Starting /dee2/code/volunteer_pipeline.sh ERR3317462 current disk space = 1524948348928 free memory = 1529674688 ERR3317462 SRAfilesize 34580269282e01644f52a5530354d011 ERR3317462.sra ERR3317462.sra file validated ERR3317462 is paired end ERR3317462 is conventional basespace ERR3317462 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317462_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.45825 34.0 31.0 34.0 31.0 34.0 2 32.31425 34.0 31.0 34.0 31.0 34.0 3 32.87725 34.0 31.0 34.0 31.0 34.0 4 36.375 37.0 37.0 37.0 35.0 37.0 5 36.405 37.0 37.0 37.0 35.0 37.0 6 36.416 37.0 37.0 37.0 35.0 37.0 7 36.40875 37.0 37.0 37.0 35.0 37.0 8 36.39875 37.0 37.0 37.0 35.0 37.0 9 38.24275 39.0 39.0 39.0 37.0 39.0 10-11 38.219375 39.0 39.0 39.0 37.0 39.0 12-13 38.15 39.0 39.0 39.0 37.0 39.0 14-15 39.6945 41.0 40.0 41.0 37.0 41.0 16-17 39.6525 41.0 40.0 41.0 37.0 41.0 18-19 39.53875 41.0 40.0 41.0 37.0 41.0 20-21 39.575625 41.0 40.0 41.0 37.0 41.0 22-23 39.49225 41.0 40.0 41.0 37.0 41.0 24-25 39.338499999999996 41.0 39.0 41.0 36.0 41.0 26-27 39.1195 41.0 39.0 41.0 35.5 41.0 28-29 38.934749999999994 40.5 39.0 41.0 35.0 41.0 30-31 38.69 40.0 38.0 41.0 35.0 41.0 32-33 38.52525 40.0 38.0 41.0 34.5 41.0 34-35 38.313875 40.0 38.0 41.0 34.0 41.0 36-37 38.076375 40.0 38.0 41.0 33.5 41.0 38-39 37.704125000000005 40.0 38.0 41.0 33.0 41.0 40-41 37.557874999999996 40.0 37.0 41.0 33.0 41.0 42-43 37.598 40.0 37.0 41.0 33.0 41.0 44-45 37.4355 40.0 37.0 41.0 32.0 41.0 46-47 37.13775 40.0 36.0 41.0 31.5 41.0 48-49 36.80025 40.0 35.5 41.0 30.5 41.0 50-51 37.161 40.0 36.0 41.0 32.0 41.0 52-53 37.0375 40.0 35.5 41.0 31.5 41.0 54-55 36.78375 39.0 35.0 41.0 31.5 41.0 56-57 36.464375000000004 39.0 35.0 41.0 31.0 41.0 58-59 36.121875 38.5 35.0 41.0 30.5 41.0 60-61 35.6425 37.5 35.0 40.5 29.5 41.0 62-63 35.366 37.0 35.0 40.0 29.5 41.0 64-65 34.919875000000005 36.5 34.0 39.5 29.0 41.0 66-67 34.445375 36.0 34.0 39.0 28.0 41.0 68-69 34.05825 35.5 34.0 39.0 27.5 41.0 70-71 33.658125 35.0 34.0 37.5 27.0 40.0 72-73 33.07475 35.0 33.0 37.0 26.0 39.0 74-75 32.613125 35.0 33.0 36.5 25.5 39.0 76-77 31.397750000000002 34.5 31.5 35.5 23.5 37.0 78-79 31.9295 35.0 32.5 36.0 24.5 37.0 80-81 31.740375 35.0 33.0 35.0 23.5 37.0 82-83 31.4355 35.0 33.0 35.0 23.0 36.5 84-85 31.141624999999998 35.0 32.5 35.0 20.5 36.0 86-87 30.898 35.0 32.0 35.0 20.0 36.0 88-89 30.637124999999997 35.0 32.0 35.0 19.0 35.5 90-91 30.336125000000003 35.0 32.0 35.0 13.5 35.0 92-93 30.02175 35.0 31.0 35.0 3.5 35.0 94-95 29.742125 34.5 31.0 35.0 2.0 35.0 96-97 29.366374999999998 34.0 31.0 35.0 2.0 35.0 98-99 28.933999999999997 34.0 30.5 35.0 2.0 35.0 100-101 26.37225 32.0 24.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 4.0 9 6.0 10 6.0 11 15.0 12 6.0 13 6.0 14 8.0 15 12.0 16 22.0 17 11.0 18 14.0 19 19.0 20 11.0 21 18.0 22 27.0 23 18.0 24 29.0 25 33.0 26 33.0 27 37.0 28 48.0 29 59.0 30 78.0 31 80.0 32 92.0 33 132.0 34 208.0 35 291.0 36 539.0 37 1038.0 38 984.0 39 113.