19.025 27.287499999999998 31.9875 21.7 12-13 18.86485810726341 27.3284160520065 32.51656457057132 21.29016127015877 14-15 20.075000000000003 25.7875 31.525 22.6125 16-17 21.077634704338042 25.765720715089387 29.141142642830353 24.01550193774222 18-19 19.117279319829958 26.65666416604151 30.220055013753438 24.006001500375092 20-21 20.54263565891473 26.456614153538382 29.044761190297574 23.95598899724931 22-23 21.152644080510065 25.015626953369168 28.641080135016878 25.19064883110389 24-25 20.0 26.200000000000003 30.1875 23.6125 26-27 21.7875 26.1 27.4125 24.7 28-29 19.975 27.200000000000003 27.537499999999998 25.2875 30-31 20.200000000000003 25.2 29.3875 25.2125 32-33 22.0125 25.3 29.349999999999998 23.3375 34-35 21.275 25.124999999999996 27.3875 26.2125 36-37 21.2375 26.174999999999997 27.525 25.0625 38-39 21.9625 25.937500000000004 27.150000000000002 24.95 40-41 21.85 25.124999999999996 27.375 25.650000000000002 42-43 20.9375 25.7 27.537499999999998 25.825 44-45 22.06801700425106 27.24431107776944 26.38159539884971 24.306076519129782 46-47 21.6929232308077 26.069017254313575 26.756689172293076 25.481370342585645 48-49 21.3625 26.3625 28.0625 24.212500000000002 50-51 21.6125 26.7625 26.937499999999996 24.6875 52-53 21.3875 25.874999999999996 27.462500000000002 25.275 54-55 21.55 26.174999999999997 28.537499999999998 23.7375 56-57 21.4875 25.474999999999998 27.425 25.6125 58-59 21.725 25.525 27.737499999999997 25.0125 60-61 21.3125 26.575 27.700000000000003 24.4125 62-63 22.3 26.5375 26.724999999999998 24.4375 64-65 22.525000000000002 25.8625 26.337500000000002 25.275 66-67 21.5 26.0625 28.275 24.1625 68-69 23.4625 25.7 25.8125 25.025 70-71 21.837500000000002 25.6125 26.487500000000004 26.0625 72-73 21.265158144768094 26.428303537942245 27.028378547318415 25.278159769971246 74-75 22.925 25.85 26.375 24.85 76-77 22.8125 26.0625 25.8125 25.3125 78-79 22.85 26.5125 26.887499999999996 23.75 80-81 23.1 26.450000000000003 26.375 24.075 82-83 23.0875 25.374999999999996 26.1125 25.424999999999997 84-85 22.787499999999998 26.05 27.187499999999996 23.974999999999998 86-87 24.212500000000002 26.237500000000004 25.0 24.55 88-89 22.7375 26.437500000000004 24.6 26.224999999999998 90-91 23.674999999999997 26.2875 26.637499999999996 23.400000000000002 92-93 23.7875 26.474999999999998 25.575 24.1625 94-95 23.7 25.624999999999996 26.2125 24.462500000000002 96-97 24.337500000000002 25.7875 26.437500000000004 23.4375 98-99 24.1125 25.55 26.1 24.2375 100-101 24.175 25.174999999999997 25.887500000000003 24.762500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 27.0 1 19.5 2 9.0 3 4.5 4 4.0 5 3.5 6 1.0 7 0.5 8 0.5 9 1.5 10 3.0 11 3.0 12 3.0 13 2.5 14 1.5 15 1.5 16 1.0 17 1.0 18 1.5 19 2.0 20 1.5 21 0.5 22 1.5 23 2.0 24 2.5 25 3.5 26 4.0 27 4.5 28 5.0 29 10.0 30 15.5 31 15.5 32 18.0 33 29.0 34 39.0 35 53.5 36 67.0 37 79.5 38 97.5 39 131.5 40 162.0 41 181.5 42 189.5 43 187.5 44 198.5 45 214.0 46 208.0 47 189.5 48 180.0 49 172.0 50 162.0 51 147.5 52 127.0 53 104.5 54 93.0 55 78.0 56 70.0 57 74.0 58 70.0 59 55.0 60 45.0 61 49.0 62 48.0 63 37.0 64 37.5 65 36.0 66 30.0 67 32.0 68 25.0 69 19.5 70 19.0 71 15.5 72 13.5 73 12.5 74 12.5 75 12.0 76 10.0 77 6.0 78 3.5 79 3.5 80 3.5 81 2.0 82 1.5 83 1.0 84 1.0 85 1.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.025 9 0.025 10-11 0.0 12-13 0.0125 14-15 0.0 16-17 0.0125 18-19 0.025 20-21 0.025 22-23 0.0125 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.025 46-47 0.025 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0125 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.15816326530611 97.175 2 0.7142857142857143 1.4000000000000001 3 0.025510204081632654 0.075 4 0.025510204081632654 0.1 5 0.025510204081632654 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025510204081632654 0.22499999999999998 >10 0.025510204081632654 0.8999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 36 0.8999999999999999 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 9 0.22499999999999998 No Hit TCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.0875 