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.275118358758547 26.17043661230931 18.93740136770121 27.617043661230934 2 27.750000000000004 24.3 17.25 30.7 3 26.474999999999998 26.474999999999998 18.025 29.025000000000002 4 26.950000000000003 25.825 16.400000000000002 30.825000000000003 5 29.799999999999997 24.0 16.175 30.025000000000002 6 28.449999999999996 27.525 17.8 26.224999999999998 7 31.25 23.05 22.525000000000002 23.175 8 31.85 26.325 23.775 18.05 9 32.0 27.675 24.275 16.05 10-11 33.037499999999994 26.8 21.725 18.4375 12-13 29.8875 25.974999999999998 24.4 19.7375 14-15 27.0125 26.174999999999997 25.25 21.5625 16-17 26.400000000000002 26.2875 25.7 21.6125 18-19 25.974999999999998 26.5875 25.825 21.6125 20-21 25.7125 26.775 25.324999999999996 22.1875 22-23 25.8125 27.0 25.3 21.8875 24-25 25.525 25.912499999999998 25.8125 22.75 26-27 25.112499999999997 26.887499999999996 25.2625 22.7375 28-29 27.0 25.2125 24.9875 22.8 30-31 25.2 25.7875 27.025 21.987499999999997 32-33 26.087500000000002 25.8625 25.1875 22.8625 34-35 25.1875 25.374999999999996 26.137500000000003 23.3 36-37 25.912499999999998 26.5 25.124999999999996 22.4625 38-39 24.8125 26.924999999999997 25.275 22.9875 40-41 26.625 26.424999999999997 24.3 22.650000000000002 42-43 24.925 26.337500000000002 25.974999999999998 22.7625 44-45 25.974999999999998 25.912499999999998 25.387500000000003 22.725 46-47 26.674999999999997 25.5625 25.224999999999998 22.537499999999998 48-49 25.224999999999998 26.7125 24.825 23.2375 50-51 25.224999999999998 26.4625 25.45 22.8625 52-53 26.05 26.437500000000004 24.4125 23.1 54-55 25.5 27.1625 25.3125 22.025 56-57 25.662499999999998 26.400000000000002 24.4375 23.5 58-59 26.375 25.874999999999996 25.3 22.45 60-61 25.662499999999998 26.937499999999996 25.137500000000003 22.2625 62-63 25.587500000000002 27.025 25.2875 22.1 64-65 26.05 26.087500000000002 24.725 23.1375 66-67 25.124999999999996 26.937499999999996 25.362499999999997 22.575 68-69 25.662499999999998 26.087500000000002 25.25 23.0 70-71 26.0125 26.950000000000003 24.6875 22.35 72-73 25.1875 27.1125 25.074999999999996 22.625 74-75 25.8625 26.8375 25.2125 22.0875 76-77 25.474999999999998 27.0 24.725 22.8 78-79 25.637500000000003 27.287499999999998 24.8125 22.2625 80-81 24.9 27.375 25.087500000000002 22.6375 82-83 25.900000000000002 26.0125 24.75 23.3375 84-85 24.5125 26.650000000000002 25.2625 23.575 86-87 25.5375 27.487499999999997 24.525 22.45 88-89 26.325 26.2875 24.325 23.0625 90-91 24.3 27.200000000000003 24.875 23.625 92-93 25.662499999999998 26.75 25.074999999999996 22.5125 94-95 25.124999999999996 27.0125 24.525 23.3375 96-97 25.4625 26.85 25.05 22.6375 98-99 26.187500000000004 26.700000000000003 24.0375 23.075000000000003 100-101 26.7125 26.137500000000003 24.275 22.875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.5 4 1.0 5 1.5 6 2.0 7 1.5 8 0.5 9 0.5 10 1.0 11 1.0 12 1.0 13 1.5 14 2.5 15 2.0 16 1.0 17 1.0 18 1.5 19 2.5 20 2.0 21 1.5 22 1.5 23 2.5 24 4.5 25 4.0 26 2.0 27 3.5 28 7.0 29 10.5 30 14.0 31 14.5 32 14.5 33 18.0 34 25.5 35 30.5 36 36.5 37 58.5 38 84.5 39 100.5 40 120.5 41 137.5 42 165.0 43 187.5 44 189.0 45 199.0 46 218.5 47 209.0 48 190.5 49 185.0 50 181.0 51 165.0 52 141.5 53 128.5 54 118.0 55 101.0 56 83.0 57 76.5 58 75.0 59 69.0 60 54.5 61 49.5 62 50.5 63 46.5 64 41.0 65 38.0 66 36.5 67 36.0 68 29.0 69 25.0 70 21.5 71 23.0 72 26.0 73 20.0 74 16.5 75 13.0 76 9.0 77 8.0 78 7.0 79 5.5 80 4.5 81 6.0 82 7.0 83 7.0 84 6.0 85 3.5 86 2.5 87 2.0 88 1.5 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.975 #Duplication Level Percentage of deduplicated Percentage of total 1 98.44348047971422 96.45 2 1.2248022454707832 2.4 3 0.22965042102577188 0.675 4 0.05103342689461597 0.2 5 0.025516713447307986 0.125 6 0.025516713447307986 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGCAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGAT 6 0.15 No Hit CAACACGGGGAAACTTACCAGGTCCAGACATAGCAAGGATTGACAGACTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.0875 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.1875 0.0 0.0 0.0 0.0 36-37 0.25 0.0 0.0 0.0 0.0 38-39 0.25 0.0 0.0 0.0 0.0 40-41 0.3125 0.0 0.0 0.0 0.0 42-43 0.35 0.0 0.0 0.0 0.0 44-45 0.3625 0.0 0.0 0.0 0.0 46-47 0.475 0.0 0.0 0.0 0.0 48-49 0.6 0.0 0.0 0.0 0.0 50-51 0.675 0.0 0.0 0.0 0.0 52-53 0.7124999999999999 0.0 0.0 0.0 0.0 54-55 0.7875000000000001 0.0 0.0 0.0 0.0 56-57 0.875 0.0 0.0 0.0 0.0 58-59 0.95 0.0 0.0 0.0 0.0 60-61 1.0875 0.0 0.0 0.0 0.0 62-63 1.175 0.0 0.0 0.0 0.0 64-65 1.2875 0.0 0.0 0.0 0.0 66-67 1.5625 0.0 0.0 0.0 0.0 68-69 1.6625 0.0 0.0 0.0 0.0 70-71 1.85 0.0 0.0 0.0 0.0 72-73 2.1125 0.0 0.0 0.0 0.0 74-75 2.5 0.0 0.0 0.0 0.0 76-77 2.675 0.0 0.0 0.0 0.0 78-79 2.9375 0.0 0.0 0.0 0.0 80-81 3.2125 0.0 0.0 0.0 0.0 82-83 3.55 0.0 0.0 0.0 0.0 84-85 3.8875 0.0 0.0 0.0 0.0 86-87 4.2875 0.0 0.0 0.0 0.0 88-89 4.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317462 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317462_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.05175 33.0 31.0 34.0 28.0 34.0 2 31.606 33.0 31.0 34.0 30.0 34.0 3 31.879 34.0 31.0 34.0 30.0 34.0 4 35.3085 37.0 35.0 37.0 33.0 37.0 5 34.4815 37.0 35.0 37.0 33.0 37.0 6 34.9775 37.0 35.0 37.0 32.0 37.0 7 35.383 37.0 36.0 37.0 33.0 37.0 8 35.54775 37.0 37.0 37.0 35.0 37.0 9 37.35325 39.0 39.0 39.0 35.0 39.0 10-11 37.30175 39.0 38.0 39.0 35.0 39.0 12-13 37.2495 39.0 38.0 39.0 35.0 39.0 14-15 38.74825 41.0 40.0 41.0 36.0 41.0 16-17 38.7485 41.0 39.0 41.0 36.0 41.0 18-19 38.623374999999996 41.0 39.0 41.0 35.0 41.0 20-21 38.6765 41.0 39.0 41.0 35.0 41.0 22-23 38.58675 41.0 39.0 41.0 35.0 