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.16249999999999998 0.0 0.0 0.0 0.0 38-39 0.1875 0.0 0.0 0.0 0.0 40-41 0.2625 0.0 0.0 0.0 0.0 42-43 0.30000000000000004 0.0 0.0 0.0 0.0 44-45 0.375 0.0 0.0 0.0 0.0 46-47 0.42500000000000004 0.0 0.0 0.0 0.0 48-49 0.525 0.0 0.0 0.0 0.0 50-51 0.625 0.0 0.0 0.0 0.0 52-53 0.8 0.0 0.0 0.0 0.0 54-55 0.8375 0.0 0.0 0.0 0.0 56-57 0.975 0.0 0.0 0.0 0.0 58-59 1.125 0.0 0.0 0.0 0.0 60-61 1.3250000000000002 0.0 0.0 0.0 0.0 62-63 1.5499999999999998 0.0 0.0 0.0 0.0 64-65 1.8 0.0 0.0 0.0 0.0 66-67 2.2375 0.0 0.0 0.0 0.0 68-69 2.5375 0.0 0.0 0.0 0.0 70-71 2.8499999999999996 0.0 0.0 0.0 0.0 72-73 3.3625 0.0 0.0 0.0 0.0 74-75 3.6375 0.0 0.0 0.0 0.0 76-77 4.0125 0.0 0.0 0.0 0.0 78-79 4.3125 0.0 0.0 0.0 0.0 80-81 4.85 0.0 0.0 0.0 0.0 82-83 5.2875 0.0 0.0 0.0 0.0 84-85 5.8125 0.0 0.0 0.0 0.0 86-87 6.325 0.0 0.0 0.0 0.0 88-89 6.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1931283 spots for ERR3317460.sra Written 1931283 spots for ERR3317460.sra Read 1931283 spots for ERR3317460.sra Written 1931283 spots for ERR3317460.sra Read 1931283 spots for ERR3317460.sra Written 1931283 spots for ERR3317460.sra Read 1931283 spots for ERR3317460.sra Written 1931283 spots for ERR3317460.sra Read 1931283 spots for ERR3317460.sra Written 1931283 spots for ERR3317460.sra Read 1931283 spots for ERR3317460.sra Written 1931283 spots for ERR3317460.sra Read 1931283 spots for ERR3317460.sra Written 1931283 spots for ERR3317460.sra Read 1931283 spots for ERR3317460.sra Written 1931283 spots for ERR3317460.sra Read 1931283 spots for ERR3317460.sra Written 1931283 spots for ERR3317460.sra Read 1931283 spots for ERR3317460.sra Written 1931283 spots for ERR3317460.sra Read 1931283 spots for ERR3317460.sra Written 1931283 spots for ERR3317460.sra Read 1931283 spots for ERR3317460.sra Written 1931283 spots for ERR3317460.sra Read 1931283 spots for ERR3317460.sra Written 1931283 spots for ERR3317460.sra Read 1931283 spots for ERR3317460.sra Written 1931283 spots for ERR3317460.sra Read 1931283 spots for ERR3317460.sra Written 1931283 spots for ERR3317460.sra Read 1931283 spots for ERR3317460.sra Written 1931283 spots for ERR3317460.sra Read 1931295 spots for ERR3317460.sra Written 1931295 spots for ERR3317460.sra Read 1931283 spots for ERR3317460.sra Written 1931283 spots for ERR3317460.sra Read 1931283 spots for ERR3317460.sra Written 1931283 spots for ERR3317460.sra Read 1931283 spots for ERR3317460.sra Written 1931283 spots for ERR3317460.sra SRR ids: ['ERR3317460.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zixpbhrx ERR3317460.sra spots: 38625672 blocks: [[1, 1931283], [1931284, 3862566], [3862567, 5793849], [5793850, 7725132], [7725133, 9656415], [9656416, 11587698], [11587699, 13518981], [13518982, 15450264], [15450265, 17381547], [17381548, 19312830], [19312831, 21244113], [21244114, 23175396], [23175397, 25106679], [25106680, 27037962], [27037963, 28969245], [28969246, 30900528], [30900529, 32831811], [32831812, 34763094], [34763095, 36694377], [36694378, 38625672]] ERR3317460 file size 9295234 ERR3317460 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317460 ERR3317460_1.fastq ERR3317460_2.fastq Input file: ERR3317460_1.fastq Paired file: ERR3317460_2.fastq trimmed: ERR3317460-trimmed-pair1.fastq, ERR3317460-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 10:01:47 2024 >> started Tue Dec 10 10:02:30 2024 >> done (43.077s) 38625672 read pairs processed; of these: 286294 ( 0.74%) short read pairs filtered out after trimming by size control 690121 ( 1.79%) empty read pairs filtered out after trimming by size control 37649257 (97.47%) read pairs available; of these: 11348230 (30.14%) trimmed read pairs available after processing 26301027 (69.