41.0 24-25 38.441500000000005 41.0 39.0 41.0 35.0 41.0 26-27 38.37025 41.0 39.0 41.0 35.0 41.0 28-29 38.215374999999995 41.0 39.0 41.0 34.0 41.0 30-31 38.063500000000005 40.0 38.0 41.0 33.5 41.0 32-33 37.94075 40.0 38.0 41.0 33.5 41.0 34-35 37.791624999999996 40.0 38.0 41.0 33.0 41.0 36-37 37.646 40.0 38.0 41.0 33.0 41.0 38-39 37.667 40.0 38.0 41.0 33.0 41.0 40-41 37.72925 40.0 38.0 41.0 33.0 41.0 42-43 37.658125 40.0 38.0 41.0 33.0 41.0 44-45 37.581 40.0 38.0 41.0 33.0 41.0 46-47 37.452875 40.0 38.0 41.0 33.0 41.0 48-49 37.108875 40.0 37.0 41.0 31.5 41.0 50-51 36.312625 39.0 35.5 40.5 30.5 40.5 52-53 36.256 39.0 35.0 40.5 30.5 41.0 54-55 36.42075 39.0 35.0 41.0 30.0 41.0 56-57 36.301875 39.0 35.0 41.0 30.5 41.0 58-59 36.115624999999994 39.0 35.0 41.0 30.0 41.0 60-61 35.746 39.0 35.0 41.0 29.5 41.0 62-63 35.357124999999996 38.0 35.0 40.5 28.5 41.0 64-65 35.022375 37.0 35.0 40.0 28.0 41.0 66-67 35.090875 37.0 35.0 40.0 29.5 41.0 68-69 34.665375 36.5 35.0 39.0 29.0 41.0 70-71 34.362125 36.0 35.0 39.0 29.0 41.0 72-73 33.893625 35.0 34.5 38.5 28.0 40.5 74-75 33.4895 35.0 34.0 37.0 27.0 39.0 76-77 33.241125 35.0 34.0 37.0 27.5 39.0 78-79 32.795875 35.0 34.0 36.5 27.0 39.0 80-81 32.423625 35.0 34.0 36.0 26.0 37.0 82-83 32.214124999999996 35.0 34.0 36.0 26.0 37.0 84-85 32.018499999999996 35.0 34.0 35.0 25.5 36.5 86-87 31.802625 35.0 33.0 35.0 25.0 36.0 88-89 31.600625 35.0 33.0 35.0 24.5 36.0 90-91 31.388625 35.0 33.0 35.0 24.0 36.0 92-93 31.23625 35.0 33.0 35.0 23.0 35.0 94-95 31.0035 35.0 33.0 35.0 20.0 35.0 96-97 30.886875000000003 35.0 33.0 35.0 19.0 35.0 98-99 30.52375 35.0 33.0 35.0 7.5 35.0 100-101 28.55825 33.5 28.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 67.0 3 4.0 4 5.0 5 4.0 6 1.0 7 3.0 8 6.0 9 3.0 10 7.0 11 9.0 12 8.0 13 5.0 14 9.0 15 11.0 16 7.0 17 13.0 18 3.0 19 13.0 20 14.0 21 13.0 22 11.0 23 15.0 24 15.0 25 20.0 26 30.0 27 38.0 28 38.0 29 46.0 30 53.0 31 49.0 32 71.0 33 106.0 34 140.0 35 256.0 36 444.0 37 970.0 38 1258.0 39 235.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.34776082061546 11.183387540655492 28.221165874405806 30.24768576432324 2 26.525 11.924999999999999 26.55 35.0 3 22.7 12.75 30.975 33.575 4 23.849999999999998 11.799999999999999 26.775 37.574999999999996 5 24.11311053984576 15.475578406169666 25.115681233933163 35.29562982005142 6 25.324999999999996 18.025 30.625000000000004 26.025 7 18.275 23.3 41.099999999999994 17.325 8 17.474999999999998 25.25 35.925000000000004 21.349999999999998 9 17.424999999999997 28.749999999999996 35.125 18.7 10-11 19.162499999999998 26.487500000000004 33.550000000000004 20.8 12-13 18.4 27.462500000000002 32.75 21.3875 14-15 19.55 26.450000000000003 32.8125 21.1875 16-17 20.1875 25.85 30.5125 23.45 18-19 19.0625 26.325 31.65 22.9625 20-21 20.6875 25.25 29.6875 24.375 22-23 19.875 25.3 30.5375 24.2875 24-25 20.4625 25.337500000000002 