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 595 0.00% 19 709 0.00% 20 1060 0.00% 21 1233 0.00% 22 1550 0.00% 23 2135 0.01% 24 2650 0.01% 25 3125 0.01% 26 3685 0.01% 27 4387 0.01% 28 4819 0.01% 29 5621 0.01% 30 6578 0.02% 31 8070 0.02% 32 8389 0.02% 33 9030 0.02% 34 11050 0.03% 35 11249 0.03% 36 12535 0.03% 37 13491 0.04% 38 15789 0.04% 39 17229 0.05% 40 17427 0.05% 41 18882 0.05% 42 19949 0.05% 43 21850 0.06% 44 22779 0.06% 45 23828 0.06% 46 25627 0.07% 47 28725 0.08% 48 30276 0.08% 49 31439 0.08% 50 34865 0.09% 51 35466 0.09% 52 37311 0.10% 53 40914 0.11% 54 44915 0.12% 55 50204 0.13% 56 49046 0.13% 57 51859 0.14% 58 56301 0.15% 59 73004 0.19% 60 82792 0.22% 61 90684 0.24% 62 95858 0.25% 63 101698 0.27% 64 108957 0.29% 65 112132 0.30% 66 124477 0.33% 67 125105 0.33% 68 125063 0.33% 69 129896 0.35% 70 132136 0.35% 71 139774 0.37% 72 145740 0.39% 73 154337 0.41% 74 154158 0.41% 75 154563 0.41% 76 152655 0.41% 77 160738 0.43% 78 173207 0.46% 79 172607 0.46% 80 177543 0.47% 81 181464 0.48% 82 183818 0.49% 83 192874 0.51% 84 201338 0.53% 85 214658 0.57% 86 221885 0.59% 87 227200 0.60% 88 228575 0.61% 89 243713 0.65% 90 245823 0.65% 91 252958 0.67% 92 267419 0.71% 93 281306 0.75% 94 305656 0.81% 95 334403 0.89% 96 379639 1.01% 97 443502 1.18% 98 559977 1.49% 99 771174 2.05% 100 1937082 5.15% 101 26301027 69.86% 37649257 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=27 prefix-density=0.32 prefix-fanout=2.0 sequence=AGGTACTGGACAATGTGGAAGCTGCCCATGTTCGGGTGCACCGACGCCACGCAGGTGCT criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=247.30 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=27.0 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=1.89 fanout-score-rank=33 prefix-density=0.47 prefix-fanout=1.0 sequence=ATGCACTGCACTTGCCTGGTGTTGTCGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=95.33 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=7.5 sequence=AGCTTCCTCTGTAATGTACATACCAATCACATCCACTCCTCGATCCACCATGCATCCATACACATAGCATGCATAACACTAGCACGGAGTAGTACTTTACAACACAAATTAAGTGCATTGTCGACCATTTCAACTAGAGAGACATATCGTCCCATCAATCAATTTTACATGCATGCA ERR3317460 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 10:03:07 Started mapping on | Dec 10 10:03:08 Finished on | Dec 10 10:05:17 Mapping speed, Million of reads per hour | 1050.68 Number of input reads | 37649257 Average input read length | 192 UNIQUE READS: Uniquely mapped reads number | 34626769 Uniquely mapped reads % | 91.97% Average mapped length | 191.18 Number of splices: Total | 22260550 Number of splices: Annotated (sjdb) | 21153251 Number of splices: GT/AG | 21930059 Number of splices: GC/AG | 293414 Number of splices: AT/AC | 18904 Number of splices: Non-canonical | 18173 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.00% Deletion average length | 1.21 Insertion rate per base | 0.00% Insertion average length | 1.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1999853 % of reads mapped to multiple loci | 5.31% Number of reads mapped to too many loci | 55554 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.72% % of reads unmapped: other | 0.85% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1213571 1213571 1213571 N_multimapping 1999853 1999853 1999853 N_noFeature 1320551 2814925 32465304 N_ambiguous 908004 259954 15125 UnstrandedReadsAssigned:32398214 PositiveStrandReadsAssigned:31551890 NegativeStrandReadsAssigned:2146340 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=98 echo kmer=93 ERR3317460 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317460-trimmed-pair1.fastq ERR3317460-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,649,257 reads, 32,939,210 reads pseudoaligned [quant] estimated average fragment length: 190.467 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,179 rounds 52973 ERR3317460.ke.tsv 35125 ERR3317460.se.tsv 88098 total ==> ERR3317460.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 746.932 0 0 PNS24247 1044 854.533 52.8496 2.88635 PNS24249 1928 1738.53 137.435 3.68935 PNS24246 1044 854.533 52.8496 2.88635 PNS24248 1044 854.533 52.8496 2.88635 PNS24244 1471 1281.53 274.016 9.9789 PNS24243 293 132.762 2 0.703059 KQK14069 1603 1413.53 5680.02 187.534 KQK14071 474 292.531 33.3961 5.32795 ==> ERR3317460.se.tsv <== BRADI_1g14170v3 6510 BRADI_1g53295v3 190 BRADI_1g59795v3 762 BRADI_1g07683v3 0 BRADI_1g00485v3 57 BRADI_1g20270v3 1478 BRADI_1g74790v3 539 BRADI_1g09890v3 16 BRADI_1g77505v3 461 BRADI_1g48960v3 0 ERR3317460 completed mapping pipeline successfully