30.875000000000004 23.325000000000003 26-27 20.837500000000002 26.337500000000002 29.2 23.625 28-29 20.6125 25.5625 28.3625 25.4625 30-31 20.325 25.45 30.412499999999998 23.8125 32-33 21.987499999999997 25.5625 28.762500000000003 23.6875 34-35 21.0625 25.412499999999998 28.712500000000002 24.8125 36-37 20.0 25.0 29.612500000000004 25.387500000000003 38-39 20.3375 24.887500000000003 28.962500000000002 25.8125 40-41 21.6625 24.7875 27.8375 25.7125 42-43 20.9875 26.8 28.287499999999998 23.925 44-45 21.224999999999998 26.700000000000003 27.3875 24.6875 46-47 21.425 26.125 27.075 25.374999999999996 48-49 20.9375 27.1 27.8875 24.075 50-51 21.925 26.900000000000002 27.1625 24.0125 52-53 22.037499999999998 25.887500000000003 26.2875 25.7875 54-55 20.2625 26.6625 28.5875 24.4875 56-57 21.7375 25.75 27.1625 25.35 58-59 21.3875 25.1875 28.0625 25.362499999999997 60-61 21.212500000000002 25.587500000000002 28.125 25.074999999999996 62-63 22.7625 25.7125 26.737499999999997 24.7875 64-65 21.15 25.0375 27.8125 26.0 66-67 21.4125 25.924999999999997 27.8375 24.825 68-69 22.05 26.0625 26.974999999999998 24.9125 70-71 22.075 25.4875 27.85 24.587500000000002 72-73 21.475 25.6125 28.0625 24.85 74-75 22.825 26.224999999999998 26.775 24.175 76-77 22.925 25.7125 26.2625 25.1 78-79 22.662499999999998 25.3 27.150000000000002 24.887500000000003 80-81 23.1625 26.0375 27.200000000000003 23.599999999999998 82-83 22.55 25.5375 26.637499999999996 25.275 84-85 23.974999999999998 25.724999999999998 26.700000000000003 23.599999999999998 86-87 23.3375 25.624999999999996 27.075 23.962500000000002 88-89 21.775 25.825 26.8 25.6 90-91 23.2125 26.200000000000003 26.137500000000003 24.45 92-93 23.275000000000002 25.775 26.8 24.15 94-95 23.0375 25.95 26.55 24.462500000000002 96-97 24.675 25.575 26.5875 23.1625 98-99 22.475 26.75 25.687500000000004 25.087500000000002 100-101 23.65 25.387500000000003 26.525 24.4375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 37.0 1 26.0 2 10.0 3 6.0 4 5.0 5 4.0 6 3.5 7 2.5 8 2.0 9 1.5 10 2.5 11 2.5 12 1.5 13 2.5 14 4.5 15 3.0 16 2.0 17 2.0 18 2.0 19 4.0 20 3.0 21 2.5 22 2.5 23 2.0 24 4.0 25 4.5 26 3.0 27 4.0 28 8.5 29 12.5 30 14.5 31 18.5 32 24.0 33 30.0 34 40.5 35 51.5 36 62.5 37 74.0 38 105.0 39 136.5 40 151.5 41 173.5 42 186.5 43 194.5 44 197.0 45 206.0 46 209.0 47 194.0 48 176.0 49 159.5 50 150.5 51 136.0 52 122.5 53 107.5 54 100.5 55 101.0 56 90.5 57 70.0 58 63.5 59 66.0 60 54.5 61 46.5 62 42.0 63 37.0 64 32.5 65 26.5 66 21.0 67 22.0 68 27.0 69 20.5 70 14.5 71 14.0 72 13.5 73 13.0 74 9.0 75 5.5 76 5.0 77 5.0 78 6.5 79 5.5 80 4.0 81 2.5 82 1.0 83 1.0 84 0.0 85 0.5 86 0.5 87 0.5 88 1.0 89 0.5 90 0.5 91 0.5 92 0.0 93 0.5 94 0.5 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 2.75 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.02489094175007 96.475 2 0.7441621760328458 1.4500000000000002 3 0.10264305876315115 0.3 4 0.025660764690787787 0.1 5 0.07698229407236336 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025660764690787787 1.3 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 52 1.3 No Hit CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 5 0.125 No Hit TCTTCTTATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.1875 0.0 0.0 0.0 0.0 36-37 0.25 0.0 0.0 0.0 0.0 38-39 0.25 0.0 0.0 0.0 0.0 40-41 0.3125 0.0 0.0 0.0 0.0 42-43 0.35 0.0 0.0 0.0 0.0 44-45 0.3625 0.0 0.0 0.0 0.0 46-47 0.475 0.0 0.0 0.0 0.0 48-49 0.6125 0.0 0.0 0.0 0.0 50-51 0.6875 0.0 0.0 0.0 0.0 52-53 0.7124999999999999 0.0 0.0 0.0 0.0 54-55 0.7875000000000001 0.0 0.0 0.0 0.0 56-57 0.875 0.0 0.0 0.0 0.0 58-59 0.95 0.0 0.0 0.0 0.0 60-61 1.0875 0.0 0.0 0.0 0.0 62-63 1.175 0.0 0.0 0.0 0.0 64-65 1.2875 0.0 0.0 0.0 0.0 66-67 1.5375 0.0 0.0 0.0 0.0 68-69 1.65 0.0 0.0 0.0 0.0 70-71 1.8125 0.0 0.0 0.0 0.0 72-73 2.0875 0.0 0.0 0.0 0.0 74-75 2.4749999999999996 0.0 0.0 0.0 0.0 76-77 2.6500000000000004 0.0 0.0 0.0 0.0 78-79 2.925 0.0 0.0 0.0 0.025 80-81 3.25 0.0 0.0 0.0 0.025 82-83 3.5625 0.0 0.0 0.0 0.025 84-85 3.9000000000000004 0.0 0.0 0.0 0.025 86-87 4.325 0.0 0.0 0.0 0.025 88-89 4.8125 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGGGAT 20 0.001835042 72.10443 1 >>END_MODULE Read 1696493 spots for ERR3317462.sra Written 1696493 spots for ERR3317462.sra Read 1696493 spots for ERR3317462.sra Written 1696493 spots for ERR3317462.sra Read 1696493 spots for ERR3317462.sra Written 1696493 spots for ERR3317462.sra Read 1696493 spots for ERR3317462.sra Written 1696493 spots for ERR3317462.sra Read 1696493 spots for ERR3317462.sra Written 1696493 spots for ERR3317462.sra Read 1696493 spots for ERR3317462.sra Written 1696493 spots for ERR3317462.sra Read 1696493 spots for ERR3317462.sra Written 1696493 spots for ERR3317462.sra Read 1696493 spots for ERR3317462.sra Written 1696493 spots for ERR3317462.sra Read 1696493 spots for ERR3317462.sra Written 1696493 spots for ERR3317462.sra Read 1696493 spots for ERR3317462.sra Written 1696493 spots for ERR3317462.sra Read 1696493 spots for ERR3317462.sra Written 1696493 spots for ERR3317462.sra Read 1696493 spots for ERR3317462.sra Written 1696493 spots for ERR3317462.sra Read 1696503 spots for ERR3317462.sra Written 1696503 spots for ERR3317462.sra Read 1696493 spots for ERR3317462.sra Written 1696493 spots for ERR3317462.sra Read 1696493 spots for ERR3317462.sra Written 1696493 spots for ERR3317462.sra Read 1696493 spots for ERR3317462.sra Written 1696493 spots for ERR3317462.sra Read 1696493 spots for ERR3317462.sra Written 1696493 spots for ERR3317462.sra Read 1696493 spots for ERR3317462.sra Written 1696493 spots for ERR3317462.sra Read 1696493 spots for ERR3317462.sra Written 1696493 spots for ERR3317462.sra Read 1696493 spots for ERR3317462.sra Written 1696493 spots for ERR3317462.sra SRR ids: ['ERR3317462.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cly74oen ERR3317462.sra spots: 33929870 blocks: [[1, 1696493], [1696494, 3392986], [3392987, 5089479], [5089480, 6785972], [6785973, 8482465], [8482466, 10178958], [10178959, 11875451], [11875452, 13571944], [13571945, 15268437], [15268438, 16964930], [16964931, 18661423], [18661424, 20357916], [20357917, 22054409], [22054410, 23750902], [23750903, 25447395], [25447396, 27143888], [27143889, 28840381], [28840382, 30536874], [30536875, 32233367], [32233368, 33929870]] ERR3317462 file size 8162555 ERR3317462 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317462 ERR3317462_1.fastq ERR3317462_2.fastq Input file: ERR3317462_1.fastq Paired file: ERR3317462_2.fastq trimmed: ERR3317462-trimmed-pair1.fastq, ERR3317462-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 10:01:10 2024 >> started Tue Dec 10 10:01:44 2024 >> done (34.744s) 33929870 read pairs processed; of these: 273555 ( 0.81%) short read pairs filtered out after trimming by size control 684077 ( 2.02%) empty read pairs filtered out after trimming by size control 32972238 (97.18%) read pairs available; of these: 9215102 (27.95%) trimmed read pairs available after processing 23757136 (72.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 536 0.00% 19 575 0.00% 20 801 0.00% 21 937 0.00% 22 1255 0.00% 23 1738 0.01% 24 2205 0.01% 25 2619 0.01% 26 3058 0.01% 27 3582 0.01% 28 3825 0.01% 29 4331 0.01% 30 4580 0.01% 31 5791 0.02% 32 6172 0.02% 33 6613 0.02% 34 7750 0.02% 35 8209 0.02% 36 9178 0.03% 37 9643 0.03% 38 11127 0.03% 39 11537 0.03% 40 12377 0.04% 41 13324 0.04% 42 13989 0.04% 43 15150 0.05% 44 16224 0.05% 45 17421 0.05% 46 18121 0.05% 47 20193 0.06% 48 21009 0.06% 49 21407 0.06% 50 23933 0.07% 51 24485 0.07% 52 25183 0.08% 53 27805 0.08% 54 32230 0.10% 55 34921 0.11% 56 34173 0.10% 57 37377 0.11% 58 39368 0.12% 59 55006 0.17% 60 64782 0.20% 61 70622 0.21% 62 75868 0.23% 63 80817 0.25% 64 84741 0.26% 65 89691 0.27% 66 98082 0.30% 67 98055 0.30% 68 100435 0.30% 69 102543 0.31% 70 105891 0.32% 71 111492 0.34% 72 123411 0.37% 73 120112 0.36% 74 120430 0.37% 75 119158 0.36% 76 120125 0.36% 77 124680 0.38% 78 137017 0.42% 79 133455 0.40% 80 136948 0.42% 81 141360 0.43% 82 140639 0.43% 83 151475 0.46% 84 151952 0.46% 85 163113 0.49% 86 168373 0.51% 87 175719 0.53% 88 178790 0.54% 89 199204 0.60% 90 191589 0.58% 91 201234 0.61% 92 211966 0.64% 93 227800 0.69% 94 249193 0.76% 95 268762 0.82% 96 302766 0.92% 97 362892 1.10% 98 501651 1.52% 99 646109 1.96% 100 1752402 5.31% 101 23757136 72.05% 32972238 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=36 prefix-density=0.33 prefix-fanout=2.0 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCC criterion=fanout-score sequence-density=0.08 sequence-density-rank=26 fanout-score=38.67 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=9.6 sequence=GAGGAGAAGAAACTTACAAGGATTCCCCTAGTAACGGCGAGCGAACCGGGAGCAGCCCAGCTTGAGAATCGGGCGGCC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=27 prefix-density=0.33 prefix-fanout=2.0 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=224.50 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=13.1 sequence=TCTTCTTGAAGACTTCTTGCTCATCCGCTTCCAGCTTGGGAGTCAGGTTCTTGATGTAGCGCTTAATGTAGGCGACAAACTGCTTCTTGTCAAAAGCAGGTTGCTCCTGAAGACGGAAGGTGTCAACAATGTCA ERR3317462 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 10:02:48 Started mapping on | Dec 10 10:02:48 Finished on | Dec 10 10:04:56 Mapping speed, Million of reads per hour | 927.34 Number of input reads | 32972238 Average input read length | 193 UNIQUE READS: Uniquely mapped reads number | 29245286 Uniquely mapped reads % | 88.70% Average mapped length | 192.48 Number of splices: Total | 18123787 Number of splices: Annotated (sjdb) | 17221688 Number of splices: GT/AG | 17853011 Number of splices: GC/AG | 240071 Number of splices: AT/AC | 15347 Number of splices: Non-canonical | 15358 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.00% Deletion average length | 1.21 Insertion rate per base | 0.00% Insertion average length | 1.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2006711 % of reads mapped to multiple loci | 6.09% Number of reads mapped to too many loci | 127705 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.56% % of reads unmapped: other | 2.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1944922 1944922 1944922 N_multimapping 2006711 2006711 2006711 N_noFeature 1184429 2803976 26991150 N_ambiguous 877693 268718 16171 UnstrandedReadsAssigned:27183164 PositiveStrandReadsAssigned:26172592 NegativeStrandReadsAssigned:2237965 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 ERR3317462 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317462-trimmed-pair1.fastq ERR3317462-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,972,238 reads, 27,590,534 reads pseudoaligned [quant] estimated average fragment length: 202.561 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52973 ERR3317462.ke.tsv 35125 ERR3317462.se.tsv 88098 total ==> ERR3317462.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 734.669 0 0 PNS24247 1044 842.439 35.0665 2.26632 PNS24249 1928 1726.44 114.675 3.61647 PNS24246 1044 842.439 35.0665 2.26632 PNS24248 1044 842.439 35.0665 2.26632 PNS24244 1471 1269.44 209.126 8.96941 PNS24243 293 123.673 1 0.440245 KQK14069 1603 1401.44 3759.29 146.049 KQK14071 474 281.254 24.1511 4.67526 ==> ERR3317462.se.tsv <== BRADI_1g14170v3 4520 BRADI_1g53295v3 256 BRADI_1g59795v3 800 BRADI_1g07683v3 0 BRADI_1g00485v3 113 BRADI_1g20270v3 2313 BRADI_1g74790v3 289 BRADI_1g09890v3 11 BRADI_1g77505v3 383 BRADI_1g48960v3 0 ERR3317462 completed mapping pipeline successfully